SlideShare a Scribd company logo
1 of 32
Download to read offline
Molecular Biology & Genetics-I
Lecture 1
By Dr. Iqra Munir
Nucleotides and Nucleosides
BASE NUCLEOSIDE DEOXYNUCLEOSIDE
Adenine Adenosine 2-deoxyadenosine
Guanine Guanosine 2-deoxyguanosine
Cytosine Cytodine 2-deoxycytodine
Uracil Uridine Not usually found
Thymine Not usually found 2-deoxythymidine
Nucleotides are nucleosides + phosphate
make up 13-34% of the dry weight in bacteria
deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)
O
C C
C C
Base
H
H or OH
H H
H
H
CH2
O
P
OH
O
HO
Nucleotide: a building block
Sugar:
• RNA – ribose (OH)
• DNA – deoxyribose (H)
Bases:
• adenine (A), cytosine (C), guanine (G),
thymine (T)
• RNA uses uracil (U) instead of thymine
Nucleoside: base + sugar
• certain nucleotides serve as a storage of energy and reducing power
e.g. ATP -> ADP -> AMP
hydrolysis (energy is released)
Nucleic Acids
DNA Stabilization– Complementary
Base Pairing
The Double Helix
•A DNA molecule consists of two strands of nucleotide
monomers running in opposite directions and coiled into
a double helix
• DNA nucleotide
• A five-carbon sugar (deoxyribose)
• Three phosphate groups
• One nitrogen-containing base (adenine, thymine, guanine, or cytosine)
The Double Helix
• Two double-helix strands are held together by hydrogen bonds
between nucleotide bases
• Chargaff’s rules
• Bases of the two DNA strands in a double helix pair in a consistent way:
• A = T and C = G
• Proportions of A and G vary among species
Patterns of Base Pairing
• The order of bases (DNA sequence) varies among species
and among individuals
• Each species has characteristic DNA sequences
• DNA sequence
• The order of nucleotide bases in a strand of DNA
• ATGGGGCTTACCTTAGTACCAA
DNA Stabilization-Base Stacking
• Figure . Base stacking in a single strand of B form
DNA.
• Space filling spheres are used to indicate the van der
Waals surfaces.
• Carbon atoms are highlighted in black, nitrogen in
blue, phosphorous in yellow and oxygen in red.
• The phosphodiester backbone is indicated with a
yellow ribbon.
• The tight spacing between the van der Waals
surfaces of adjacent bases indicates the close
proximity of their electron densities.
• It is also important to note that hydrogen atoms
are not displayed and as a result, the actual
spacing between stacks is closer than indicated
by this figure.
DNA Stabilization--H-bonding between
DNA base pair stacks
• Figure . Hydrogen bonding between DNA base pair stacks.
• Hydrogen bonding is indicated by the green dotted line.
• Hydrogen bonds occur not only between complimentary base pairs,
but adjacent nucleotide pairs as well.
• The hydrogen bonds indicated by the black arrows are between
stacked base pairs.
• Hydrogen bonding between base pair stacks could be responsible for
the tight base pair stacking observed in DNA molecules.
Advantages to Double Helix
• Stability---protects bases from attack by H2O soluble
compounds and H2O itself.
• Provides easy mechanism for replication
• each strand of DNA has a “direction”
• at one end, the terminal carbon atom in the
backbone is the 5’ carbon atom of the terminal
sugar
• at the other end, the terminal carbon atom is
the 3’ carbon atom of the terminal sugar
• therefore we can talk about the 5’ and the 3’ ends
of a DNA strand
• in a double helix, the strands are antiparallel
(arrows drawn from the 5’ end to the 3’ end go in
opposite directions)
• Chains are anti-parallel (i.e in opposite directions)
• Diameter and periodicity are consistent
• 2.0 nm
• 10 bases/ turn
• 3.4 nm/ turn
• Width consistent because of pyrimidine/purine pairing
Physical Structure (cont’d)
• The glycosidic bonds do not lie directly opposite each
other.
• the sugar phosphate backbones are not equally spaced
along the helical axis and the grooves that form between
the backbones are not of equal size, i.e we see a major
and minor groove
• these grooves provide a topography and allow
recognition by proteins
•  The structure of DNA is such that the bases are
protected (backbone, complementary H-bonds, base-
stacking), but also accessible.
G-C Content
• A=T, G=C, but AT≠GC
• Generally GC~50%, but extremely variable
• EX.
• Slime mold~22%
• Mycobacterium~73%
• Distribution of GC is not uniform in genomes
Consequences of GC content
• GC slightly denser
• Higher GC DNA moves further in a gradient
• Higher # of base pairs=more stable DNA, i.e. the strands don’t
separate as easily.
FORMS OF DNA
• The A-DNA conformation (left) is favored when DNA is
dehydrated. B-DNA (center) is the conformation
normally found inside cells.
• the Z-DNA conformation (right) is favored in certain GC-
rich sequences.
• Notes---The base pairs in Z-DNA are clearly
perpendicular to the axis of the helix and show very little
propeller twist. This conformation relieves some steric
hindrances found in certain GC-rich sequences.
DNA Can Undergo Reversible
Strand Separation
• During replication and transcription of DNA, the strands of
the double helix must separate to allow the internal edges of
the bases to pair with the bases of the nucleotides to be
polymerized into new polynucleotide chains.
•The unwinding and separation of DNA strands,
referred to as
• denaturation,
• or “melting,”
•can be induced experimentally by increasing the
temperature of a solution of DNA.
• As the thermal energy increases, the resulting increase in
molecular motion eventually breaks the hydrogen bonds
and other forces that stabilize the double helix; the
strands then separate, driven apart by the electrostatic
repulsion of the negatively charged deoxyribose-
phosphate backbone of each strand.
Reference Material
• 1. Molecular Cell Biology by Harvey Lodish.
• 2. Molecular Biology of the Cell, Volume 2 by Bruce Albert
• 3. Cell and Molecular Biology by Gerald Karp

