Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Structure basis for microRNA targeting

821 views

Published on

Seminar in Biochemistry of nucleoprotein and nucleic acid
(1/2558)

Published in: Science
  • Be the first to comment

  • Be the first to like this

Structure basis for microRNA targeting

  1. 1. Schirle, N. T., et al. (2014) Presented by Bundit Boonyarit 5814400587 Dept.Biochemistry, Fac.Science, Kasertsart University tructure basis for microRNA targetingS December 24, 2015
  2. 2. 3 INTRODUCTION
  3. 3. 4 INTRODUCTION WHAT WHERE WHEN WHY HOW
  4. 4. 5 INTRODUCTION miRNA microRNA WHAT RNA interference (RNAi) Short non-coding RNA (20-22 nt) RNA silencing pathway miRNA-miRNA* duplex (miRNA is the antisense or guide strand and miRNA* is the sense or passenger strand)
  5. 5. (A)n Pri-miRNA Processing Maturation Strand selection; RISC assembly Initiation or elongation block Deadenylation Transcription Pre-miRNA Drosha DGCR8 m7G (A)n Exportin 5 Dicer TRBP Ago Ago Ago CCR4–NOT P-bodies Target repression AGO1– AGO4 RISC AAAAA ORF AAAAA ORF EIF4E Ribosome Nucleus Cytoplasm Box 1 | RNA biogenesis and mechanisms of action MicroRNAs (miRNAs) are transcribed as primary transcripts (pri-miRNAs) by RNA polymerase II. Each pri-miRNA contains one or more hairpin structures that are recognized and processed by the microprocessor complex, which consists of the RNase III type endonuclease Drosha and its partner, DGCR8 (see the figure). The microprocessor complex generates a 70-nucleotide stem loop known as the precursor miRNA (pre-miRNA), which is actively exported to the cytoplasm by exportin 5. In the cytoplasm, the pre-miRNA is recognized by Dicer, another RNase III type endonuclease, and TAR RNA-binding protein (TRBP; also known as TARBP2). Dicer cleaves this precursor, generating a 20-nucleotide mature miRNA duplex. Generally, only one strand is selected as the biologically active mature miRNA and the other strand is degraded. The mature miRNA is loaded into the RNA-induced silencing complex (RISC), which contains Argonaute (Ago) proteins and the single-stranded miRNA. Mature miRNA allows the RISC to recognize target mRNAs through partial sequence complementarity with its target. In particular, perfect base pairing between the seed sequence of the miRNA (from the second to the eighth nucleotide) and the seed match sequences in the mRNA 3 UTR are crucial. The RISC can inhibit the expression of the target mRNA through two main mechanisms that have several variations: removal of the polyA tail (deadenylation) by fostering the activity of deadenylases (such as CCR4–NOT), followed by mRNA degradation; and blockade of translation at the initiation step or at the elongation step; for example, by inhibiting eukaryotic initiation factor 4E (EIF4E) or causing ribosome stalling RISC-bound mRNA can be localized to sub-cytoplasmatic compartments, known as P-bodies, where they are reversibly stored or degraded. Figure is modified, with permission, from REF. 104 Nature Reviews Genetics 2008 Macmillan Publishers Ltd. All rights reserved. m7 G, 7-methylguanosine cap; ORF, open reading frame. 6 INTRODUCTION microRNA WHERE DGCR8 microprocessor complex subunit (DiGeorge syndrome chromosomal [or critical] region 8) Drosha and dicer, RNase III enzyme pri-miRNA = primary transcript miRNA pre-miRNA = precursor miRNA RNA-induced silencing complex (RISC) Transactivating response RNA-binding protein (TRBP) miRNA
  6. 6. (A)n Pri-miRNA Processing Maturation Strand selection; RISC assembly Initiation or elongation block Deadenylation Transcription Pre-miRNA Drosha DGCR8 m7G (A)n Exportin 5 Dicer TRBP Ago Ago Ago CCR4–NOT P-bodies Target repression AGO1– AGO4 RISC AAAAA ORF AAAAA ORF EIF4E Ribosome Nucleus Cytoplasm Box 1 | RNA biogenesis and mechanisms of action MicroRNAs (miRNAs) are transcribed as primary transcripts (pri-miRNAs) by RNA polymerase II. Each pri-miRNA contains one or more hairpin structures that are recognized and processed by the microprocessor complex, which consists of the RNase III type endonuclease Drosha and its partner, DGCR8 (see the figure). The microprocessor complex generates a 70-nucleotide stem loop known as the precursor miRNA (pre-miRNA), which is actively exported to the cytoplasm by exportin 5. In the cytoplasm, the pre-miRNA is recognized by Dicer, another RNase III type endonuclease, and TAR RNA-binding protein (TRBP; also known as TARBP2). Dicer cleaves this precursor, generating a 20-nucleotide mature miRNA duplex. Generally, only one strand is selected as the biologically active mature miRNA and the other strand is degraded. The mature miRNA is loaded into the RNA-induced silencing complex (RISC), which contains Argonaute (Ago) proteins and the single-stranded miRNA. Mature miRNA allows the RISC to recognize target mRNAs through partial sequence complementarity with its target. In particular, perfect base pairing between the seed sequence of the miRNA (from the second to the eighth nucleotide) and the seed match sequences in the mRNA 3 UTR are crucial. The RISC can inhibit the expression of the target mRNA through two main mechanisms that have several variations: removal of the polyA tail (deadenylation) by fostering the activity of deadenylases (such as CCR4–NOT), followed by mRNA degradation; and blockade of translation at the initiation step or at the elongation step; for example, by inhibiting eukaryotic initiation factor 4E (EIF4E) or causing ribosome stalling RISC-bound mRNA can be localized to sub-cytoplasmatic compartments, known as P-bodies, where they are reversibly stored or degraded. Figure is modified, with permission, from REF. 104 Nature Reviews Genetics 2008 Macmillan Publishers Ltd. All rights reserved. m7 G, 7-methylguanosine cap; ORF, open reading frame. 7 INTRODUCTION microRNA WHY Apoptosis Proliferation Differentiation and maturation DESEASE MUTATION miRNA
