Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Genome evolution - tales of scales DNA to crops,months to billions of years, chromosomes to ecosystems

5,394 views

Published on

Pat Heslop-Harrison: Lecture to University of Malaya, Kuala Lumpur, Malaysia December 2013
Some DNA sequences are recognizable in all organisms and originated with the start of life. Others are unique to a single species. Some sequences are present in single copies in genomes, while others are present as millions of copies. The total amount of DNA in cells of an advanced eukaryotic species can vary over three orders of magnitude, and chromosome number can vary similarly. How can such huge variations be accommodated within the constraints of organism growth, development and reproduction? What are the evolutionary implications of these huge variations? How can we use the information to understand plant evolution, cytogenetics, genetics and epigenetics? What are the implications for future evolution, biodiversity and responses of plants during plant breeding or climate change?

Published in: Education, Technology
  • Be the first to comment

Genome evolution - tales of scales DNA to crops,months to billions of years, chromosomes to ecosystems

  1. 1. Genome evolution: tales of scales Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com and www.molcyt.org User & pw ‘visitor’ Twitter, YouTube and Slideshare: pathh1 20 December 2013
  2. 2. Proso millet (Panicum miliaceum): origins, genomic studies and prospects Pat Heslop-Harrison, Farah Badakshi and Harriet Hunt 14C Millet: Tacuinum Sanitatis via Wiki See Paris & Janick Ann Bot 2009-2013
  3. 3. Scales – metres, kilograms, seconds, numbers • Time: 3.5 billion years from the first living cells • Time: a generation in hybrids or stress response, or few years for plant breeding • Size: the amount of DNA from a few kb in viruses to variation in genome size between species • Size: from single base modifications to whole genome changes • Numbers: from 2 to 1000s of chromosomes • Area: from endemics to worldwide • Numbers: from a few plants to millions of ha • Scale (synonym): balancing or comparing
  4. 4. Plant genome size range > 2,300 x Genlisea aurea 1C = 63.6 Mb Paris japonica 20 µm Image wikicommons Chromosomes & data see Bennett et al. 2011 Ann Bot. 1C = 149,000 Mb
  5. 5. • • • • • • • • Genome sizes: reading them out base-by-base HIV type 1 Virus Bacteria (E. coli) Yeast Genlisea Arabidopsis Man Wheat Paris 2hr 40 min 53 days 138 days 2 years (20mm) 5 years 100 years 5 centuries 4 millennia (50m)
  6. 6. Repetitive DNA-Sequences form the largest part of the genome Species size Arabidopsis thaliana Sugar beet Beta vulgaris Broad bean Vicia faba Rye Secale cereale Onion Allium cepa Repetitive DNA >25% 63% 85% 92% 95% Genome 145 Mbp 758 Mbp 12000 Mbp 8800 Mbp 15100 Mbp These species are all diploid – 2x Human Homo sapiens 45% 3000 Mbp
  7. 7. Genes!
  8. 8. Major Genomic Components • • • • • • Tandem Repeats Simple Sequence Repeats Dispersed Repeats Functional Repeats Retroelements Genes Typical Fraction 10% 5% 10% 15% 50% 10%
  9. 9. 32 chromosomes DAPI; TTTAGGG telomere; 45S rDNA (1 major pair + minor) 5S rDNA (1 major + minor) 19/12/2013 Oil Palm Kubis & HH
  10. 10. • • • • Telomere (TTTAGGG)n Universal in eukaryotes with only a few exceptions Dynamic Number of repeats varies: tissue, age and chromosome Added by telomerase
  11. 11. 146 bp around histones
  12. 12. DNA sequence TE Centromere TE Tandem repeat monomer Transposable element Single copy DNA Kinetochore 147bp plus 5-70bp linker = 150-220bp Metaphase chromosome Spindle microtubules pulling apart chromatids Heslop-Harrison JS, Schwarzacher T. 2013. Nucleosomes and centromeric DNA packaging. Proc Nat Acad Sci USA. http://dx.doi.org/10.1073/pnas.1319945110. See also http://molcyt.org (Dec 2013)
  13. 13. Nucleosomes in Rye Digest intact chromatin (DNA + histone) with micrococcal nuclease for a few seconds, cutting between the nucleosomes. Then treat with protease and run on agarose gel. • Vershinin & Heslop-Harrison
  14. 14. • Three copies of the Arabidopsis 180 bp repeat showing (dark purple, stepped line) GC content of the sequence and (red, smooth line) sequence curvature. While GC and AT rich regions of a sequence generally correlate with curvature, the kinked region shows curvature with low GC content.