More Related Content

Similar to LEC#2 Nucleotides .pdf

Nucleic Acid.pptx
Nucleic Acid.pptxNucleic Acid.pptx
Nucleic Acid.pptxDawitThomas
 
A592974226_23691_25_2019_Lecture11 onwards NUCLEIC ACIDS 2.pdf
A592974226_23691_25_2019_Lecture11 onwards NUCLEIC ACIDS 2.pdfA592974226_23691_25_2019_Lecture11 onwards NUCLEIC ACIDS 2.pdf
A592974226_23691_25_2019_Lecture11 onwards NUCLEIC ACIDS 2.pdfRahulSharma123800
 
Unit v dnastructureand function
Unit v dnastructureand functionUnit v dnastructureand function
Unit v dnastructureand functionDeepa Lashkari
 
DNA STRUCTURE AND THEIR DIFFERENT TYPES.pptx
DNA STRUCTURE AND THEIR DIFFERENT TYPES.pptxDNA STRUCTURE AND THEIR DIFFERENT TYPES.pptx
DNA STRUCTURE AND THEIR DIFFERENT TYPES.pptxAngela Abraham
 
phw1wyuuswgwao8gzhfj-signature-091447bade647bc70325d98b994f7c3a3901d946a34a45...
phw1wyuuswgwao8gzhfj-signature-091447bade647bc70325d98b994f7c3a3901d946a34a45...phw1wyuuswgwao8gzhfj-signature-091447bade647bc70325d98b994f7c3a3901d946a34a45...
phw1wyuuswgwao8gzhfj-signature-091447bade647bc70325d98b994f7c3a3901d946a34a45...bnvj
 
Chemistry of nucleic acids
Chemistry of nucleic acidsChemistry of nucleic acids
Chemistry of nucleic acidsAreeba Ghayas
 
Basics of DNA Structure
Basics of DNA StructureBasics of DNA Structure
Basics of DNA StructureRiddhi Datta
 
Dna structure slide share
Dna structure slide shareDna structure slide share
Dna structure slide shareICHHA PURAK
 
structural organization of dna.pptx
structural organization of dna.pptxstructural organization of dna.pptx
structural organization of dna.pptxAjishaSBabu
 
Lecture_Nucleic acids.ppt
Lecture_Nucleic acids.pptLecture_Nucleic acids.ppt
Lecture_Nucleic acids.pptelphaswalela
 
Double helix model of dna (kailash)
Double helix model of dna (kailash)Double helix model of dna (kailash)
Double helix model of dna (kailash)kailash saini
 