  7. 7. cap, is repressed by miRNAs43,44 . As in numerous subse- quent studies, the specificity of repression was assessed using reporters containing mutated miRNA sites or by antisense oligonucleotides that specifically block the targeting miRNA. The conclusion that the m7 G cap is essential for translational repression was corroborated by experiments with bi-cistronic mRNAs. In these experi- ments, the activity of the first cap-dependent cistron, but not the second cistron, placed under the control of eIF4E or eIF4G artificially tethered to the mRNA, was repressed by the endogenous let-7 miRNA43 (FIG. 1). Polysome gradient analysis independently supports an effect on the initiation step: reporter mRNAs that either contained functional let-7-binding sites or that were repressed by AGO2 (artificially tethered to the 3 UTR) showed a marked shift in sedimentation toward the top of the gradient, indicating reduced ribosome loading on the repressed mRNA43 . Likewise, the amino-acid- starvation-induced release of endogenous cationic amino acid transporter 1 (CAT1) mRNA from repression that was mediated by the miRNA miR-122 was accompa- nied by a more effective recruitment of CAT1 mRNA to polysomes in human hepatoma cells45 . There is substantial evidence that factors bound at the 3 UTR exert their inhibitory effect on translational initiation by recruiting proteins that either interfere with Box 2 | Principles of microRNA–mRNA interactions MicroRNAs (miRNAs) interact with their mRNA targets by base pairing. In plants, most miRNAs base pair to mRNAs with nearly perfect complementarity and induce mRNA degradation by an RNAi-like mechanism — the mRNA is cleaved endonucleolytically in the middle of the miRNA–mRNA duplex29 . By contrast, with few exceptions, metazoan miRNAs base pair with their targets imperfectly, following a set of rules that have been identified by experimental and bioinformatics analyses30–34 . • One rule for miRNA–target base paring is perfect and contiguous base pairing of miRNA nucleotides 2 to 8, representing the ‘seed’ region (shown in dark red and green), which nucleates the miRNA–mRNA association. GU pairs or mismatches and bulges in the seed region greatly affect repression. However, an A residue across position 1 of the miRNA, and an A or U across position 9 (shown in yellow), improve the site efficiency, although they do not need to base pair with miRNA nucleotides. • Another rule is that bulges or mismatches must be present in the central region of the miRNA–mRNA duplex, precluding the Argonaute (AGO)-mediated endonucleolytic cleavage of mRNA. • The third rule is that there must be reasonable complementarity to the miRNA 3 half to stabilize the interaction. Mismatches and bulges are generally tolerated in this region, NNNNNNN Nature Reviews | Genetics Bulge ORF AAAAAA >15 nucleotides ‘Seed’ region Bulge 3 complementarity 816 13 1 A NNNNNNNNNN NNNNNNNNNN A U NNNNNNNNN miRNA REVIEWS (A)n Pri-miRNA Processing Maturation Strand selection; RISC assembly Initiation or elongation block Deadenylation Transcription Pre-miRNA Drosha DGCR8 m7G (A)n Exportin 5 Dicer TRBP Ago Ago Ago CCR4–NOT P-bodies Target repression AGO1– AGO4 RISC AAAAA ORF AAAAA ORF EIF4E Ribosome Nucleus Cytoplasm Box 1 | RNA biogenesis and mechanisms of action MicroRNAs (miRNAs) are transcribed as primary transcripts (pri-miRNAs) by RNA polymerase II. Each pri-miRNA contains one or more hairpin structures that are recognized and processed by the microprocessor complex, which consists of the RNase III type endonuclease Drosha and its partner, DGCR8 (see the figure). The microprocessor complex generates a 70-nucleotide stem loop known as the precursor miRNA (pre-miRNA), which is actively exported to the cytoplasm by exportin 5. In the cytoplasm, the pre-miRNA is recognized by Dicer, another RNase III type endonuclease, and TAR RNA-binding protein (TRBP; also known as TARBP2). Dicer cleaves this precursor, generating a 20-nucleotide mature miRNA duplex. Generally, only one strand is selected as the biologically active mature miRNA and the other strand is degraded. The mature miRNA is loaded into the RNA-induced silencing complex (RISC), which contains Argonaute (Ago) proteins and the single-stranded miRNA. Mature miRNA allows the RISC to recognize target mRNAs through partial sequence complementarity with its target. In particular, perfect base pairing between the seed sequence of the miRNA (from the second to the eighth nucleotide) and the seed match sequences in the mRNA 3 UTR are crucial. The RISC can inhibit the expression of the target mRNA through two main mechanisms that have several variations: removal of the polyA tail (deadenylation) by fostering the activity of deadenylases (such as CCR4–NOT), followed by mRNA degradation; and blockade of translation at the initiation step or at the elongation step; for example, by inhibiting eukaryotic initiation factor 4E (EIF4E) or causing ribosome stalling RISC-bound mRNA can be localized to sub-cytoplasmatic compartments, known as P-bodies, where they are reversibly stored or degraded. Figure is modified, with permission, from REF. 104 Nature Reviews Genetics 2008 Macmillan Publishers Ltd. All rights reserved. m7 G, 7-methylguanosine cap; ORF, open reading frame. 8 INTRODUCTIONWHEN microRNA Principles of microRNA–mRNA interactions
 Nucleotide 1: A Seed region (Nucleotides 2-8): Perfect base pairing Nucleotide 9: A or U Nucleotide 13-16: Good base pairing miRNA