  15. 15. Arabidopsis cell line with a macro-chromosome Anti-phosphohistone H3 locates exclusively at the centromeres of the small chromosomes. In contrast, the antibody shows a weak but more uniform distribution along the full length of the macrochromosome
  16. 16. Phosphorylation of histone H3 and centromere activity, Schwarzacher
  17. 17. Major Genomic Components • • • • • • Tandem Repeats Simple Sequence Repeats Dispersed Repeats Functional Repeats Retroelements Genes Typical Fraction 10% 5% 10% 15% 50% 10%
  18. 18. Simple sequence repeats • GGCTACGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA GAGAGATGGTCGTAATG • Flanked by unique sequences (SSR/microsatellite markers) or • Part of other repetitive elements • Dispersed OR clustered in genome • SSR markers are dispersed!
  19. 19. Simple Sequence Repeats Sugar beet: Characteristic organization of each motif Schmidt, HH et a
  20. 20. Major Genomic Components • • • • • • Typical Fraction Tandem Repeats 10% Simple Sequence Repeats 5% Dispersed Repeats 10% Functional Repeats 15% Transposons/Retroelements 50% Genes 10%
  21. 21. Retroelement abundance and diversity in barley Gypsy elements are present in 25% of all BAC clones Barley gypsy: Vershinin, Druka, Kleinhofs, HH: PMB 2002; Brassica Alix & HH PMB 2005
  22. 22. Retroelement Organization Schmidt and Heslop-Harrison
  23. 23. Hansen & Heslop-Harrison
  24. 24. Malvern Hills: Wiki
  25. 25. gag en rt LINE Retrotransposon (non-LTR Retrotransposon) LTR gag rt int LTR Gypsy (LTR Retrotransposon) LTR gag int rt LTR Copia (LTR Retrotransposon) LTR gag Common structure of Retroelements rt int env LTR Retrovirus gag en rt LTR env – core particle compone – endonuclease – reverse transcriptase – long terminal repeat – envelope glycoprotein
  26. 26. Gene Full name Position Function ORF Open reading frame LTR Long terminal repeat Flanking retrotrans posin eae Regions of several hundred base pairs (250-4000) containing regulatory sequences for gene expression: Enhancer, promoter, transcription initiation (capping), transcription terminator and polyadenylation signal. The 3' LTR is not normally functional as a promoter, although it has exactly the same sequence arrangement as the 5' LTR. Instead, the 3' LTR acts in transcription termination and polyadenylation. As a consequence of the replication mechanism of the elements the two LTRs are identical at the time of integration. PBS Primer binding site About 18 nt at the end of the 5’LTR Binding site for a specific tRNA that functions as the primer for reverse transcriptase to initiate synthesis of the minus (-) strand of viral DNA Gag Groupspecific antigen Usually one of the first ORFs The gag precursor is cleaved by the viral protease (encoded by pol) into three mature products: the matrix (MA), the capsid (CA), and the nucleocapsid (NC) together forming the “capsid” which surrounds the genome – this complex is the virus core. Equivalent to the coat or transit protein. CP Coat protein Sequence capable of translation into a protein Equivalent to gag
  27. 27. Cys-His or C-H Cysteinehistidine repeat motif C-terminal of gag RNA or DNA binding site of the coat protein or gag (NEXT SLIDE!) Pol Polyprotein PR Aspartic protease pol Cleaves the full length mRNA. PR has a significant role in the processing of the polyprotein precursor into the mature form. RT Reverse transcrip tase pol RNA dependant DNA polymerase – translates RNA to DNA RH Ribonucleas e H/ RNase H pol RNase H is an enzyme that specifically degrades RNA hybridized to DNA. INT Integrase pol Enzyme responsible for removing two bases from the end of the LTR and inserting of the linear double stranded DNA copy of the retroelement genome into the host cell DNA Env Envelope gene After pol, but not in parare trovir us if MP=e nv Envelope genes mediate the binding of virus particles to their cellular receptors enabling virus entry, the first step in a new replication cycle. Thus the envelope genes give retroelements the ability to spread between cells and individuals - infectivity. Contain the proteins SU (surface) and TM (transmembrane). MP Movement protein Cell to cell movement, maybe equivalent to env TAV Transactivat Regulating translation of the polycistronic mRNA Contains aspartic protease, reverse transcriptase and RNase H and in some cases integrase