Dna chemistry structure,fuctions and its orgainization
Dna chemistry   structure,fuctions and its orgainizationDna chemistry   structure,fuctions and its orgainization
Dna chemistry structure,fuctions and its orgainizationneha sheth
 
B.Tech Biotechnology II Elements of Biotechnology Unit 2 Structure of DNA
B.Tech Biotechnology II Elements of Biotechnology Unit 2 Structure of DNAB.Tech Biotechnology II Elements of Biotechnology Unit 2 Structure of DNA
B.Tech Biotechnology II Elements of Biotechnology Unit 2 Structure of DNARai University
 
lecture 7 Nucleic Acids.pptx
lecture 7 Nucleic Acids.pptxlecture 7 Nucleic Acids.pptx
lecture 7 Nucleic Acids.pptxelphaswalela
 

Similar to LEC#2 Nucleotides .pdf (20)

Nucleic Acid.pptx
Nucleic Acid.pptxNucleic Acid.pptx
Nucleic Acid.pptx
 
molecular biology LECTURE 1 DNA & rna.pptx
molecular biology LECTURE 1 DNA & rna.pptxmolecular biology LECTURE 1 DNA & rna.pptx
molecular biology LECTURE 1 DNA & rna.pptx
 
Nucleic acids
Nucleic acids   Nucleic acids
Nucleic acids
 
A592974226_23691_25_2019_Lecture11 onwards NUCLEIC ACIDS 2.pdf
A592974226_23691_25_2019_Lecture11 onwards NUCLEIC ACIDS 2.pdfA592974226_23691_25_2019_Lecture11 onwards NUCLEIC ACIDS 2.pdf
A592974226_23691_25_2019_Lecture11 onwards NUCLEIC ACIDS 2.pdf
 
Nucleic acids
Nucleic acidsNucleic acids
Nucleic acids
 
Unit v dnastructureand function
Unit v dnastructureand functionUnit v dnastructureand function
Unit v dnastructureand function
 
The nucleic acids
The nucleic acidsThe nucleic acids
The nucleic acids
 
DNA STRUCTURE AND THEIR DIFFERENT TYPES.pptx
DNA STRUCTURE AND THEIR DIFFERENT TYPES.pptxDNA STRUCTURE AND THEIR DIFFERENT TYPES.pptx
DNA STRUCTURE AND THEIR DIFFERENT TYPES.pptx
 
DNA Structure & Function
DNA Structure & FunctionDNA Structure & Function
DNA Structure & Function
 
phw1wyuuswgwao8gzhfj-signature-091447bade647bc70325d98b994f7c3a3901d946a34a45...
phw1wyuuswgwao8gzhfj-signature-091447bade647bc70325d98b994f7c3a3901d946a34a45...phw1wyuuswgwao8gzhfj-signature-091447bade647bc70325d98b994f7c3a3901d946a34a45...
phw1wyuuswgwao8gzhfj-signature-091447bade647bc70325d98b994f7c3a3901d946a34a45...
 
Structure of DNA
Structure of DNA Structure of DNA
Structure of DNA
 
Chemistry of nucleic acids
Chemistry of nucleic acidsChemistry of nucleic acids
Chemistry of nucleic acids
 
Basics of DNA Structure
Basics of DNA StructureBasics of DNA Structure
Basics of DNA Structure
 
Dna structure slide share
Dna structure slide shareDna structure slide share
Dna structure slide share
 
structural organization of dna.pptx
structural organization of dna.pptxstructural organization of dna.pptx
structural organization of dna.pptx
 
Lecture_Nucleic acids.ppt
Lecture_Nucleic acids.pptLecture_Nucleic acids.ppt
Lecture_Nucleic acids.ppt
 
Double helix model of dna (kailash)
Double helix model of dna (kailash)Double helix model of dna (kailash)
Double helix model of dna (kailash)
 
Dna chemistry structure,fuctions and its orgainization
Dna chemistry   structure,fuctions and its orgainizationDna chemistry   structure,fuctions and its orgainization
Dna chemistry structure,fuctions and its orgainization
 