  8. 8. cap, is repressed by miRNAs43,44 . As in numerous subse- quent studies, the specificity of repression was assessed using reporters containing mutated miRNA sites or by antisense oligonucleotides that specifically block the targeting miRNA. The conclusion that the m7 G cap is essential for translational repression was corroborated by experiments with bi-cistronic mRNAs. In these experi- ments, the activity of the first cap-dependent cistron, but not the second cistron, placed under the control of eIF4E or eIF4G artificially tethered to the mRNA, was repressed by the endogenous let-7 miRNA43 (FIG. 1). Polysome gradient analysis independently supports an effect on the initiation step: reporter mRNAs that either contained functional let-7-binding sites or that were repressed by AGO2 (artificially tethered to the 3 UTR) showed a marked shift in sedimentation toward the top of the gradient, indicating reduced ribosome loading on the repressed mRNA43 . Likewise, the amino-acid- starvation-induced release of endogenous cationic amino acid transporter 1 (CAT1) mRNA from repression that was mediated by the miRNA miR-122 was accompa- nied by a more effective recruitment of CAT1 mRNA to polysomes in human hepatoma cells45 . There is substantial evidence that factors bound at the 3 UTR exert their inhibitory effect on translational initiation by recruiting proteins that either interfere with Box 2 | Principles of microRNA–mRNA interactions MicroRNAs (miRNAs) interact with their mRNA targets by base pairing. In plants, most miRNAs base pair to mRNAs with nearly perfect complementarity and induce mRNA degradation by an RNAi-like mechanism — the mRNA is cleaved endonucleolytically in the middle of the miRNA–mRNA duplex29 . By contrast, with few exceptions, metazoan miRNAs base pair with their targets imperfectly, following a set of rules that have been identified by experimental and bioinformatics analyses30–34 . • One rule for miRNA–target base paring is perfect and contiguous base pairing of miRNA nucleotides 2 to 8, representing the ‘seed’ region (shown in dark red and green), which nucleates the miRNA–mRNA association. GU pairs or mismatches and bulges in the seed region greatly affect repression. However, an A residue across position 1 of the miRNA, and an A or U across position 9 (shown in yellow), improve the site efficiency, although they do not need to base pair with miRNA nucleotides. • Another rule is that bulges or mismatches must be present in the central region of the miRNA–mRNA duplex, precluding the Argonaute (AGO)-mediated endonucleolytic cleavage of mRNA. • The third rule is that there must be reasonable complementarity to the miRNA 3 half to stabilize the interaction. Mismatches and bulges are generally tolerated in this region, NNNNNNN Nature Reviews | Genetics Bulge ORF AAAAAA >15 nucleotides ‘Seed’ region Bulge 3 complementarity 816 13 1 A NNNNNNNNNN NNNNNNNNNN A U NNNNNNNNN miRNA REVIEWS (A)n Pri-miRNA Processing Maturation Strand selection; RISC assembly Initiation or elongation block Deadenylation Transcription Pre-miRNA Drosha DGCR8 m7G (A)n Exportin 5 Dicer TRBP Ago Ago Ago CCR4–NOT P-bodies Target repression AGO1– AGO4 RISC AAAAA ORF AAAAA ORF EIF4E Ribosome Nucleus Cytoplasm Box 1 | RNA biogenesis and mechanisms of action MicroRNAs (miRNAs) are transcribed as primary transcripts (pri-miRNAs) by RNA polymerase II. Each pri-miRNA contains one or more hairpin structures that are recognized and processed by the microprocessor complex, which consists of the RNase III type endonuclease Drosha and its partner, DGCR8 (see the figure). The microprocessor complex generates a 70-nucleotide stem loop known as the precursor miRNA (pre-miRNA), which is actively exported to the cytoplasm by exportin 5. In the cytoplasm, the pre-miRNA is recognized by Dicer, another RNase III type endonuclease, and TAR RNA-binding protein (TRBP; also known as TARBP2). Dicer cleaves this precursor, generating a 20-nucleotide mature miRNA duplex. Generally, only one strand is selected as the biologically active mature miRNA and the other strand is degraded. The mature miRNA is loaded into the RNA-induced silencing complex (RISC), which contains Argonaute (Ago) proteins and the single-stranded miRNA. Mature miRNA allows the RISC to recognize target mRNAs through partial sequence complementarity with its target. In particular, perfect base pairing between the seed sequence of the miRNA (from the second to the eighth nucleotide) and the seed match sequences in the mRNA 3 UTR are crucial. The RISC can inhibit the expression of the target mRNA through two main mechanisms that have several variations: removal of the polyA tail (deadenylation) by fostering the activity of deadenylases (such as CCR4–NOT), followed by mRNA degradation; and blockade of translation at the initiation step or at the elongation step; for example, by inhibiting eukaryotic initiation factor 4E (EIF4E) or causing ribosome stalling RISC-bound mRNA can be localized to sub-cytoplasmatic compartments, known as P-bodies, where they are reversibly stored or degraded. Figure is modified, with permission, from REF. 104 Nature Reviews Genetics 2008 Macmillan Publishers Ltd. All rights reserved. m7 G, 7-methylguanosine cap; ORF, open reading frame. 9 INTRODUCTIONHOW microRNA Structural biology of microRNA for targeting? HOW? Stepwise mechanism? miRNA
  9. 9. (A)n Pri-miRNA Processing Maturation Strand selection; RISC assembly Initiation or elongation block Deadenylation Transcription Pre-miRNA Drosha DGCR8 m7G (A)n Exportin 5 Dicer TRBP Ago Ago Ago CCR4–NOT P-bodies Target repression AGO1– AGO4 RISC AAAAA ORF AAAAA ORF EIF4E Ribosome Nucleus Cytoplasm Box 1 | RNA biogenesis and mechanisms of action MicroRNAs (miRNAs) are transcribed as primary transcripts (pri-miRNAs) by RNA polymerase II. Each pri-miRNA contains one or more hairpin structures that are recognized and processed by the microprocessor complex, which consists of the RNase III type endonuclease Drosha and its partner, DGCR8 (see the figure). The microprocessor complex generates a 70-nucleotide stem loop known as the precursor miRNA (pre-miRNA), which is actively exported to the cytoplasm by exportin 5. In the cytoplasm, the pre-miRNA is recognized by Dicer, another RNase III type endonuclease, and TAR RNA-binding protein (TRBP; also known as TARBP2). Dicer cleaves this precursor, generating a 20-nucleotide mature miRNA duplex. Generally, only one strand is selected as the biologically active mature miRNA and the other strand is degraded. The mature miRNA is loaded into the RNA-induced silencing complex (RISC), which contains