  28. 28. BSV Expression in Banana
  29. 29. Banana Streak ParaRetrovirus (BSV) • Double stranded DNA is infective • Insect vector • Unexpected epidemiology – Appearance after cold or tissue culture Glyn Harper & Roger Hull
  30. 30. Nuclear Copies of Banana Streak Virus in Banana
  31. 31. DNA Fibre Hybridization
  32. 32. Nuclear Copies of BSV in Banana Harper, HH et al., Virology 1999 … cf D’Hont et al., Nature, 2012
  33. 33. D’Hont et al. Nature 2012 doi:10.1038/natu re11241
  34. 34. Organelle sequences from chloroplasts or mitochondria Sequences from viruses, Agrobacterium or other vectors Plant Nuclear Genome Genes, regulatory and noncoding single copy sequences Repetitive DNA sequences Transgenes introduced with molecular biology methods 45S and 5S rRNA genes Other genes Repeated genes Structural components of chromosomes Dispersed repeats: Transposable Elements Retrotransposons amplifying via an RNA intermediate DNA transposons copied and moved via DNA Centromeric repeats Telomeric repeats Tandem repeats Subtelomeric repeats Blocks of tandem repeats at discrete chromosomal loci Simple sequence repeats or microsatellites DNA sequence components of the plant nuclear genome Heslop-Harrison & Schmidt 2012. Encyclopedia of Life Sciences
  35. 35. Genome • Genes and regulatory sequences make up a small proportion of the genome • The majority of DNA sequences in all higher eukaryotic genomes are repetitive sequences (50-90%) • FUNCTION? • Different sequence classes evolve at different rates
  36. 36. Aegilops tauschii (D genome donor) in Iran • 57 accessions collected – ssp. tauschii • • • • var. meyeri (18) var. tauschii (22) var. anathera (4) var. meyeri (12) Hojjatollah Saeidi, Mohammad Reza Rahiminejad, Sadeq Vallian, HH
  37. 37. Diversity in D genome • Microsatellite markers • 57 accessions of wild Aegilops tauschii (2n = 2x = 14; D genome) • No SSR markers were characteristic for taxa or geographical origin • High diversity present Saeidi, HH et al. Genet Resources & Crop Evolution 2005
  38. 38. Aegilops tauschii in Iran dpTa1Repetitive banding pattern does correlate with taxonomic grouping Dpta1 Hojjatollah Saeidi and Pat Heslop-Harrison
  39. 39. In situ repetitive DNA markers Markers characteristic for taxa Evolution of genes/DNA markers and repetitive (SSR are different) High diversity present Useful genes for wheat breeding
  40. 40. UPGMA dendrograms of the relationships based on IRAP analysis of (A) accessions of Ae. tauschii subsp Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042 Copyright restrictions may apply.
  41. 41. Demonstration of the direction of distribution (phylogeography) even over short geographic distances Phylogeography of Ae. tauschii Species originated from North of Iran and distributed in two directions. tauschii genotype passes from middle parts of Alborz Mountains and the distributed eastward and westward (direction 1) strangulata genotype are distributed along the Caspian Sea shore (direction 2)
  42. 42. susp. strangulata IRAP Cross-pollinating ancestor SSR FISH var. meyeri var. anathera Self-pollinating ancestor subsp. tauschii var. tauschii (Aegilops tauschii) An evolutionary model supported by molecular analyses Saeidi, HH et al. 2010
  43. 43. Sheep Ovis aries 2n=54 Muntiacus muntjak 2n=6, 7
  44. 44. Mammalian Chromosome Evolution • Mammals: 3,500 Mbp genome size remarkably conserved • Diploid chromosome numbers vary from 2n=6 (Indian muntjak) to 2n=134 (black rhinoceros). • From 2n=2 (an ant species), several species with 2n=4; to 2n>1000 in some ferns • No correlation of chromosome number with evolutionary position •  loss and gain occurs •
  45. 45. Bos taurus taurus vs Bos taurus indicus: 2n=60, XY But: B. taurus submetacentric Y B. indicus acrocentric Y
  46. 46. Do we see chromosome fusion now?