B.Tech Biotechnology II Elements of Biotechnology Unit 2 Structure of DNA
B.Tech Biotechnology II Elements of Biotechnology Unit 2 Structure of DNAB.Tech Biotechnology II Elements of Biotechnology Unit 2 Structure of DNA
B.Tech Biotechnology II Elements of Biotechnology Unit 2 Structure of DNA
 
lecture 7 Nucleic Acids.pptx
lecture 7 Nucleic Acids.pptxlecture 7 Nucleic Acids.pptx
lecture 7 Nucleic Acids.pptx
 

More from MuhammadAfrazNuman

LEC#3.1 Cell-Mediate ALL THE HPOES ARE d Immunity.pptx
LEC#3.1 Cell-Mediate ALL THE HPOES ARE d Immunity.pptxLEC#3.1 Cell-Mediate ALL THE HPOES ARE d Immunity.pptx
LEC#3.1 Cell-Mediate ALL THE HPOES ARE d Immunity.pptxMuhammadAfrazNuman
 
LEC#1 Immunity. pptxFDF DVF FDFDFFDF DDFDFDD FDFFDFDDFDF
LEC#1 Immunity. pptxFDF DVF FDFDFFDF DDFDFDD FDFFDFDDFDFLEC#1 Immunity. pptxFDF DVF FDFDFFDF DDFDFDD FDFFDFDDFDF
LEC#1 Immunity. pptxFDF DVF FDFDFFDF DDFDFDD FDFFDFDDFDFMuhammadAfrazNuman
 
LEC#0 Antigen-Presenting Cells ALL THE CELLS HAT HAVE.pptx
LEC#0 Antigen-Presenting Cells ALL THE CELLS HAT HAVE.pptxLEC#0 Antigen-Presenting Cells ALL THE CELLS HAT HAVE.pptx
LEC#0 Antigen-Presenting Cells ALL THE CELLS HAT HAVE.pptxMuhammadAfrazNuman
 
WEHH IMMDADA Cellular Immunity AND ALL THE
WEHH IMMDADA Cellular Immunity AND ALL THEWEHH IMMDADA Cellular Immunity AND ALL THE
WEHH IMMDADA Cellular Immunity AND ALL THEMuhammadAfrazNuman
 
Hepatitisfull presenta and full all .pptx
Hepatitisfull presenta and full all .pptxHepatitisfull presenta and full all .pptx
Hepatitisfull presenta and full all .pptxMuhammadAfrazNuman
 
Advances in Virology presentaion #2.pptx
Advances in Virology presentaion #2.pptxAdvances in Virology presentaion #2.pptx
Advances in Virology presentaion #2.pptxMuhammadAfrazNuman
 
LEC#4 Tolerance & Autoimmunity.pptx
LEC#4 Tolerance & Autoimmunity.pptxLEC#4 Tolerance & Autoimmunity.pptx
LEC#4 Tolerance & Autoimmunity.pptxMuhammadAfrazNuman
 
LEC#3 Hypersensitivity (Allergy).pptx
LEC#3  Hypersensitivity (Allergy).pptxLEC#3  Hypersensitivity (Allergy).pptx
LEC#3 Hypersensitivity (Allergy).pptxMuhammadAfrazNuman
 
LEC#7 DNA Replication and Repair.pdf
LEC#7  DNA Replication and Repair.pdfLEC#7  DNA Replication and Repair.pdf
LEC#7 DNA Replication and Repair.pdfMuhammadAfrazNuman
 

More from MuhammadAfrazNuman (12)

LEC#3.1 Cell-Mediate ALL THE HPOES ARE d Immunity.pptx
LEC#3.1 Cell-Mediate ALL THE HPOES ARE d Immunity.pptxLEC#3.1 Cell-Mediate ALL THE HPOES ARE d Immunity.pptx
LEC#3.1 Cell-Mediate ALL THE HPOES ARE d Immunity.pptx
 
LEC#1 Immunity. pptxFDF DVF FDFDFFDF DDFDFDD FDFFDFDDFDF
LEC#1 Immunity. pptxFDF DVF FDFDFFDF DDFDFDD FDFFDFDDFDFLEC#1 Immunity. pptxFDF DVF FDFDFFDF DDFDFDD FDFFDFDDFDF
LEC#1 Immunity. pptxFDF DVF FDFDFFDF DDFDFDD FDFFDFDDFDF
 