Argonaute (Ago) proteins and the single-stranded miRNA. Mature miRNA allows the RISC to recognize target mRNAs through partial sequence complementarity with its target. In particular, perfect base pairing between the seed sequence of the miRNA (from the second to the eighth nucleotide) and the seed match sequences in the mRNA 3 UTR are crucial. The RISC can inhibit the expression of the target mRNA through two main mechanisms that have several variations: removal of the polyA tail (deadenylation) by fostering the activity of deadenylases (such as CCR4–NOT), followed by mRNA degradation; and blockade of translation at the initiation step or at the elongation step; for example, by inhibiting eukaryotic initiation factor 4E (EIF4E) or causing ribosome stalling RISC-bound mRNA can be localized to sub-cytoplasmatic compartments, known as P-bodies, where they are reversibly stored or degraded. Figure is modified, with permission, from REF. 104 Nature Reviews Genetics 2008 Macmillan Publishers Ltd. All rights reserved. m7 G, 7-methylguanosine cap; ORF, open reading frame. 10 INTRODUCTION To study structure of Argonaute 2 (Ago2) bound to guide RNA with and without target RNAs OBJECTIVE
  10. 10. 11 INTRODUCTION Nature Reviews | G c H. sapiens AGO2 PIWI domain N MID PIWIPAZL1 L2 V591 F587 P590 F659 Y698 Y654 F653 L694 E695 K660 20–25 Å W2 W1 N-terminal domain MID PIWIPAZ C lo N-terminal lobe miRNA 5′ end miRNA 3′ end W1 W2 Target mRNA a H. sapiens AGO2 b Complex of miRNA-bound H. sapiens AGO2 and a target mRNA Figure 2 | Structural insight into the interaction of AGO proteins with GW182 proteins. a | Argonaute (AG proteins have four domains: the amino-terminal domain, the PIWI–AGO–ZWILLE (PAZ) domain, the MID domain a the PIWI domain. The PAZ domain is connected to the N-terminal and MID domains by linker regions called L1 and respectively. Homo sapiens AGO2 is shown as a representative example of this family.b | The structure ofH. sapiens (green and grey) in complex with a microRNA (miRNA; black) and a short piece of target mRNA (orange) (RCSB Pro Data Bank code: 4W5O)61 highlights the position of the tryptophan (W) residues (red) bound to pockets on the surf REVIE Nature Reviews | Genetics c H. sapiens AGO2 PIWI domain N MID PIWIPAZL1 L2 V591 F587 P590 F659 Y698 Y654 F653 L694 E695 K660 20–25 Å W2 W1 N-terminal domain MID PIWIPAZ C-terminal lobe N-terminal lobe miRNA 5′ end miRNA 3′ end W1 W2 Target mRNA a H. sapiens AGO2 b Complex of miRNA-bound H. sapiens AGO2 and a target mRNA Figure 2 | Structural insight into the interaction of AGO proteins with GW182 proteins. a | Argonaute (AGO) proteins have four domains: the amino-terminal domain, the PIWI–AGO–ZWILLE (PAZ) domain, the MID domain and the PIWI domain. The PAZ domain is connected to the N-terminal and MID domains by linker regions called L1 and L2, respectively. Homo sapiens AGO2 is shown as a representative example of this family.b | The structure ofH. sapiens AGO2 (green and grey) in complex with a microRNA (miRNA; black) and a short piece of target mRNA (orange) (RCSB Protein Data Bank code: 4W5O)61 highlights the position of the tryptophan (W) residues (red) bound to pockets on the surface of the PIWI domain. c | Close-up view of the W-binding pockets (PDB code: 4OLB)59 is shown. Residues lining the pockets are shown as sticks and partially labelled for orientation. The minimal distance between the two W residues is indicated. C-terminal, carboxy-terminal. REVIEWS PAZ domain: A conserved nucleic-acid-binding structure that is found in members of the Dicer and Argonaute protein families. PIWI domain: A conserved structure that is found in members of the Argonaute protein family. It is structurally similar to ribonuclease H domains and, in at least some cases, has endoribonuclease activity.
  11. 11. 12 EXPERIMENTS
  12. 12. 13 EXPERIMENTS UmGmAmAmAmCmCmUmU 3' miR-122: 5' Biotin- mUmCmUmCmUmGmCmUmAmAmCmCmAmUmGmCmGmAmAmCmA mCmUmCmCmAmUmCmUmCmUmGmC 3' Competitor DNAs: Sod1: 5' AAGGTTTCACATTTATGAAGTCGTGGGAAGA 3' miR-122: 5' GCAGAGATCAAGTGTTCGCATGGTTAGCAGAGA 3' Crystallized Target RNAs: 5' rCrArArUrGrUrGrArArArA 3'; 5' rArArArUrGrUrGrArArArA 3'; 5' rArCrArUrGrUrGrArArArA 3'; 5' rCrCrArArArUrGrUrGrArArArA 3'; Slicing Targets and Northern Blot Probes: Sod1: 5' rArArUrUrArArArArArGrArGrArCrUrUrGrGrGrCrArArUrGrUrGrArCrArCrCrUrUrAr A 3' miR-122: 5' CAAACACCATTGTCACACTCCA 3' Binding Assay Target RNAs: Sod1: 5' rUrCrCrCrUrUrArCrGrArCrGrCrArArUrGrUrGrArArArA 3'; 5' rUrCrCrCrUrUrArCrGrArCrCrCrArArUrGrUrGrArArArA 3'; 5' rUrCrCrCrUrUrArCrGrArCrCrArArArUrGrUrGrArArArA 3'; 5' rUrCrCrCrUrUrArCrGrArCrCrArCrArUrGrUrGrArArArA 3'; miR-122: 5' rArCrCrUrGrCrArGrUrCrGrUrUrCrArCrArCrUrCrCrArArA 3'; 5' rArCrCrUrGrCrArGrUrCrGrUrCrCrArCrArCrUrCrCrArArA 3'; 5' rArCrCrUrGrCrArGrUrCrGrUrCrArArCrArCrUrCrCrArArA 3'; 5' rArCrCrUrGrCrArGrUrCrGrUrCrArUrCrArCrUrCrCrArArA 3'; 1 2 3 Protein Expression and Purification Crystallization Structure Determination 4 Analysis (2-9 paired) (2-8 paired) (2-7 paired) (2-8 paired, long) Materials and Methods Oligonucleotides Guide RNAs: Sod1: 5' p-rUrUrCrArCrArUrUrGrCrCrCrArArGrUrCrUrCrUrU 3'; miR-122: 5' p-rUrGrGrArGrUrGrUrGrArCrArArUrGrGrUrGrUrUrUrG 3' 2'OMethyl Capture oligos: Sod1: 5' Biotin- mUmCmUmUmCmCmCmAmCmGmAmCmUmUmCmAmUmAmAmAmUmGm UmGmAmAmAmCmCmUmU 3' miR-122: 5' Biotin- mUmCmUmCmUmGmCmUmAmAmCmCmAmUmGmCmGmAmAmCmA mCmUmCmCmAmUmCmUmCmUmGmC 3' Competitor DNAs: Sod1: 5' AAGGTTTCACATTTATGAAGTCGTGGGAAGA 3' miR-122: 5' GCAGAGATCAAGTGTTCGCATGGTTAGCAGAGA 3' Crystallized Target RNAs: 5' rCrArArUrGrUrGrArArArA 3'; 5' rArArArUrGrUrGrArArArA 3'; 5' rArCrArUrGrUrGrArArArA 3'; 5' rCrCrArArArUrGrUrGrArArArA 3'; Slicing Targets and Northern Blot Probes: Sod1: 5' rArArUrUrArArArArArGrArGrArCrUrUrGrGrGrCrArArUrGrUrGrArCrArCrCrUrUrAr A 3'
  13. 13. 14 EXPERIMENTS 1 2 3 Protein Expression and Purification 4 Full length human Ago2 was cloned into pFastBac HT A for expression using the bac-2-bac (Invitrogen) baculovirus expression system and over-expressed in Sf9 cells.
