Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Utahbigmountain ancestrydnahbasehadoop9-7-2013billyetman-130928100600-phpapp02


Published on

Bill Yetman's Presentation at QCON about Ancestry and their Hadoop cluster and solution.

Published in: Technology
  • Be the first to comment

  • Be the first to like this

Utahbigmountain ancestrydnahbasehadoop9-7-2013billyetman-130928100600-phpapp02

  1. 1. Ancestry DNA at Scale Using Hadoop and HBase September 7, 2013 1
  2. 2. What does this talk cover? What does Ancestry do? How did our journey with Hadoop start? Using Hadoop as a Job Processor DNA Matching with Hadoop and HBase What’s next? 2
  3. 3. Mission 3
  4. 4. Discoveries Are the Key We are the world's largest online family history resource. • Over 30,000 historical content collections • 11 billion records and images • Records dating back to 16th century • 4 petabytes
  5. 5. Discoveries In Detail The “eureka” moment drives our business
  6. 6. Discoveries With DNA Spit in a tube, pay $99, learn your past Autosomal DNA tests Over 120,000 DNA samples 700,000 SNPs for each sample 6,000,000+ 4th cousin matches 150,000 100,000 Genotyped samples 50,000 - 6 DNA molecule 1 differs from DNA molecule 2 at a single base-pair location (a C/T polymorphism). (
  7. 7. What does the customer see? 7
  8. 8. Network Effect – Cousin Matches 3,500,000 Cousin Matches 3,000,000 2,500,000 2,000,000 1,500,000 1,000,000 500,000 2,000 10,053 21,205 40,201 Database Size 8 60,240 80,405 115,756
  9. 9. Where Did We Start? The process before Hadoop 9
  10. 10. What’s the Story? Cast of Characters (Scientists and Software Engineers) Scientists Software Engineers Think they can code: Think they are Scientists: • Linux • Biology in HS and College • MySQL • Math/Statistics • PERL and/or Python • Read science papers Pressures of a startup business – Release a product, learn, and then scale Sr. Manager and 5 developers and 4 member Science Team 10
  11. 11. DNA Input Raw Data (A,C,T,G,0): 3 123456789_RZZZZ2_XXXXXXH3Q7U7Q2B_YYYY84598-DNA 0 0 0 -9 C C G G G G G G A A A A C C G G A AAACCGGGGAAGGGAAAGGAGAACCAAAAGGAAAGGGGGCCGGAAGGGGGG G A A A A C G A A A A G A G A A A A G G G G G G A G G G G G G G … (continues for 700,000+ snips) Map File: 0 0 0 0 0 0 0 0 0 0 0 11 rs10005853 rs10015934 rs1004236 rs10059646 rs10085382 rs10123921 rs10127827 rs10155688 rs10162780 rs1017484 rs10188129 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
  12. 12. What Did “Get Something Running” Look Like? Old Version Run Watch Dog B Init Rakesh Results Processing 3) Poll status Finalize Creates run Reruns Heart beat 2) Enqueuer (dna validation) Pipeline Control Monitor Monitor 4) Disc Management (V2) Runs on AdMixture (Ethnicity) Beagle (Phasing) and GermLine (Matching) runs here “Beefy Box” Single Beefy Box – Only option is to scale Vertically 12
  13. 13. Measure Everything Principle • Start time, end time, duration in seconds, and sample count for every step in the pipeline. Also the full end-toend processing time • Put the data in pivot tables and graphed each step • Normalize the data (sample size was changing) #1 • Use the data collected to predict future performance 13