  47. 47. How many chromosomes? • Is the number constant in a species? • Cattle 2n=60 – but some individuals have 2n=58 or 2n=59 because two chromosomes fuse • Chromosomal evolution is happening now
  48. 48. The 1;29 fusion in cattle • Found in multiple breeds • Sometimes a founder effect (imported in one bull – e.g. Brahman to Africa) • But present even in major breeds • Limited effect on fertility • Probably positively selected for a difficult-toscore trait
  49. 49. • Chaves, Heslop-Harrison et al.
  50. 50. rob(1;29) translocation in cattle
  51. 51. Robertsonian Fusion (+ ?)
  52. 52. Bovid alpha-satellites and chromosome evolution
  53. 53. Complex satellite DNA reshuffing in the polymorphic t(1;29) Robertsonian translocation and evolutionarily derivedchromosomes in cattle R. Chaves1, F. Adega1, J. S. Heslop-Harrison2,et al. 2003
  54. 54. Sheep Ovis aries 2n=54, XY three pairs biarmed chromosomes 60 autosomal arms
  55. 55. • Goat • Sheep • Cattle • Chromosome homologies and centromeric fusions • Paul Popescu
  56. 56. Do we see chromosome fusion now? Molecular cytogenetic analysis and centromeric satellite organization of a novel 8;11 translocation in sheep: a possible intermediate in biarmed chromosome evolution. 2003. Chaves, Adega, Wienberg, Guedes-Pinto, Heslop-Harrison
  57. 57. Sheep 2n = 53, XY chromosome paints for 8 (yellow) and 11 (magenta; e), satellite I (yellow f), satellite II (cyan g). Chaves, HH et al. 2003
  58. 58. • Satellite I and II probes in the biarmed chromosomes of the sheep with 2n = 53, XY. • Chr (8;11), 2, 3, 1 are ordered from the most recent to the postulated evolutionarily oldest chromosome
  59. 59. • t(8;11) showed satellite I proximal on both arms with satellite II covering the centromere, while the evolutionarily derived fusion leading to Chrs 2 and 3 showed the opposite configuration, not obviously derived by a simple fusion. Chr 1 has lost the satellite I hybridization patterns. The novel t(8;11) provides strong evidence for an intermediate step in evolution of the biarmed chromosomes in sheep.
  60. 60. 2n=52, XY including 4 bi-armed chromosomes = 58 autosomal chromosome arms +X,Y • Syncerus caffer (African Buffalo or Cape Buffalo), a bovid from the family of the Bovineae
  61. 61. Tragelaphus strepsiceros or greater kudu 2n=31, X1 X2 Y 26 biarmed chromosomes, three acrocentric chromosomes (inc. X1), acrocentric X and a biarmed Y
  62. 62. sheep (Ovis aries) centromeric DNA satellite I-clone pOaKB9 (green-FITC) to metaphase chromosomes (chromosomal DNA stained with DAPI, presented in red pseudocolour) of the: (a) tribe Caprini, Ovis ammon (female, 2n=54,XX), (b) tribe Reduncini, Kobus leche (male, 2n=48,XY ), (c) tribe Hippotragini, Addax nasomaculatus (female, 2n=58,XX), (d ) tribe Alcelaphini, Connochaetes taurinus (male, 2n=58,XY ), (e) tribe Alcelaphini, Damaliscus hunteri (male, 2n=44,XY), ( f ) tribe Aepycerotini, Aepyceros melampus (female, 2n=60,XX).
