Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Le séquençage haut débit: NGS, une révolution de la biologie moléculaire au service des patients

49 views

Published on

Présentation de MALLEK Ramdane
rmallek@lab-cerba.com
Biologie Moléculaire et génomique, Laboratoire Cerba, Saint-Ouen l'Aumône, France
Institut Pasteur de Tunis 6 Avril 2019

Published in: Health & Medicine
  • Be the first to comment

  • Be the first to like this

Le séquençage haut débit: NGS, une révolution de la biologie moléculaire au service des patients

  1. 1. 1 Le séquençage haut débit: NGS Une révolution de la biologie moléculaire au service des patients MALLEK Ramdane rmallek@lab-cerba.com Biologie Moléculaire et génomique, Laboratoire Cerba, Saint-Ouen l'Aumône, France IPT, Tunis 06 Avril 2019
  2. 2. UNE PETITE QUESTION POUR COMMENCER • Quelle est la taille (en bases) du génome ? • Humain : • Bactérie Escherichia coli : • Cytomégalovirus humain : 2
  3. 3. UNE PETITE QUESTION POUR COMMENCER • Quelle est la taille (en bases) du génome ? • Humain : 2,99 Milliards • Environ 20.000 gènes (1,2% du génome) de 0,9Kb (SRY) à 2,4Mb (DMD) • Environ 220.000 exons • Bactérie Escherichia coli : 4,64 Millions • Cytomégalovirus humain : 2360 3
  4. 4. UN PEU DE TERMINOLOGIE • Séquençage « ancienne génération » ou bas débit = Séquençage type Sanger  méthode de référence Permet de décrypter quelques centaines de pb à la fois • Séquençage de nouvelle génération (Next Generation Sequencing NGS) = Séquençage à très haut débit (High Throughput Sequencing HTS)= Séquençage massif en parrallèle MPS= dénomination unique « post Sanger » Permet de décrypter jusqu’à 6 milliards de pb à la fois 4
  5. 5. PROJET GÉNOME HUMAIN : 1990-2003 5 1866 1953 1977 1983 2003 2005 2008 2019: ILLUMINA annonce WGS entre 1000 et 2000 $
  6. 6. caryotype FISH SNP-arrays PCR LES OUTILS DIAGNOSTIQUES EN GÉNÉTIQUE Séquençage 6
  7. 7. SÉQUENÇAGE DE TYPE SANGER 7 https://www.youtube.com/watch?v=3M0PyxFPwkQ
  8. 8. SÉQUENÇAGE DE TYPE SANGER 8 • Avantages • Relativement peu coûteux (sauf rapporté à la base séquencée) • Equipement « standard » • Analyse des résultats simples (expertise limitée) • Les limites • Connaissance à priori de la cible (ce sont des produits de PCR qui sont séquencés et non pas la séquence originelle) • Faible débit • Analyse séquentielle individuelle • Pas de possibilité de multiplexage • Seuil de sensibilité (détection de variant minoritaire) faible : environ 20%
  9. 9. Par run Séquençage SANGER Séquençage NGS Petit débit Séquençage NGS Moyen débit Séquençage NGS Haut débit Instrument ABI3130XL Illimuna MiSeq Illimuna NextSeq Illimuna 1500 Nombre de reads 96 25 millions (single reads 36bp) 400 millions (single reads 75bp) 1.5 milliards (single reads 27bp) Capacité 300KB (300 10+3) 15GB (15 10+9) 120GB (120 10+9) 300GB (300 10+9) Durée 24H 56H (2*300bp) 29H (2*150bp) 11J (2*100bp) LA RUPTURE TECHNOLOGIQUE DU SÉQUENÇAGE A HAUT DÉBIT (NGS) A PARTIR DE 2006 X 400.000 X 1.000.000X 50.000
  10. 10. Par run Séquençage SANGER Séquençage NGS Petit débit Séquençage NGS Moyen débit Séquençage NGS Haut débit Instrument ABI3130XL Illimuna MiSeq Illimuna NextSeq Illimuna 1500 Nombre de reads 96 25 millions (single reads 36bp) 400 millions (single reads 75bp) 1.5 milliards (single reads 27bp) Capacité 300KB (300 10+3) 15GB (15 10+9) 120GB (120 10+9) 300GB (300 10+9) Durée 24H 56H (2*300bp) 29H (2*150bp) 11J (2*100bp) LA RUPTURE TECHNOLOGIQUE DU SÉQUENÇAGE A HAUT DÉBIT (MPS) AUDI A1 105CH ARIANE 5 21.500CH 10