  14. 14. Challenges and Pain Points Performance degrades when DNA pool grows • Static (by batch size) • Linear (by DNA pool size) • Quadratic (Matching related steps) – Time bomb (Courtesy from Keith’s Potting) 14
  15. 15. Parallel Ethnicity Jobs Use Hadoop as a job processor 15
  16. 16. Why Attack Ethnicity First? • Smart developers, little Hadoop experience – Using Hadoop as a job scheduler and scaling the ethnicity step was easier than redesigning the matching step • AdMixture is a self-contained application – Reference panel, the users DNA, and a seed value for inputs – CPU intensive job that writes to stdout • Easy to split up the input • Looked hard enough at the matching problem to realize a HBase, MapReduce solution was realistic 16
  17. 17. Parallel Ethnicity Jobs Typical run of 1000 samples. Queue up one Hadoop job with 40 tasks, 25 samples per task Hadoop Cluster (20 x 4 slots x 96g) Server Server Server Server Server Server Server Server Server Server 1) Map Reduce Admixture Admixture Admixture Admixture Admixture Admixture 17 Admixture Admixture Admixture #2
  18. 18. 2012-03-01T21:18:03 2012-03-31T16:27:50 2012-04-17T07:31:45 2012-05-17T18:36:08 2012-06-16T15:23:27 2012-06-29T19:42:18 2012-07-11T11:29:56 2012-07-22T07:48:32 2012-07-30T06:56:26 2012-08-08T20:42:30 2012-08-17T20:58:55 2012-09-01T01:51:54 2012-09-11T21:53:05 2012-09-23T21:46:15 2012-10-02T14:28:50 2012-10-14T17:45:53 2012-11-04T02:43:36 2012-11-24T11:12:19 2012-12-12T17:35:15 2012-12-25T04:36:45 2013-01-14T15:18:38 2013-01-29T12:29:56 2013-02-11T10:22:02 2013-03-02T16:03:16 2013-03-29T00:19:36 2013-04-21T02:02:51 2013-05-17T01:34:00 2013-05-29T07:08:04 2013-06-13T13:50:45 2013-06-25T21:06:04 2013-07-17T15:15:27 2013-08-06T07:57:41 Results 1000 sample runs under 3 hours (one interesting bug) AdMixture Time (sec) 100000 90000 80000 70000 60000 50000 40000 30000 18 Sum of Run Size 20000 Admixture Time 10000 0
  19. 19. Freed up the “Beefy Box” • Moving AdMixture off left an additional 10 threads for phasing and matching • Memory was freed up for phasing and matching • Just moving AdMixture off, saved over 6 hours of processing on the single box – Bought us time 19
  20. 20. New Matching Algorithm Hadoop and HBase 20
  21. 21. What is GERMLINE? • • • GERMLINE is an algorithm that finds hidden relationships within a pool of DNA GERMLINE also refers to the reference implementation of that algorithm written in C++ You can find it here :
  22. 22. So what's the problem? • • • • GERMLINE (the implementation) was not meant to be used in an industrial setting • Stateless • Single threaded • Prone to swapping (heavy memory usage) • Generic • Used for any DNA (fish, fruit fly, human, …) GERMLINE performs poorly on large data sets Our metrics predicted exactly where the process would slow to a crawl Put simply : GERMLINE couldn't scale
  23. 23. Hours GERMLINE Run Times (in hours) 25 20 15 10 5 0 60000 57500 55000 52500 50000 47500 45000 42500 40000 37500 35000 32500 30000 27500 25000 22500 20000 17500 15000 12500 10000 7500 5000 2500 Number of samples