  14. 14. 15 EXPERIMENTS 1 2 3 Crystallization 4 Crystals of guide-loaded Ago2 were grown using hanging drop vapor diffusion. Ago2-guide-target complexes were formed by the addition of 1.2 molar equivalents of target RNA at room temperature for 10 minutes. Crystals of guide-loaded Ago2 bound to target RNA were grown using hanging drop vapor diffusion.
  15. 15. 16 EXPERIMENTS 1 2 3 Structure Determination 4 Ago2 crystal 4W5N 4W5O 4W5Q 4W5R 4W5T Target RNA guide only 2-9 paired 2-8 paired 2-8 paired (long) 2-7 paired Beamline SSRL 11-1 SSRL 12-2 SSRL 11-1 APS 24-ID-E SSRL 12-2 Space Group P1211 P1211 P1211 P1211 P1211 Unit Cell Dimensions A (Å) 63.12 55.81 55.50 55.38 55.64 B (Å) 108.87 116.99 116.65 116.18 116.47 C (Å) 68.07 69.77 70.07 69.68 69.82 α (°) 90.00 90.00 90.00 90.00 90.00 β (°) 106.93 92.45 92.26 92.17 92.34 γ (°) 90.00 90.00 90.00 90.00 90.00 Ago2 Molecules per ASU 1 1 1 1 1 Data Collection Ago2 crystal 4W5N 4W5O 4W5Q 4W5R 4W5T Target RNA guide only 2-9 paired 2-8 paired 2-8 paired (long) 2-7 paired Beamline SSRL 11-1 SSRL 12-2 SSRL 11-1 APS 24-ID-E SSRL 12-2 Space Group P1211 P1211 P1211 P1211 P1211 Unit Cell Dimensions A (Å) 63.12 55.81 55.50 55.38 55.64 B (Å) 108.87 116.99 116.65 116.18 116.47 C (Å) 68.07 69.77 70.07 69.68 69.82 α (°) 90.00 90.00 90.00 90.00 90.00 β (°) 106.93 92.45 92.26 92.17 92.34 γ (°) 90.00 90.00 90.00 90.00 90.00 Ago2 Molecules per ASU 1 1 1 1 1 Data Collection Wavelength (Å) 0.97945 0.97950 0.97944 0.97918 0.97950 Resolution (Å) 38.98-2.90 39.00-1.80 38.88-3.10 116.16-2.50 38.82-2.50 (3.08-2.90) (1.84-1.80) (3.31-3.10) (2.64-2.50) (2.64-2.50) No Reflections Total 67638 276820 55568 113374 104468 Unique 19381 80397 16052 30428 29434 Completeness (%) 98.8 (98.8) 97.7 (92.0) 98.9 (98.9) 99.8 (99.9) 95.8 (97.6) Redundancy 3.5 (3.6) 3.4 (3.4) 3.5 (3.4) 3.7 (3.7) 3.5 (3.6) I/σI 15.6 (2.6) 11.5 (2.2) 10.6 (2.5) 9.0 (1.9) 12.5 (3.3) Rmerge 7.0 (44.7) 5.5 (53.5) 9.4 (39.6) 14.1 (75.8) 7.4 (39.8) Rpim 6.8 (43.1) 5.1 (47.9) 9.0 (7.5) 8.5 (45.7) 4.6 (24.3) B (Å) 108.87 116.99 116.65 116.18 116.47 C (Å) 68.07 69.77 70.07 69.68 69.82 α (°) 90.00 90.00 90.00 90.00 90.00 β (°) 106.93 92.45 92.26 92.17 92.34 γ (°) 90.00 90.00 90.00 90.00 90.00 Ago2 Molecules per ASU 1 1 1 1 1 Data Collection Wavelength (Å) 0.97945 0.97950 0.97944 0.97918 0.97950 Resolution (Å) 38.98-2.90 39.00-1.80 38.88-3.10 116.16-2.50 38.82-2.50 (3.08-2.90) (1.84-1.80) (3.31-3.10) (2.64-2.50) (2.64-2.50) No Reflections Total 67638 276820 55568 113374 104468 Unique 19381 80397 16052 30428 29434 Completeness (%) 98.8 (98.8) 97.7 (92.0) 98.9 (98.9) 99.8 (99.9) 95.8 (97.6) Redundancy 3.5 (3.6) 3.4 (3.4) 3.5 (3.4) 3.7 (3.7) 3.5 (3.6) I/σI 15.6 (2.6) 11.5 (2.2) 10.6 (2.5) 9.0 (1.9) 12.5 (3.3) Rmerge 7.0 (44.7) 5.5 (53.5) 9.4 (39.6) 14.1 (75.8) 7.4 (39.8) Rpim 6.8 (43.1) 5.1 (47.9) 9.0 (7.5) 8.5 (45.7) 4.6 (24.3) Refinement Resolution (Å) 38.98-2.90 39.00-1.80 35.29-3.10 69.63-2.50 35.29-2.50 R-free/R-factor 25.33/21.73 19.65/16.72 23.25/19.03 23.4/19.46 21.51/17.28 R.M.S. Deviation Bond Distances (Å) 0.010 0.007 0.011 0.006 0.009 Bond Angles (°) 1.035 1.142 1.218 0.7820 1.194 Number of Atoms Non-hydrogen, protein 6461 6419 6439 6442 6471 Non-hydrogen, RNA 355 595 572 406 527 Phenol 21 28 28 21 28 Isopropanol 0 8 0 8 0 Phosphate 0 5 0 0 0 Mg 1 3 3 2 2 Water 34 433 0 126 156 Ramachandran Plot Most Favored Regions 93.83% 96.20% 93.95% 95.70% 96.11% Additionally Allowed 5.67% 3.68% 5.55% 4.05% 3.64% Generously Allowed 0.50% 0.13% 0.5% 0.25% 0.25%
  16. 16. 17 EXPERIMENTS 1 2 3 4 Analysis Binding Assays
  17. 17. 18 RESULTS
  18. 18. e-target t tates hibitory ved wo lencing of al repres- 0 miRNAs over 50% contain a sequently, ogical pro- mostly disordered, and no structure of any eu- karyotic Argonaute bound to a target RNA has been reported. Guide RNAs are threaded through the N-PAZ channel Structural insights into eukaryotic Argonaute proteins have been thwarted by the challenge of separating Argonaute from copurifying cellu- lar RNAs (15, 18). Although a protocol for purify- ing RNA-free Ago2 has been reported (19), the Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, CA 92037, USA. *Corresponding author. E-mail: macrae@scripps.edu 19 RESULTS duced silencing complexes contain a member of the ily (1). Argonaute uses the dentifying complementary are encoded in the human genome, and over 50% of mammalian protein-coding genes contain a conserved miRNA target site (3). Consequently, miRNAs contribute to diverse physiological pro- Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, CA 92037, USA. *Corresponding author. E-mail: macrae@scripps.edu he Ago2-guide complex. (A) Schematic of the Ago2 primary sequence. Front and top views of human Ago2 bound to a defined 2 contains a large central cleft between two lobes (N-PAZ and MID-PIWI) connected by two linker domains (L1 and L2). (B) Guide Mwithin RNA-induced silencing complexes (RISCs), which contain a member of the Argonaute protein family (1). Argonaute uses the miRNA as a guide for identifying complementary are encoded in the human genome, and over 50% of mammalian protein-coding genes contain a conserved miRNA target site (3). Consequently, miRNAs contribute to diverse physiological pro- Mwithin (RISCs) Argonaute prote miRNA as a gui Only four guide (g) nucleotides (nt g8–g11) disordered Structure of the Ago2-guide complex
