SlideShare a Scribd company logo
1 of 52
ATTENDANCE
You are given a piece of
paper with a
questions/phrases in it,
and they need to find the
students whose holding the
other piece of paper with
an answer on it.
I'm
Puzzled?!
?
Each group will be
given a puzzle that
the students will need
to arrange and hold it
for the next activity.
I'm
Complete
Now!!!
After you complete the
puzzle flip it and you
will see a jumbled
letters, arrange it,
paste the picture at
the board and write
the word below it.
CENTRAL DOGMA
OF MOLECULAR
BIOLOGY
At the end of the lesson the
students should be able to:
• describe the building blocks
of DNA, RNA and proteins;
• differentiate the structural
and functional characteristics
of DNA and RNA;
• characterized the different
levels of protein structure
and
• apply and translate the given
coding sequences.
PICTIONARY
Pick a representative in
each group. The
representative will be
given a description and
he/she had to do is draw
the description, and the
rest of the group will
guess the word.
is a term used to
describe the physical
structure of DNA
is the structure of
the simplest type of
RNA
basic unit from which
something is built up
A functional group
characterized by a
phosphorus atom bonded
to four oxygen atoms
(three single bonds
and one double bond).
• Francis Harry Compton
Crick OM FRS (8 June 1916
– 28 July 2004) was an
English molecular
biologist, biophysicist,
and neuroscientist.
• The fundamental theory of
central dogma was
developed by Francis
Crick in 1958.
DNA → RNA → protein
• A nucleotide is the
basic building block of
nucleic acids (RNA and
DNA).
• A nucleotide consists
of a sugar molecule
(either ribose in RNA
or deoxyribose in DNA)
attached to a phosphate
group
• deoxyribonucleic acid
• it contains the genetic
information used in the
development and functioning
of all known living
organisms.
• mostly found in the
nucleus.
• double helix
• Adenine, Thymine, Guanine,
Cytosine
• Ribonucleic acid
• RNA helps in the
synthesis of proteins
in our body.
• single-stranded
• adenine, guanine,
cytosine, and uracil
• it provides the template for
protein synthesis during
translation.
• it carries the genetic code
from DNA during transcription,
in the form of triplets of
nucleotides called codons.
• usually found in the
ribosome.
• rRNAs combine with proteins
and enzymes in the
cytoplasm to form
ribosomes, which act as the
site of protein synthesis.
• transfer of amino acids during
protein synthesis.
• reads the genetic code during
translation.
• also act as adapters in the
translation of the genetic
sequence of mRNA into proteins.
Thus, they are also called
adapter molecules.
• Proteins are among the most
abundant organic molecules
in living systems and are
way more diverse in
structure and function than
other classes of
macromolecules.
• The simplest level of
protein structure, primary
structure, is simply the
sequence of amino acids in
a polypeptide chain.
• Refers to local folded
structures that form within a
polypeptide due to
interactions between atoms of
the backbone.
• Three dimensional folding
pattern of a protein due to
interactions between the R
groups of the amino acids that
make up the protein.
• The quaternary structure of
a protein is how its
subunits are oriented and
arranged with respect to one
another.
• Cells decode mRNAs by reading
their nucleotides in groups of
three, called codons.
• used to translate a genetic
code into a sequence of amino
acids.
Adenine(A) Thymine(T)
Cytosine(C) Guanine(G)
DNA
RNA
Adenine(A) Uracil(U)
Cytosine(C) Guanine(G)
5' ATG CAT AGA TTA GGA TAT CCC AGA TAG 3'
5' UAC GUA UCU AAU CCU AUA GGG UCU AUC 3'
5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C
1) 5’ AAATCTATCGGGTCTATACCTTTAGGT 3’
2) 5’ GTAGCATCATCGTCCCCTCTGCTAGAT 3’
5’ AAA TCT ATC GGG TCT ATA CCT TTA GGT 3’
5’ UUU AGA UAG CCC AGA UAU GGA AAU CCA 3’
mRNA
Proteins
5’ PHE ARG STOP PRO ARG TYR GLY ASN PRO 3’
5’ GTA GCA TCA TCG TCC CCT CTG CTA GAT 3’
5’ UUU AGA UAG CCC AGA UAU GGA AAU CCA 3’
mRNA
Proteins
5’ HIS ARG SER SER ARG GLY ASP ASP LEU 3’
Directions: Using the template
below. Draw the structure of
the 4 structure of protein and
write it's characteristic.
Direction: Choose and write the letter
of the correct answer.
Direction: Choose and write the letter
of the correct answer.
Research
about DNA
replication
A S S I G N M E N T
DNA Replication Lesson Activity

More Related Content

What's hot

The quantum mechanical model of the atom
The quantum mechanical model of the atomThe quantum mechanical model of the atom
The quantum mechanical model of the atomPearlie Joy Fajanil
 
Arranging the elements
Arranging the elementsArranging the elements
Arranging the elementsRuba Salah
 
6 concept of atomic no.... moran & atega
6 concept of atomic no.... moran & atega6 concept of atomic no.... moran & atega
6 concept of atomic no.... moran & ategaRupert Capellan
 
Dacota Blue: Scientific attitude
Dacota Blue: Scientific attitudeDacota Blue: Scientific attitude
Dacota Blue: Scientific attitudeDaniel Tabinga
 
earthquakesandfaults-171023070052 (1).pdf
earthquakesandfaults-171023070052 (1).pdfearthquakesandfaults-171023070052 (1).pdf
earthquakesandfaults-171023070052 (1).pdfIvy Lynne Esguerra
 