  24. 24. Hours Projected GERMLINE Run Times (in hours) 700 600 500 400 300 200 GERMLINE run times 100 Projected GERMLINE run times 0 122500 120000 117500 115000 112500 110000 107500 105000 102500 100000 97500 95000 92500 90000 87500 85000 82500 80000 77500 75000 72500 70000 67500 65000 62500 60000 57500 55000 52500 50000 47500 45000 42500 40000 37500 35000 32500 30000 27500 25000 22500 20000 17500 15000 12500 10000 7500 5000 2500 Number of samples
  25. 25. The Mission : Create a Scalable Matching Engine ... and thus was born (aka "Jermline with a J")
  26. 26. DNA Matching : How it Works The Input Starbuck : ACTGACCTAGTTGAC Adama : TTAAGCCTAGTTGAC Kara Thrace, aka Starbuck • • • Ace viper pilot Has a special destiny Not to be trifled with Admiral Adama • • Admiral of the Colonial Fleet Routinely saves humanity from destruction
  27. 27. DNA Matching : How it Works Separate into words 0 1 2 Starbuck : ACTGA CCTAG TTGAC Adama : TTAAG CCTAG TTGAC
  28. 28. DNA Matching : How it Works Build the hash table 0 1 2 Starbuck : ACTGA CCTAG TTGAC Adama : TTAAG CCTAG TTGAC ACTGA_0 : Starbuck TTAAG_0 : Adama CCTAG_1 : Starbuck, Adama TTGAC_2 : Starbuck, Adama
  29. 29. DNA Matching : How it Works Iterate through genome and find matches 0 1 2 Starbuck : ACTGA CCTAG TTGAC Adama : TTAAG CCTAG TTGAC ACTGA_0 : Starbuck TTAAG_0 : Adama CCTAG_1 : Starbuck, Adama TTGAC_2 : Starbuck, Adama Starbuck and Adama match from position 1 to position 2
  30. 30. Does that mean they're related? ...maybe
  31. 31. But wait... what about Baltar? Baltar : TTAAGCCTAGGGGCG Gaius Baltar • • • Handsome Genius Kinda evil
  32. 32. Adding a new sample, the GERMLINE way
  33. 33. The GERMLINE Way Step one : Rebuild the entire hash table from scratch, including the new sample 0 1 2 Starbuck : ACTGA CCTAG TTGAC Adama : TTAAG CCTAG TTGAC Baltar : TTAAG CCTAG GGGCG ACTGA_0 : Starbuck TTAAG_0 : Adama, Baltar CCTAG_1 : Starbuck, Adama, Baltar TTGAC_2 : Starbuck, Adama GGGCG_2 : Baltar
  34. 34. The GERMLINE Way Step two : Find everybody's matches all over again, including the new sample. (n x n comparisons) 0 1 2 Starbuck : ACTGA CCTAG TTGAC Adama : TTAAG CCTAG TTGAC Baltar : TTAAG CCTAG GGGCG ACTGA_0 : Starbuck TTAAG_0 : Adama, Baltar CCTAG_1 : Starbuck, Adama, Baltar TTGAC_2 : Starbuck, Adama GGGCG_2 : Baltar Starbuck and Adama match from position 1 to position 2 Adama and Baltar match from position 0 to position 1 Starbuck and Baltar match at position 1
  35. 35. The GERMLINE Way Step three : Now, throw away the evidence! 0 1 2 Starbuck : ACTGA CCTAG TTGAC Adama : TTAAG CCTAG TTGAC Baltar : TTAAG CCTAG GGGCG ACTGA_0 : Starbuck TTAAG_0 : Adama, Baltar CCTAG_1 : Starbuck, Adama, Baltar TTGAC_2 : Starbuck, Adama GGGCG_2 : Baltar Starbuck and Adama match from position 1 to position 2 Adama and Baltar match from position 0 to position 1 Starbuck and Baltar match at position 1 You have done this before, and you will have to do it ALL OVER AGAIN.
  36. 36. Not so good, right? Now let's take a look at the way.