  63. 63. Phylogenetic relationships and the primitive X chromosome inferred from chromosomal and satellite DNA analysis in Bovidae Raquel Chaves1,*, Henrique Guedes-Pinto1 and John S. Heslop-Harrison Proc Roy Soc B 2005
  64. 64. Young Brassica nigra (BB) Brassica carinata (BBCC) Brassica juncea (AABB) Brassica rapa (AA) Brassica oleracea (CC) Brassica napus (AACC) Old
  65. 65. Genome Specificity of a CACTA (En/Spm) Transposon B. napus (AACC, 2n=4x=38) B. oleracea (CC, 2n=2x=18) B. rapa (AA, 2n=2x=20)
  66. 66. Genome Specificity of a CACTA (En/Spm) Transposon B. napus (AACC, 2n=4x=38) – hybridized with C-genome CACTA element red B. oleracea (CC, 2n=2x=18) B. rapa (AA, 2n=2x=20) Alix & HH 2008
  67. 67. Genome Specificity of a CACTA (En/Spm) Transposon B. napus AJ 245479 AC 189496 B. rapa AC 189446 AC 189655 AC 189480 B ot1-1 large insertion specific of Bot1-1 B. oleracea large insertion in common between Bot1-2 and Bot1-3 B ot1-2 B ot1-3 Bo6L1-15 1010bp Rearrangement specific of Bot1-3
  68. 68. Genome Specificity of a CACTA (En/Spm) Transposon •Bot1 has encountered several rounds of amplification in the C (B. oleracea) genome only, playing a major role in the recent B. rapa and B. oleracea genome divergence •Bot1 carries a host S-locus associated SLL3 gene copy; is the transposon associated with SLL3 proliferation? Transposons are a driver of genome and genome evolution Alix et al. The CACTA transposon Bot1 played a major role in Brassica genome divergence and gene proliferation. Plant Journal December 2008
  69. 69. Dot-plots of genomic sequence from homologous pairs of BACs kb Brassica rapa (A genome) sequence Region of high homology between A and C sequence Region of low homology 4kb Insertion-gap pair: present in C genome 500bp Insertion-gap pair: present in A Microsatellite Transposed (moved) sequence An inversion Dotter plot of Brassica oleracea var. alboglabra clone BoB028L01 x Brassica rapa subsp. pekinensis clone KBrB073F16 with transposable elements. 19/12/2013 gi 195970379 vs. gi 199580153 Brassica oleracea (C genome) sequence 79
  70. 70. AAGTGAATGGATGCTCGCATTAGTTACTATGAGCCGATTCTCGCTCTTGCGAAAGCTAAAGAGGAAAAGGCCTTCGCATTGCAGAAG AGCTGGCTGCCAGCGAGCAAGAGGTTTTCAATATTGGCTTGTGGAAAATTTGTTGCCACTTTTGCTTTACTAAGGAATGAAATAATAC TTGTTTTTTTTTTTCATGGTTAATATTAGAAGATATAATTTCCTTTGAAGTTAGATTACGTTTCTTTATGTCGACGAAGTGAAGAAATATT GTCTTGTTTATGGTTCCTTCTAGTCCCAACCTTTTTTCAAGAAGGTACAGTACGTGTCAGGATTTATATGGATATACACA TATCCTATTGCGCAATTGTCAATAATAGCACTTTTTGAAGTTTATGTCTCAAAATAGCACTAGAAGGAGAAAGTCACAAAAATGATATT CATTAAAGGGTAAAATATCTCTTATATCCTTGGTTTAAAATTAAATAAACAAACAAAAATAAATAAAAATAAATAAAAAAAATGAAAAAA AAGAAATTTTTTTTATAGTTTCAGATTATATGTTTTCAGATTCGATTTTTTTTTTATTTTTTTATTTTTTTCGAAATTTTTTTTTTATTTTTTTTCA AATTTTCTTTTTATAATTTAAAAATACTTTTTGAAACTGTTTTTTTAATTTTTATTTTTTATTTTAGTATTTATTTTTTATAAAATTTTAAACCCT AATTCCTAAACCCCCACCCCTTAACTCTAAACCCTAAGGTTTGGATTAATTAACCCAATGGATATAAGTGTATATTTACCTCTTTAATGA AACCTATTTTTGTGACTTTGAATCTTGAGTGCTACTTTGGGAACAAAAACTTGGTTTGGTGCTATCCTAGTCTTTTTCTCTATCCTATT TACCACCCTTCTTTGTTCAATACTTTTTACAGTTTTTGGAAAGGACATGTTTCTTCTATCATCACTTAATGGTTATATATGTATGAGAAG