  11. 11. SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ? 11 Pour ADN plusieurs approches possibles selon le besoin - Séquençage de 1 ou plusieurs gènes en même temps (panel) - Séquençage de l’exome ou WES - Séquençage de l’ensemble du génome WGS 1- Définir le besoin 2- Extraction des Acides nucléiques à partir de l’échantillon biologique (ADN ou ARN) Sang Total EDTA Plasma Tumeur FFPE Liquide Amniotique Biopsie liquide
  12. 12. SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ? 12 2- Préparation de l’échantillon = Préparation de la Librairie Adaptateur (INDEX)
  13. 13. SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ? 13 Flowcell= lame de verre sur laquelle va se fixer la librairie et avoir lieu de séquençage
  14. 14. SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ? 14
  15. 15. SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ? 15 *La librairie est ensuite amplifiée sur la Flowcell Librairie
  16. 16. SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ? 16 *Séquençage par synthèse:
  17. 17. 17
  18. 18. Etudier le génome La bioinformatique Si vous tapiez les lettres du génome humain à raison de 60 mots par minute durant 8 heures par jour, il vous faudrait... 50 ans pour le transcrire. Duffourd Yannis Bioinformaticien – CHU Dijon 18
  19. 19. Etudier le génome La bioinformatique La bioinformatique est l’ensemble des méthodes qui convertissent les données biologiques en informations. Approche multidisciplinaire impliquant l’informatique, les mathématiques, des méthodes statistiques, ainsi qu’une profonde compréhension des problématiques biologiques. Au delà de la prouesse technologique le NGS nécessite de disposer de compétences Bioinformatique
  20. 20. Etudier le génome La bioinformatique A quoi sert la bioinformatique ? TCGATCTGATGAAA GCATGATCGCATCGCATCACATATCT  Reconstituer ces séquences pour retrouver la séquence totale  Comparer la séquence à la séquence de référence  Identifier les variants  Déterminer leur impact Analyser un génome requiert environ 1 Milliard de séquences de 150 bases Duffourd Yannis Bio-informaticien – CHU Dijon  Mise en place d’un environnement Haute performance (HPC) avec serveurs sur site pour analyse et stockage des données
  21. 21. INTÉRÊT, CONSÉQUENCE ET IMPACT DE L’IMPLÉMENTATION DU NGS DANS UN LABORATOIRE 21 Réduction du coût de séquençage (par base*) Augmentation des capacités (par run) Possibilité de séquençage de novo Plus de gènes séquencés par patient Plus de patients séquencés par gène Nouvelles applications Réduction du temps au diagnostic ET/OU
  22. 22. QUESTION : POUR QUELLES APPLICATIONS ? 22
  23. 23. 23 Diagnostic prénatal Génétique constitutionnelle Maladies infectieuses Génétique somatique NGS
  24. 24. GÉNÉTIQUE CONSTITUTIONNELLE 24 Génétique constitutionnelle MPS  Les maladies rares - Une maladie est dite « rare » lorsqu’elle atteint moins de une personne sur 2 000. - Très nombreuses (plus de 8.000 décrites) *En Tunisie, plus de 400 maladies rares et environ 600 000 Tunisiens, soit une personne sur vingt serait atteinte d’une maladie rare, dont 85 % sont d’origine génétique. C’est ce que Sanofi Tunisie et l’Association Tunisienne des Maladies Lysosomales (ATML) ont annoncé lors de la 12ème Journée internationale des maladies rares, le 28 février 2019.
