Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

V tinfographic final_061114_no_footer

2,425 views

Published on

  • Be the first to comment

V tinfographic final_061114_no_footer

  1. 1. The cloud that is helping cure cancer. Develop new cancer therapies Big data is growing 3x faster than compute capability Cost to sequence one genome $100M $10M $1M $100K $10K $1K $4100 $95M 2002 2006 2010 2013 What’s possible when you make the Microsoft Cloud part of your DNA? learn more at microsoftcloud.com Amazing possibilities Data is increasing exponentially Microsoft Azure is enabling more efficient analysis “Microsoft Azure is enabling us to keep up with the data deluge in the DNA sequencing space by analyzing data faster and more intelligently.” —Wu Feng, Professor of Computer Science, Virginia Tech data deluge 1 in 3 people will develop cancer Cost of cancer: $458 billion per year in 2030 Research that once took years now happens in hours. Using Microsoft Azure and HDInsight, scientists and engineers at Virginia Tech harness supercomputing power to analyze vast amounts of DNA sequencing information and help deliver lifesaving treatments. GATCAATACGATCACGATCATGATCA TGATCAACTGCGACAGATCATGATCG GTCAATACGATCAACGATCATGATCT 15 petabytes As music, TGATCAACTGCGACAGATCATGATCG it would take TCAATACGATCATCGTATCAGGATCA of genome CAGATCATGATCGACGATCATGATCT 30,000 GATCAATACGATCACGATCATGATCA data available years to TGATCAACTGCGACAGATCATGATCG play! GTCAATACGATCAACGATCATGATCT Did you know? Combat drug-resistant bugs Locate undetected genes Extend analysis from the lab to the hospital Individualize treatment Amount of time Virginia Tech spent resourcing and building a new facility 0

×