TTTGAAAGAGATTACACTGTTTTGGAATATTAAAAAAAAAAGATATTACAAGATCTGATTTTGTTTGTATTTTAAAATTCTACCAAATC TCTCCTCAAAATCTTGGTCAAAGTCCAAAAATCCAAATATCTCAGTTAAATTCCACCAAATATGAAATCCTAAAACTTTTCCAAAATA GTTCAATAAGCCCTTAGTGTTTGGTG 542-bp BART1 TE 9-bp TSD (TATCCTATT) 6-bp TIR and 66-bp imperfect sub-TIR TSD TIR Brassica rapa with inserted 542bp sequence not present in B. oleracea 9bp TSD (red bold letters and arrow) and TIR (blue) Flanking primers used in PCR (next slide) as blue arrows on sequence 19/12/2013 TIR TSD 80
  71. 71. Insertion polymorphism in Brassica genomes shown by PCR with flanking primers A) Brassica rapa Brassica nigra Uncertain Brassica Brassica oleracea Brassica juncea 6X Brassicas Brassica napus Brassica carinata 1500 1000 800 600 400 200 HP1 1 2 3 4 5 6 HP1 7 8 9 10 11 12 13 14 15 16 17 18 HP1 19 20 21 22 23 24 25 26 27 28 29 30 HP1 31 32 33 34 35 36 37 38 B) Brassica rapa Brassica nigra Uncertain Brassica Brassica oleracea Brassica juncea Brassica napus Brassica carinata 6X Brassicas 1500 1000 800 600 400 200 HP1 1 2 3 4 5 6 HP1 7 8 9 10 11 12 13 14 15 16 17 18 HP1 19 20 21 22 23 24 25 26 27 28 29 30 HP1 31 32 33 34 35 36 37 38 Amplification with two primer sets (top and bottom) B. rapa (AA), B. juncea (AABB) and B. napus (AACC) include the longer fragment with insertion. B and C genomes have only the shorter, lower, fragment without insertion. 19/12/2013 81
  72. 72. hAT 141F hAT 185F 1 hAT 8002 246 TSD TIR 542-bp TE TIR TSD 790 hAT 177R 1000 B. rapa (4718648200) ………………..………………. B. oleracea (66,350-66750) B. rapa (AA) B. juncea (AABB) B. napus (AACC) Hexaploid Brassica (carinata x rapa) B. nigra (BB) ………………..………………. B. oleracea (CC) ………………..………………. ………………..………………. B. carinata (BBCC) B. oleracea (GK97361) ………………..………………. =A =T =C =G Schematic representation of insertion in Brassica rapa and other Brassica genomes. Green, red, blue and black boxes showing DNA motifs 19/12/2013 82
  73. 73. GACACTCTTCCCAATCGTTCATTCCTGACGTCATTAGGCAACCACCTCTGTTTTTCCCCACCACAAACAGTGAATACATCTCTCCTATCTCTC TCAGAATCGTCAGTGTTTGCTCTCCGTTGCTTACTCGCTTCTCTATGAATCCAACTTGCCCCGTCGTTACAAATCTGCCAAAAATAAACCAAA ACCAGTCCGGTCAATGAAAAAAATGCCAATGTTTCAGGTCTAGAAATTATCCACAACCCTAGTACTAAGATCTGAAATTTATGAGGGAGATAA ACATTTTTAGGTTAATTGTAAGAAAAAATATTTATAATTTTTGGGCCATGCAGCAAATACATAATATTTCCTTAAAATTTGGATTGTAAGAC TAATAGTGTTTGAGTATTTGATATTTGATATCTTTTAAAAAAGGAAACAAAATTGAATTTCTAAATAAGATTATATTTTTAAAATAAAACAAT AAAAATACATAAAAATAGTTACAAAAAAAAATATATATATTGTTAAACCGTTAGCAAATTAAATACTAAATCCTATACCCTAAATCCTAAACT CCAAACCCTAAATGATAAACCTTAAATCTTGGATAAACCGTAAACCATTGGAAAATTTTAAAACCTAATCATACATTAAAAACTAAAATTTAA TAACACTAAACCCTAAACCCTAATCACTAAACCCTAAACCCTTAGATAAATCATGAACCCTTGGATAAATCATAAACTCTAAATCAAAAATAT TTAAAATTAAACCCTAAAATATATAATTTATCCAAGGGCTCAGAGTTTACCCAAGGGTTTAGGGTTTAGTGATTAGGATTTAGGGTTTAGTGT TATTAAAATTTAGTTTTTAATGTATGATCTAAGGTTTAAGAGTTTCCAATGGTTTAGAGTTTATCCAAAGTTTAAGGTTTAACGTTTAGGGTT TAGGATTTAGGATTTAAGGTATAGGGTTTAGTATTTTGCTGAAGATTTAACAATATTAATTAATTTATTTTTTGTAACTATTTTTATATATTT TTATTATTTTATTTTTAAAATATAATATAATTTGGATATTCAATTTTATTTTCTTTTTTAAAAAATATCAAATATCAAATACTCAAACACTAT