LEC#0 Antigen-Presenting Cells ALL THE CELLS HAT HAVE.pptx
LEC#0 Antigen-Presenting Cells ALL THE CELLS HAT HAVE.pptxLEC#0 Antigen-Presenting Cells ALL THE CELLS HAT HAVE.pptx
LEC#0 Antigen-Presenting Cells ALL THE CELLS HAT HAVE.pptx
 
WEHH IMMDADA Cellular Immunity AND ALL THE
WEHH IMMDADA Cellular Immunity AND ALL THEWEHH IMMDADA Cellular Immunity AND ALL THE
WEHH IMMDADA Cellular Immunity AND ALL THE
 
Hepatitisfull presenta and full all .pptx
Hepatitisfull presenta and full all .pptxHepatitisfull presenta and full all .pptx
Hepatitisfull presenta and full all .pptx
 
Advances in Virology presentaion #2.pptx
Advances in Virology presentaion #2.pptxAdvances in Virology presentaion #2.pptx
Advances in Virology presentaion #2.pptx
 
LEC#4 Tolerance & Autoimmunity.pptx
LEC#4 Tolerance & Autoimmunity.pptxLEC#4 Tolerance & Autoimmunity.pptx
LEC#4 Tolerance & Autoimmunity.pptx
 
LEC#3 Hypersensitivity (Allergy).pptx
LEC#3  Hypersensitivity (Allergy).pptxLEC#3  Hypersensitivity (Allergy).pptx
LEC#3 Hypersensitivity (Allergy).pptx
 
LEC#7 DNA Replication and Repair.pdf
LEC#7  DNA Replication and Repair.pdfLEC#7  DNA Replication and Repair.pdf
LEC#7 DNA Replication and Repair.pdf
 
LEC#1 INTRODUCTION.pdf
LEC#1 INTRODUCTION.pdfLEC#1 INTRODUCTION.pdf
LEC#1 INTRODUCTION.pdf
 
Saqib PPT.pptx
Saqib PPT.pptxSaqib PPT.pptx
Saqib PPT.pptx
 
Lec# 28 (Vaccines).pptx
Lec# 28 (Vaccines).pptxLec# 28 (Vaccines).pptx
Lec# 28 (Vaccines).pptx
 

Recently uploaded

Crushers to screens in aggregate production
Crushers to screens in aggregate productionCrushers to screens in aggregate production
Crushers to screens in aggregate productionChinnuNinan
 
Unit7-DC_Motors nkkjnsdkfnfcdfknfdgfggfg
Unit7-DC_Motors nkkjnsdkfnfcdfknfdgfggfgUnit7-DC_Motors nkkjnsdkfnfcdfknfdgfggfg
Unit7-DC_Motors nkkjnsdkfnfcdfknfdgfggfgsaravananr517913
 
Ch10-Global Supply Chain - Cadena de Suministro.pdf
Ch10-Global Supply Chain - Cadena de Suministro.pdfCh10-Global Supply Chain - Cadena de Suministro.pdf
Ch10-Global Supply Chain - Cadena de Suministro.pdfChristianCDAM
 
Crystal Structure analysis and detailed information pptx
Crystal Structure analysis and detailed information pptxCrystal Structure analysis and detailed information pptx
Crystal Structure analysis and detailed information pptxachiever3003
 
Internet of things -Arshdeep Bahga .pptx
Internet of things -Arshdeep Bahga .pptxInternet of things -Arshdeep Bahga .pptx
Internet of things -Arshdeep Bahga .pptxVelmuruganTECE
 
Past, Present and Future of Generative AI
Past, Present and Future of Generative AIPast, Present and Future of Generative AI
Past, Present and Future of Generative AIabhishek36461
 
TechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor Catchers
TechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor CatchersTechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor Catchers
TechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor Catcherssdickerson1
 
Correctly Loading Incremental Data at Scale
Correctly Loading Incremental Data at ScaleCorrectly Loading Incremental Data at Scale
Correctly Loading Incremental Data at ScaleAlluxio, Inc.
 