  19. 19. 20 RESULTS duced silencing complexes contain a member of the ily (1). Argonaute uses the dentifying complementary are encoded in the human genome, and over 50% of mammalian protein-coding genes contain a conserved miRNA target site (3). Consequently, miRNAs contribute to diverse physiological pro- Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, CA 92037, USA. *Corresponding author. E-mail: macrae@scripps.edu he Ago2-guide complex. (A) Schematic of the Ago2 primary sequence. Front and top views of human Ago2 bound to a defined 2 contains a large central cleft between two lobes (N-PAZ and MID-PIWI) connected by two linker domains (L1 and L2). (B) Guide The guide 5′ end is anchored in the Ago2 MID (middle) domain, and nucleotides g2–g7 are splayed in a helical conformation. 608 31 OCTOBER 2014 • VOL 346 ISSUE 6209 Fig. 1. Structure of the Ago2-guide complex. (A) Sch guide RNA (red). Ago2 contains a large central cleft bet RNA omit map contoured at 2s (blue mesh). (C) Nucleo guide is threaded through the N-PAZ channel. (E) View Nucleotides g14–g18 are threaded through a narrow channel formed between the PAZ and N domains of Ago2. (A) Schematic of the Ago2 primary sequence. Front and top views of human Ago2 bound to a defined cleft between two lobes (N-PAZ and MID-PIWI) connected by two linker domains (L1 and L2). (B) Guide Structure of the Ago2-guide complex
  20. 20. 21 RESULTS duced silencing complexes contain a member of the ily (1). Argonaute uses the dentifying complementary are encoded in the human genome, and over 50% of mammalian protein-coding genes contain a conserved miRNA target site (3). Consequently, miRNAs contribute to diverse physiological pro- Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, CA 92037, USA. *Corresponding author. E-mail: macrae@scripps.edu he Ago2-guide complex. (A) Schematic of the Ago2 primary sequence. Front and top views of human Ago2 bound to a defined 2 contains a large central cleft between two lobes (N-PAZ and MID-PIWI) connected by two linker domains (L1 and L2). (B) Guide Consistent with the ability of Ago2 to bind guide RNAs of any nucleotide sequence, the majority of contacts are made through hydrogen bonds and salt linkages to the RNA sugar-phosphate backbone Fig. S2 Details of Ago2-guide interactions. (A) Residues Y529, K533, Q545, K566, and K570 of the MID domain, R812 of the PIWI domain, and the carboxy-terminus of the protein make direct contacts to the guide 5'-phosphate. (B) Residues K566 of the MID domain and K709, R712, H753, Y790, S798, and Y804 of the PIWI domain make direct contacts Structure of the Ago2-guide complex
  21. 21. 22 RESULTS duced silencing complexes contain a member of the ily (1). Argonaute uses the dentifying complementary are encoded in the human genome, and over 50% of mammalian protein-coding genes contain a conserved miRNA target site (3). Consequently, miRNAs contribute to diverse physiological pro- Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, CA 92037, USA. *Corresponding author. E-mail: macrae@scripps.edu he Ago2-guide complex. (A) Schematic of the Ago2 primary sequence. Front and top views of human Ago2 bound to a defined 2 contains a large central cleft between two lobes (N-PAZ and MID-PIWI) connected by two linker domains (L1 and L2). (B) Guide Improvements in the electron density map allowed to observe amino acid residues 119 to 125, which fold into a hairpin loop that forms the end of the N-PAZ channel and directs the guide 3′ end into the PAZ domain through contacts to g18. sciencemag.org SCIENCE of the Ago2 primary sequence. Front and top views of human Ago2 bound to a defined wo lobes (N-PAZ and MID-PIWI) connected by two linker domains (L1 and L2). (B) Guide 2–g5 are exposed, whereas Ago2 occludes nucleotides g6 and g7. (D) The 3′ half of the he N-PAZ channel. Structure of the Ago2-guide complex
  22. 22. 23 RESULTS duced silencing complexes contain a member of the ily (1). Argonaute uses the dentifying complementary are encoded in the human genome, and over 50% of mammalian protein-coding genes contain a conserved miRNA target site (3). Consequently, miRNAs contribute to diverse physiological pro- Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, CA 92037, USA. *Corresponding author. E-mail: macrae@scripps.edu he Ago2-guide complex. (A) Schematic of the Ago2 primary sequence. Front and top views of human Ago2 bound to a defined 2 contains a large central cleft between two lobes (N-PAZ and MID-PIWI) connected by two linker domains (L1 and L2). (B) Guide Sequences of guide (red) and target RNAs (blue). method generates relatively small amounts of material and is difficult to reproduce. As an al- ternative, we adapted a biochemical method for purifying RISC loaded with a specified guide from cell lysates (20) to produce milligram quan- tities of recombinant Ago2 bound to a defined 21-nt guide RNA. The ratio RNA in the purified sam pre–steady-state kinetics s Fig. 2. Structure of Ago2 bound to seed- matched target RNAs. (A) Sequences of guide (red) and target RNAs (blue). (B) Front and top views of Ago2 bound to guide