GGTTGGTGAACTTCTAGGTGTGAACCCAAGAATTACTCTTAATGTTTCATCCGATTGTGCTCAAAACCTTTCATGAACTGGCTAAAGCTGGAA ACATAGGATTAGTAAGAAGTAGAATCTTGTAAAGTACCTGTTATAGTATTCCTCTAAGAAAGTTCGATCAGTTTCGTCGTTTGTCTGATCGTT ACCAACAATCTCCATCAAAACATCGTTGTTTTCTTTGGTCACCGCGTCTCCGACAAGATTCTCTGTCTCCGAGCCATAAGCGACAAACTGTAT GATAGTGAGGTGAATCTGAGAGTTATTGATAAGCCACTGGCACAAGGACAGAGCCTCTCGATCATCAGGACCACCAAAGAACAATGCAGCGAC GTGTTGTACCGACTCAAACCCGTGAAGCTGGTGGAACCCGGTTATGTTTCTATCCACATAGATACCGATCG 790-bp TE TAAT, 4-bp TSD AGTGT/ACTCT, 5-bp TIRs & 370-bp IR Insertion sequence present in Brassica oleracea, missing from Brassica rapa. TSD highlighted red, green and blue; boxes 19/12/2013 shows remarkable internal structure with 370-bp inverted repeat near-filling the insert 83
  74. 74. Dotplot of 790bp insertion element showing inverted repeat structure. TIR at end of box shown 19/12/2013 84
  75. 75. Genes!
  76. 76. EvolutionEpigeneticsDevelopment Phenotype Cause Multiple abnormalities Chromosomal loss, deletion or translocation Gene mutation / base pair changes Telomere shortening (Retro)transposon insertion Retrotransposon activation SSR expansion Methylation Heterochromatinization Chromatin remodelling Histone modification Genetic changes non-reverting Changes seen, some reverting (Male/Female) Normal Differentiation
  77. 77. From Chromosome to Nucleus Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
  78. 78. Scales – metres, kilograms, seconds, numbers • Time: 3.5 billion years from the first living cells • Time: a generation in hybrids or stress response, or few years for plant breeding • Size: the amount of DNA from a few kb in viruses to variation in genome size between species • Size: from single base modifications to whole genome changes • Numbers: from 2 to 1000s of chromosomes • Area: from endemics to worldwide • Numbers: from a few plants to millions of ha • Scale (synonym): balancing or comparing
  79. 79. Genome evolution: tales of scales Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com and www.molcyt.org User & pw ‘visitor’ Twitter, YouTube and Slideshare: pathh1 20 December 2013
  80. 80. Scales of genome organization • • • • • Base-pair / sequence Gene Repeat sequence BAC Chromosome • Genetic mapping • Physical mapping
  81. 81. • Some DNA sequences are recognizable in all organisms and originated with the start of life. Others are unique to a single species. Some sequences are present in single copies in genomes, while others are present as millions of copies. The total amount of DNA in cells of an advanced eukaryotic species can vary over three orders of magnitude, and chromosome number can vary similarly. How can such huge variations be accommodated within the constraints of organism growth, development and reproduction? What are the evolutionary implications of these huge variations? How can we use the information to understand plant evolution, cytogenetics, genetics and epigenetics? What are the implications for future evolution, biodiversity and responses of plants during plant breeding or climate change?

×