Industrial Safety Unit-IV workplace health and safety.ppt
Industrial Safety Unit-IV workplace health and safety.pptIndustrial Safety Unit-IV workplace health and safety.ppt
Industrial Safety Unit-IV workplace health and safety.pptNarmatha D
 
List of Accredited Concrete Batching Plant.pdf
List of Accredited Concrete Batching Plant.pdfList of Accredited Concrete Batching Plant.pdf
List of Accredited Concrete Batching Plant.pdfisabel213075
 
THE SENDAI FRAMEWORK FOR DISASTER RISK REDUCTION
THE SENDAI FRAMEWORK FOR DISASTER RISK REDUCTIONTHE SENDAI FRAMEWORK FOR DISASTER RISK REDUCTION
THE SENDAI FRAMEWORK FOR DISASTER RISK REDUCTIONjhunlian
 
Immutable Image-Based Operating Systems - EW2024.pdf
Immutable Image-Based Operating Systems - EW2024.pdfImmutable Image-Based Operating Systems - EW2024.pdf
Immutable Image-Based Operating Systems - EW2024.pdfDrew Moseley
 
Instrumentation, measurement and control of bio process parameters ( Temperat...
Instrumentation, measurement and control of bio process parameters ( Temperat...Instrumentation, measurement and control of bio process parameters ( Temperat...
Instrumentation, measurement and control of bio process parameters ( Temperat...121011101441
 
Risk Management in Engineering Construction Project
Risk Management in Engineering Construction ProjectRisk Management in Engineering Construction Project
Risk Management in Engineering Construction ProjectErbil Polytechnic University
 
11. Properties of Liquid Fuels in Energy Engineering.pdf
11. Properties of Liquid Fuels in Energy Engineering.pdf11. Properties of Liquid Fuels in Energy Engineering.pdf
11. Properties of Liquid Fuels in Energy Engineering.pdfHafizMudaserAhmad
 
multiple access in wireless communication
multiple access in wireless communicationmultiple access in wireless communication
multiple access in wireless communicationpanditadesh123
 
complete construction, environmental and economics information of biomass com...
complete construction, environmental and economics information of biomass com...complete construction, environmental and economics information of biomass com...
complete construction, environmental and economics information of biomass com...asadnawaz62
 
System Simulation and Modelling with types and Event Scheduling
System Simulation and Modelling with types and Event SchedulingSystem Simulation and Modelling with types and Event Scheduling
System Simulation and Modelling with types and Event SchedulingBootNeck1
 
Robotics-Asimov's Laws, Mechanical Subsystems, Robot Kinematics, Robot Dynami...
Robotics-Asimov's Laws, Mechanical Subsystems, Robot Kinematics, Robot Dynami...Robotics-Asimov's Laws, Mechanical Subsystems, Robot Kinematics, Robot Dynami...
Robotics-Asimov's Laws, Mechanical Subsystems, Robot Kinematics, Robot Dynami...Sumanth A
 

Recently uploaded (20)

Crushers to screens in aggregate production
Crushers to screens in aggregate productionCrushers to screens in aggregate production
Crushers to screens in aggregate production
 
Unit7-DC_Motors nkkjnsdkfnfcdfknfdgfggfg
Unit7-DC_Motors nkkjnsdkfnfcdfknfdgfggfgUnit7-DC_Motors nkkjnsdkfnfcdfknfdgfggfg
Unit7-DC_Motors nkkjnsdkfnfcdfknfdgfggfg
 
Ch10-Global Supply Chain - Cadena de Suministro.pdf
Ch10-Global Supply Chain - Cadena de Suministro.pdfCh10-Global Supply Chain - Cadena de Suministro.pdf
Ch10-Global Supply Chain - Cadena de Suministro.pdf
 
Crystal Structure analysis and detailed information pptx
Crystal Structure analysis and detailed information pptxCrystal Structure analysis and detailed information pptx
Crystal Structure analysis and detailed information pptx
 
Internet of things -Arshdeep Bahga .pptx
Internet of things -Arshdeep Bahga .pptxInternet of things -Arshdeep Bahga .pptx
Internet of things -Arshdeep Bahga .pptx
 
Past, Present and Future of Generative AI
Past, Present and Future of Generative AIPast, Present and Future of Generative AI
Past, Present and Future of Generative AI
 
TechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor Catchers
TechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor CatchersTechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor Catchers
TechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor Catchers
 
Correctly Loading Incremental Data at Scale
Correctly Loading Incremental Data at ScaleCorrectly Loading Incremental Data at Scale
Correctly Loading Incremental Data at Scale
 
Industrial Safety Unit-IV workplace health and safety.ppt
Industrial Safety Unit-IV workplace health and safety.pptIndustrial Safety Unit-IV workplace health and safety.ppt
Industrial Safety Unit-IV workplace health and safety.ppt
 