and target RNAs. (C) Binding pocket for t1 adenine between L2 and MID domains. (D) Equilibrium binding data for target RNAs bearing different t1 nucleotides. Mean values from ≥ three independent replicates T SE shown. (E) Ago2 interrogates the guide-target minor groove. Protein is shown as a ribbon, RNA in surface representation, and interacting side-chains as sticks with dots. Helix-7 (a7) is indicated with the arrow. Fig. 3. Structural analysis of seed- pairing. (A to C) Ago2-guide-target RESEARCH | R (2-9 paired) mounts of e. As an al- method for purifying RISC loaded with a specified guide from cell lysates (20) to produce milligram quan- tities of recombinant Ago2 bound to a defined 21-nt guide RNA. The ratio of Ago2 protein to guide RNA in the purified samples is 1:1.2 T 0.2, and pre–steady-state kinetics showed that 99.0 T 8.6% d to seed- ces of guide ont and top et RNAs. (C) L2 and MID a for target Mean values E shown. (E) nor groove. in surface ins as sticks the arrow. RESEARCH | RESEARCH ARTICLES method generates relatively small amounts of material and is difficult to reproduce. As an al- ternative, we adapted a biochemical method for purifying RISC loaded with a specified guide from cell lysates (20) to produce milligram quan- tities of recombinant Ago2 bound to a defined 21-nt guide RNA. The r RNA in the purified pre–steady-state kineti Fig. 2. Structure of Ago2 bound to seed- matched target RNAs. (A) Sequences of guide (red) and target RNAs (blue). (B) Front and top views of Ago2 bound to guide and target RNAs. (C) Binding pocket for t1 adenine between L2 and MID domains. (D) Equilibrium binding data for target RNAs bearing different t1 nucleotides. Mean values from ≥ three independent replicates T SE shown. (E) Ago2 interrogates the guide-target minor groove. Protein is shown as a ribbon, RNA in surface representation, and interacting side-chains as sticks with dots. Helix-7 (a7) is indicated with the arrow. RESEARCH | Front and top views of Ago2 bound to guide and target RNAs. Structure of the Ago2 bound guide-target complex
  23. 23. 24 RESULTS duced silencing complexes contain a member of the ily (1). Argonaute uses the dentifying complementary are encoded in the human genome, and over 50% of mammalian protein-coding genes contain a conserved miRNA target site (3). Consequently, miRNAs contribute to diverse physiological pro- Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, CA 92037, USA. *Corresponding author. E-mail: macrae@scripps.edu he Ago2-guide complex. (A) Schematic of the Ago2 primary sequence. Front and top views of human Ago2 bound to a defined 2 contains a large central cleft between two lobes (N-PAZ and MID-PIWI) connected by two linker domains (L1 and L2). (B) Guide The pocket appears to specifically recognize adenosine nucleotides because a target RNA with a t1-A bound Ago2 with almost threefold higher affinity than equivalent targets with U, G, or C t1 nucleotides. Fig. 3. Structural analysis of seed- pairing. (A to C) Ago2-guide-target complexes with pairing to (A) g2–g7, (B) g2–g8, or (C) g2–g9. (D) Alignment of g2–g9 structure (guide, red; target, blue) with g2–g7 The t1- adenine inserts into a narrow pocket between the MID and L2 domains of Ago2 where Ser561 hydrogen bonds to the adenine N6 amine. Structure of the Ago2 bound guide-target complex
  24. 24. 25 RESULTS duced silencing complexes contain a member of the ily (1). Argonaute uses the dentifying complementary are encoded in the human genome, and over 50% of mammalian protein-coding genes contain a conserved miRNA target site (3). Consequently, miRNAs contribute to diverse physiological pro- Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, CA 92037, USA. *Corresponding author. E-mail: macrae@scripps.edu he Ago2-guide complex. (A) Schematic of the Ago2 primary sequence. Front and top views of human Ago2 bound to a defined 2 contains a large central cleft between two lobes (N-PAZ and MID-PIWI) connected by two linker domains (L1 and L2). (B) Guide Aliphatic segments of residues R795, I756, and Q757 within the PIWI domain and I365 and T361 on helix-7 of the L2 domain line the minor groove, making extensive hydrophobic and van der Waals interactions with positions 2 to 7 of the guide-target duplex Structure of the Ago2 bound guide-target complex
  25. 25. 26 RESULTS NCE sciencemag.org 31 OCTOBER 2014 • VOL 346 ISSUE 6209 609 3. Structural ysis of seed- ng. (A to C) -guide-target plexes with pairing ) g2–g7, (B) 8, or (C) g2–g9. lignment of 9 structure e, red; target, with g2–g7 ture (guide, pink; t, light blue). d F) Dissociation tants of wild type and F811A Ago2 ins binding target s with various ees of guide plementarity. was loaded with RNAs derived either (E) Sod1 or miR122. Mean of endent tripli- , TSEM. Binding experiments show that pairing to g8 can substantially contribute to the affinity of Ago2 for target RNAs. Structure of the Ago2 bound guide-target complex