  25. 25. 25 Errance diagnostique (8 ans!): Séquençage ciblé des gènes MID1, MED12, UPF3B négatif ! Caryotype avec recherche de microdélétion 22q11.2 négatif WES le 01/03/2017: NM_001101.3(ACTB):c.1043C>T (p.Ser348Leu) hétérozygote de novo ACTB est à l’origine du Syndrome de Baraitser-Winter autosomique dominante Le Syndrome de Baraitser Winter est une maladie très rare, seulement 30 patients rapportés ! Déficience intellectuelle, retard global des acquisitions, retard du langage, retard de motricité, retard de croissance, dysmorphie, suspicion de malformation cardiaque. Maladie rare non reconnue = errance Diagnostique
  26. 26. La médecine de précision a pour objectif de proposer au patient un traitement adapté aux caractéristiques génétiques de sa tumeur MEDECINE DE PRECISION 26 Génétique Somatique (onco)
  27. 27. 27 Pathologie Biomarqueur Nombre de patients testés Pourcentage de patients présentant une altération moléculaire Thérapies ciblées associées  Cancer du sein Amplification d’HER2 10 832 19,7 % Trastuzumab, Pertuzumab Lapatinib  Cancer de l’estomac Amplification d’HER2 770 23,5 % Trastuzumab  Cancer colorectal Mutations de KRAS 21 923 43,7 % Panitumumab, Cetuximab Mutations de NRAS 17 814 5,2 % Panitumumab, Cetuximab  GIST Mutations de KIT 1 218 65,5 % Imatinib Mutations de PDGFRA 1 083 15,4 % Imatinib  Cancer du poumon Mutations d’EGFR 28 563 13,4 % Gefitinib, Erlotinib Afatinib, Osimeritinib Translocation d’ALK 12 434 3,1 % Crizotinib, Ceritinib Translocation de ROS1 17 680 1,0 % Crizotinib  Mélanome Mutation de BRAF V600 5 583 37,2 % Vemurafenib, Dabrafenib Cobimetinib, Trametinib  Leucémies Détection de BCR-ABL 10 263 16,7 % Imatinib, Dasatinib, Nilotinib, Bosutinib, Ponatinib Mutations d’ABL 1 014 22,4 % Imatinib, Dasatinib, Nilotinib, Bosutinib Ponatinib  Leucémie lymphoïde chronique Mutation de TP53 2 309 1 % Idelalisib  Ovaire Mutation somatique de BRCA 1 608 12,6 % Olaparib LES THERAPIES CIBLEES 27
  28. 28. VERS UNE MÉDECINE PERSONNALISÉE 28
  29. 29. NGS ET DIAGNOSTIC PRÉNATAL 29 Diagnostic prénatal MPS  Dépistage des trisomies 13, 18 et 21 par analyse de l’ADN fœtal circulant o Implémentation en routine clinique en France : Novembre 2013
  30. 30. Prélèvement tissulaire Biopsie liquide Vallée et Denis, Corresp Onco-Ther. 2013 ADN circulant (fragments) Cellules Tumorales Circulantes NGS ET « ADN CIRCULANT » (SUITE)  Concept de biopsie liquide : le patrimoine tumoral dans un tube 30
  31. 31. 31 EN CONCLUSION…
  32. 32. 32 LA SUITE : LES TECHNOLOGIES DE 3ÈME GÉNÉRATION Oxford Nanopores Single Molecule Real Time Sequencing Le passage de la molécule d’ADN à travers le nanopore provoque un différentiel osmotique mesurable et quantifiable en fonction de la base Utilisation d’un nanopore modifié dans une membrane
  33. 33. LA NOUVELLE ARME DE LA GÉOLOCALISATION ?
  34. 34. LA NOUVELLE ARME DE LA GÉOLOCALISATION ? 34 • Avec 1 connexion internet et utilisation de données publiques , il est capable d’identifier l’identité de personnes qui ont bénéficiés de tests génétiques

×