List of Accredited Concrete Batching Plant.pdf
List of Accredited Concrete Batching Plant.pdfList of Accredited Concrete Batching Plant.pdf
List of Accredited Concrete Batching Plant.pdf
 
THE SENDAI FRAMEWORK FOR DISASTER RISK REDUCTION
THE SENDAI FRAMEWORK FOR DISASTER RISK REDUCTIONTHE SENDAI FRAMEWORK FOR DISASTER RISK REDUCTION
THE SENDAI FRAMEWORK FOR DISASTER RISK REDUCTION
 
Immutable Image-Based Operating Systems - EW2024.pdf
Immutable Image-Based Operating Systems - EW2024.pdfImmutable Image-Based Operating Systems - EW2024.pdf
Immutable Image-Based Operating Systems - EW2024.pdf
 
Instrumentation, measurement and control of bio process parameters ( Temperat...
Instrumentation, measurement and control of bio process parameters ( Temperat...Instrumentation, measurement and control of bio process parameters ( Temperat...
Instrumentation, measurement and control of bio process parameters ( Temperat...
 
Risk Management in Engineering Construction Project
Risk Management in Engineering Construction ProjectRisk Management in Engineering Construction Project
Risk Management in Engineering Construction Project
 
11. Properties of Liquid Fuels in Energy Engineering.pdf
11. Properties of Liquid Fuels in Energy Engineering.pdf11. Properties of Liquid Fuels in Energy Engineering.pdf
11. Properties of Liquid Fuels in Energy Engineering.pdf
 
POWER SYSTEMS-1 Complete notes examples
POWER SYSTEMS-1 Complete notes  examplesPOWER SYSTEMS-1 Complete notes  examples
POWER SYSTEMS-1 Complete notes examples
 
multiple access in wireless communication
multiple access in wireless communicationmultiple access in wireless communication
multiple access in wireless communication
 
complete construction, environmental and economics information of biomass com...
complete construction, environmental and economics information of biomass com...complete construction, environmental and economics information of biomass com...
complete construction, environmental and economics information of biomass com...
 
System Simulation and Modelling with types and Event Scheduling
System Simulation and Modelling with types and Event SchedulingSystem Simulation and Modelling with types and Event Scheduling
System Simulation and Modelling with types and Event Scheduling
 
Robotics-Asimov's Laws, Mechanical Subsystems, Robot Kinematics, Robot Dynami...
Robotics-Asimov's Laws, Mechanical Subsystems, Robot Kinematics, Robot Dynami...Robotics-Asimov's Laws, Mechanical Subsystems, Robot Kinematics, Robot Dynami...
Robotics-Asimov's Laws, Mechanical Subsystems, Robot Kinematics, Robot Dynami...
 