  26. 26. 27 RESULTS An unrelated guide RNA displayed a smaller difference between the affinities for g2–g7 and g2–g8 complementary target RNAs, revealing that the degree to which pairing to g8 influences target affinity is dependent on the seed sequence. 31 OCTOBER 2014 • VOL 346 ISSUE 6209 609 Materials and Methods Oligonucleotides Guide RNAs: Sod1: 5' p-rUrUrCrArCrArUrUrGrCrCrCrArArGrUrCrUrCrUrU 3'; miR-122: 5' p-rUrGrGrArGrUrGrUrGrArCrArArUrGrGrUrGrUrUrUrG 3' 2'OMethyl Capture oligos: Sod1: 5' Biotin- mUmCmUmUmCmCmCmAmCmGmAmCmUmUmCmAmUmAmAmAmUmGm UmGmAmAmAmCmCmUmU 3' miR-122: 5' Biotin- mUmCmUmCmUmGmCmUmAmAmCmCmAmUmGmCmGmAmAmCmA mCmUmCmCmAmUmCmUmCmUmGmC 3' Competitor DNAs: Sod1: 5' AAGGTTTCACATTTATGAAGTCGTGGGAAGA 3' Structure of the Ago2 bound guide-target complex
  27. 27. 28 RESULTS duced silencing complexes contain a member of the ily (1). Argonaute uses the dentifying complementary are encoded in the human genome, and over 50% of mammalian protein-coding genes contain a conserved miRNA target site (3). Consequently, miRNAs contribute to diverse physiological pro- Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, CA 92037, USA. *Corresponding author. E-mail: macrae@scripps.edu he Ago2-guide complex. (A) Schematic of the Ago2 primary sequence. Front and top views of human Ago2 bound to a defined 2 contains a large central cleft between two lobes (N-PAZ and MID-PIWI) connected by two linker domains (L1 and L2). (B) Guide In moving from the guide- only to the target-bound conformation, helix-7 shifts ~4 Å to interact with the minor groove of the guide-target duplex. The movement of helix-7 is required to avoid steric clashes with target nt t6 and t7 and is therefore necessary for target pairing beyond g5. G, Gly; H, His; Asn; P, Pro; Q, W, Trp; and Y, o acids were for example, ne at position Ago2 does not ions 8 and 9, tary target RNAs, revealing that the degree to which pairing to g8 influences target affinity is dependent on the seed sequence (Fig. 3F). Narrowing of the central cleft restricts pairing past g8 Although complementarity to g8 increased the affinity of Ago2 for target RNAs, extending com- plementarity to g9 and g10 did not enhance (Fig. 4, D and E). We conclude that the observed conformation of Ago2 can only accommodate pairing to g9 when using short targets that end at t9 (such as those used to facilitate crystalli- zation), and that pairing to g9 on longer targets (such as those in the 3′ UTR of a mRNA) requires further opening of the Ago2 central cleft. We suggest that opening the cleft involves confor- mational changes responsible for the decrease de and Ago2- 7 (a7) shifts to As. The Ago2- he Ago2-guide- AZ domain and position of pro- emitransparent) uctures. Arrows to guide-target e in the L1/L2 he guide RNA uide-only and e supplemental ed helical con- tructure. (F) Il- mental pairing. Structure of the Ago2 bound guide RNA with and without target RNAs
  28. 28. 29 RESULTS Magnesium ion (green) is bound to the D597 carboxylate side chain, the V598 main chain carbonyl, and four water molecules (brown spheres). CLES airing to g9. plementarity d feature of duplex with a minor groove that provides a new binding surface for helix-7, stabilizing the opened conformation. Conversely, mismatches form conformation (Fig. 5, C and D). Helical stacking is disrupted after g16 by P67 of the N domain, and electron density for g17–g19 is he Ago2 active site. (A and B). Magne- D597 carboxylate side chain, the V598 ter molecules (brown spheres). 2Fo-Fc at 1.5s (A), and Fo-Fc magnesium omit d at 15s (B). (C) Active site of Ago2 e site of TtAgo (yellow) (PDB ID 3DLH). (D) Ago2 active site aligned with plugged-in TtAgo (blue) (PDB ID 3HVR). Metals ions are shown as spheres. (E) Ago2 active site aligned with Bacillus halodurans RNase H (pink with red magnesium ion; PDB ID 2G8H). (F) Align- ment of Ago2 (gray with green magnesium), TtAgo (blue), and B. halodurans RNase H (pink) shows the Ago2 magnesium shifted 1.5 Å from the active position. Alignment of Ago2 (gray with green magnesium), TtAgo (blue), and B. halodurans RNase H (pink) shows the Ago2 magnesium shifted 1.5 Å from the active position. Structure of inactivated magnesium ion in the slicer active site
  29. 29. 30 CONCLUSION
  30. 30. CONCLUSION 31 Stepwise mechanism, in which Ago2 primarily exposes guide nucleotides (nt) 2 to 5 for initial target pairing. Pairing to nt 2 to 5 promotes conformational changes that expose nt 2 to 8 and 13 to 16 for further target recognition. Interactions with the guide-target minor groove allow Ago2 to interrogate target RNAs in a sequence-independent manner, whereas an adenosine binding-pocket opposite guide nt 1 further facilitates target recognition. Slicing of miRNA targets is avoided through an inhibitory coordination of one catalytic magnesium ion by bound to the D597 carboxylate side chain, the V598 main chain carbonyl, and four water molecules.
  31. 31. 32 REFERENCES (1) Ha, M., and Kim, V. N. (2014). Regulation of microRNA biogenesis. Nat Rev Mol Cell Biol 15, 509-524. (2) Hutvagner, G., and Simard, M. J. (2008). Argonaute proteins: key players in RNA silencing. Nat Rev Mol Cell Biol 9, 22-32. (3) Jinek, M., and Doudna, J. A. (2009). A three-dimensional view of the molecular machinery of RNA interference. Nature 457, 405-412.
  32. 32. Schirle, N. T., et al. (2014) Presented by Bundit Boonyarit 5814400587 Dept.Biochemistry, Fac.Science, Kasertsart University tructure basis for microRNA targetingS December 27, 2015

×