  37. 37. The Starbuck 2_ACTGA_0 way Adama Step one : Update the hash table. 1 2_TTAAG_0 1 2_CCTAG_1 1 1 2_TTGAC_2 1 Already stored in HBase 1 Baltar : TTAAG CCTAG GGGCG New sample to add Add a column for every new sample for each user Key : [CHROMOSOME]_[WORD]_[POSITION] Qualifier : [USER ID] Cell value : A byte set to 1, denoting that the user has that word at that position on that chromosome
  38. 38. The 2_Starbuck 2_Starbuck 2_Adama way 2_Adama Step two : Find matches. { (1, 2), ...} { (1, 2), ...} Baltar and Adama match from position 0 to position 1 Baltar and Starbuck match at position 1 Already stored in HBase New matches to add “Fuzzy Match” the consecutive words. Worst case: Identical twins Key : [CHROMOSOME]_[USER ID] Qualifier : [CHROMOSOME]_[USER ID] Cell value : A list of ranges where the two users match on a chromosome
  39. 39. The Starbuck 2_ACTGA_0 way Adama Baltar 1 1 1 1 2_TTAAG_0 2_CCTAG_1 1 1 2_TTGAC_2 1 1 2_GGGCG_2 1 2_Starbuck 2_Adama { (1), ...} { (1), ...} { (1, 2), ...} 2_Baltar 2_Baltar { (1, 2), ...} 2_Starbuck 2_Adama { (0,1), ...} { (0,1), ...} These are the updated tables after adding Baltar’s information Only looking at 3 samples, chromosome #2, positions 0, 1, and 2 Very simple example of how the matching process works
  40. 40. But wait ... what about Zarek, Roslin, Hera, and Helo?
  41. 41. Run them in parallel with Hadoop! Photo by Benh Lieu Song
  42. 42. Parallelism with Hadoop • Batches are usually about a thousand people. • Each mapper takes a single chromosome for a single person. o • Three samples per task means 22 jobs with 334 tasks (1000/3) each MapReduce Jobs : Job #1 : Match Words • Updates the hash table Job #2 : Match Segments • Identifies areas where the samples match
  43. 43. How does Jermline perform? A 1700% improvement over GERMLINE! Along with more accurate results #3
  44. 44. Hours Run Times For Matching (in hours) 25 20 15 10 5 0 120000 117500 115000 112500 110000 107500 105000 102500 100000 97500 95000 92500 90000 87500 85000 82500 80000 77500 75000 72500 70000 67500 65000 62500 60000 57500 55000 52500 50000 47500 45000 42500 40000 37500 35000 32500 30000 27500 25000 22500 20000 17500 15000 12500 10000 7500 5000 2500 Number of samples
  45. 45. 2500 5000 7500 10000 12500 15000 17500 20000 22500 25000 27500 30000 32500 35000 37500 40000 42500 45000 47500 50000 52500 55000 57500 60000 62500 65000 67500 70000 72500 75000 77500 80000 82500 85000 87500 90000 92500 95000 97500 100000 102500 105000 107500 110000 112500 115000 117500 120000 Hours Run Times For Matching (in hours) 180 160 140 120 100 GERMLINE run times 80 60 Jermline run times 40 Projected GERMLINE run times 20 0 Number of samples
  46. 46. Incremental Changes Over Time • Support the business, move incrementally and adjust • After H2, pipeline speed stays flat • 46 (Courtesy from Bill’s plotting)
  47. 47. Dramatically Increased our Capacity Bottom line : Without Hadoop and HBase, this would have been expensive and difficult. • Previously, we ran GERMLINE on a single "beefy box". • 12-core 2.2GHZ Opteron 6174 with 256GB of RAM • We had upgraded this machine until it couldn't be upgraded any more. • Processing time was unacceptable, growth was unsustainable. • To continue running GERMLINE on a single box, we would have required a vastly more powerful machine, probably at the supercomputer level – at considerable cost! • Now, we run Jermline on a cluster. • 20 X 12-core 2GHZ Xeon E5-2620 with 96GB of RAM • We can now run 16 batches per day, whereas before we could only run one. • Most importantly, growth is sustainable. To add capacity, we need only add more nodes.
  48. 48. What’s Next? Hadoop and HBase 48
  49. 49. Continue to Evolve the Software • Azkaban for job control – Nearly complete • Phasing – Still runs on the “Beefy Box”, 1000 samples take over 11 hours – Total run time for 1000 samples is about 14 hours. – Re-implement with HBase, MapReduce, Hadoop • Version Updates – New algorithms require us to re-run the entire DNA pool – Burst capacity to the cloud • Machine Learning – Matching (V2) and Ethnicity (V3) both would benefit from a Machine Learning approach 49
  50. 50. End of the Journey (for now) - Questions? 50