LEC#2 Nucleotides .pdf

  • 1. Molecular Biology & Genetics-I Lecture 1 By Dr. Iqra Munir
  • 2. Nucleotides and Nucleosides BASE NUCLEOSIDE DEOXYNUCLEOSIDE Adenine Adenosine 2-deoxyadenosine Guanine Guanosine 2-deoxyguanosine Cytosine Cytodine 2-deoxycytodine Uracil Uridine Not usually found Thymine Not usually found 2-deoxythymidine Nucleotides are nucleosides + phosphate
  • 3. make up 13-34% of the dry weight in bacteria deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) O C C C C Base H H or OH H H H H CH2 O P OH O HO Nucleotide: a building block Sugar: • RNA – ribose (OH) • DNA – deoxyribose (H) Bases: • adenine (A), cytosine (C), guanine (G), thymine (T) • RNA uses uracil (U) instead of thymine Nucleoside: base + sugar • certain nucleotides serve as a storage of energy and reducing power e.g. ATP -> ADP -> AMP hydrolysis (energy is released) Nucleic Acids
  • 5. The Double Helix •A DNA molecule consists of two strands of nucleotide monomers running in opposite directions and coiled into a double helix
  • 6. • DNA nucleotide • A five-carbon sugar (deoxyribose) • Three phosphate groups • One nitrogen-containing base (adenine, thymine, guanine, or cytosine)
  • 7. The Double Helix • Two double-helix strands are held together by hydrogen bonds between nucleotide bases
  • 8. • Chargaff’s rules • Bases of the two DNA strands in a double helix pair in a consistent way: • A = T and C = G • Proportions of A and G vary among species
  • 9. Patterns of Base Pairing • The order of bases (DNA sequence) varies among species and among individuals • Each species has characteristic DNA sequences
  • 10. • DNA sequence • The order of nucleotide bases in a strand of DNA • ATGGGGCTTACCTTAGTACCAA
  • 12. • Figure . Base stacking in a single strand of B form DNA. • Space filling spheres are used to indicate the van der Waals surfaces. • Carbon atoms are highlighted in black, nitrogen in blue, phosphorous in yellow and oxygen in red. • The phosphodiester backbone is indicated with a yellow ribbon.
  • 13. • The tight spacing between the van der Waals surfaces of adjacent bases indicates the close proximity of their electron densities. • It is also important to note that hydrogen atoms are not displayed and as a result, the actual spacing between stacks is closer than indicated by this figure.
  • 15. • Figure . Hydrogen bonding between DNA base pair stacks. • Hydrogen bonding is indicated by the green dotted line. • Hydrogen bonds occur not only between complimentary base pairs, but adjacent nucleotide pairs as well. • The hydrogen bonds indicated by the black arrows are between stacked base pairs. • Hydrogen bonding between base pair stacks could be responsible for the tight base pair stacking observed in DNA molecules.
  • 16.
  • 17. Advantages to Double Helix • Stability---protects bases from attack by H2O soluble compounds and H2O itself. • Provides easy mechanism for replication
  • 18.
  • 19. • each strand of DNA has a “direction” • at one end, the terminal carbon atom in the backbone is the 5’ carbon atom of the terminal sugar • at the other end, the terminal carbon atom is the 3’ carbon atom of the terminal sugar • therefore we can talk about the 5’ and the 3’ ends of a DNA strand • in a double helix, the strands are antiparallel (arrows drawn from the 5’ end to the 3’ end go in opposite directions)
  • 20. • Chains are anti-parallel (i.e in opposite directions) • Diameter and periodicity are consistent • 2.0 nm • 10 bases/ turn • 3.4 nm/ turn • Width consistent because of pyrimidine/purine pairing
  • 22. • The glycosidic bonds do not lie directly opposite each other. • the sugar phosphate backbones are not equally spaced along the helical axis and the grooves that form between the backbones are not of equal size, i.e we see a major and minor groove • these grooves provide a topography and allow recognition by proteins •  The structure of DNA is such that the bases are protected (backbone, complementary H-bonds, base- stacking), but also accessible.
  • 23. G-C Content • A=T, G=C, but AT≠GC • Generally GC~50%, but extremely variable • EX. • Slime mold~22% • Mycobacterium~73% • Distribution of GC is not uniform in genomes
  • 24. Consequences of GC content • GC slightly denser • Higher GC DNA moves further in a gradient • Higher # of base pairs=more stable DNA, i.e. the strands don’t separate as easily.
  • 26. • The A-DNA conformation (left) is favored when DNA is dehydrated. B-DNA (center) is the conformation normally found inside cells. • the Z-DNA conformation (right) is favored in certain GC- rich sequences. • Notes---The base pairs in Z-DNA are clearly perpendicular to the axis of the helix and show very little propeller twist. This conformation relieves some steric hindrances found in certain GC-rich sequences.
  • 27.
  • 28.
  • 29. DNA Can Undergo Reversible Strand Separation • During replication and transcription of DNA, the strands of the double helix must separate to allow the internal edges of the bases to pair with the bases of the nucleotides to be polymerized into new polynucleotide chains.
  • 30. •The unwinding and separation of DNA strands, referred to as • denaturation, • or “melting,” •can be induced experimentally by increasing the temperature of a solution of DNA.
  • 31. • As the thermal energy increases, the resulting increase in molecular motion eventually breaks the hydrogen bonds and other forces that stabilize the double helix; the strands then separate, driven apart by the electrostatic repulsion of the negatively charged deoxyribose- phosphate backbone of each strand.
  • 32. Reference Material • 1. Molecular Cell Biology by Harvey Lodish. • 2. Molecular Biology of the Cell, Volume 2 by Bruce Albert • 3. Cell and Molecular Biology by Gerald Karp