Filipino hiphop presentation
Filipino hiphop presentationFilipino hiphop presentation
Filipino hiphop presentationElaine Lee
 
Strategic intervention material
Strategic intervention materialStrategic intervention material
Strategic intervention materialRodtips
 
THE CONCEPT OF LIFE BASED ON.pptx
THE CONCEPT OF LIFE BASED ON.pptxTHE CONCEPT OF LIFE BASED ON.pptx
THE CONCEPT OF LIFE BASED ON.pptxElvinMacajelos
 
Earthquakes and faults (Grade 8 Lesson)
Earthquakes and faults (Grade 8 Lesson) Earthquakes and faults (Grade 8 Lesson)
Earthquakes and faults (Grade 8 Lesson) Riya Duran
 
Sim (earth's plate movement)
Sim (earth's plate movement)Sim (earth's plate movement)
Sim (earth's plate movement)Sirjpdmcmhs
 
Lesson 8 physical science
Lesson 8 physical science Lesson 8 physical science
Lesson 8 physical science Marjorie Brondo
 
General Physics 2.pptx
General Physics 2.pptxGeneral Physics 2.pptx
General Physics 2.pptxssuserc87763
 
Science 8 module 1 Forces and Motion
Science 8 module 1 Forces and MotionScience 8 module 1 Forces and Motion
Science 8 module 1 Forces and MotionVenus Metilla
 

What's hot (20)

The quantum mechanical model of the atom
The quantum mechanical model of the atomThe quantum mechanical model of the atom
The quantum mechanical model of the atom
 
Electronic configuration final
Electronic configuration finalElectronic configuration final
Electronic configuration final
 
Arranging the elements
Arranging the elementsArranging the elements
Arranging the elements
 
Topic 2: Structure of matter
Topic 2: Structure of matterTopic 2: Structure of matter
Topic 2: Structure of matter
 
Unit 9 Chemical Bonding
Unit 9 Chemical BondingUnit 9 Chemical Bonding
Unit 9 Chemical Bonding
 
6 concept of atomic no.... moran & atega
6 concept of atomic no.... moran & atega6 concept of atomic no.... moran & atega
6 concept of atomic no.... moran & atega
 
Dacota Blue: Scientific attitude
Dacota Blue: Scientific attitudeDacota Blue: Scientific attitude
Dacota Blue: Scientific attitude
 
earthquakesandfaults-171023070052 (1).pdf
earthquakesandfaults-171023070052 (1).pdfearthquakesandfaults-171023070052 (1).pdf
earthquakesandfaults-171023070052 (1).pdf
 
Earthquakes and Fault Grade 8
Earthquakes and Fault Grade 8Earthquakes and Fault Grade 8
Earthquakes and Fault Grade 8
 
Filipino hiphop presentation
Filipino hiphop presentationFilipino hiphop presentation
Filipino hiphop presentation
 
Strategic intervention material
Strategic intervention materialStrategic intervention material
Strategic intervention material
 
Polar and Non-Polar Bonds
Polar and Non-Polar BondsPolar and Non-Polar Bonds
Polar and Non-Polar Bonds
 
THE CONCEPT OF LIFE BASED ON.pptx
THE CONCEPT OF LIFE BASED ON.pptxTHE CONCEPT OF LIFE BASED ON.pptx
THE CONCEPT OF LIFE BASED ON.pptx
 
Earthquakes and faults (Grade 8 Lesson)
Earthquakes and faults (Grade 8 Lesson) Earthquakes and faults (Grade 8 Lesson)
Earthquakes and faults (Grade 8 Lesson)
 
Sim (earth's plate movement)
Sim (earth's plate movement)Sim (earth's plate movement)
Sim (earth's plate movement)
 
Lesson 8 physical science
Lesson 8 physical science Lesson 8 physical science
Lesson 8 physical science
 
Physical science (1)
Physical science (1)Physical science (1)
Physical science (1)
 
General Physics 2.pptx
General Physics 2.pptxGeneral Physics 2.pptx
General Physics 2.pptx
 
Science 8 module 1 Forces and Motion
Science 8 module 1 Forces and MotionScience 8 module 1 Forces and Motion
Science 8 module 1 Forces and Motion
 
Heredity Science Grade 10 3rd Quarter
Heredity Science Grade 10 3rd QuarterHeredity Science Grade 10 3rd Quarter
Heredity Science Grade 10 3rd Quarter
 

Similar to DNA Replication Lesson Activity

Molecular genetics 1 win q
Molecular genetics 1 win qMolecular genetics 1 win q
Molecular genetics 1 win qXu Jia Xian
 
Basics of molecular biology
Basics of molecular biologyBasics of molecular biology
Basics of molecular biologyAshfaq Ahmad
 
Basics of molecular biology tools and techniques
Basics of molecular biology tools and techniquesBasics of molecular biology tools and techniques
Basics of molecular biology tools and techniquesBOTANYWith
 
Basics of molecular biology
Basics of molecular biologyBasics of molecular biology
Basics of molecular biologyIhteram Ullah
 
lect-1-Basics-of-Molecular-Biology.ppt
lect-1-Basics-of-Molecular-Biology.pptlect-1-Basics-of-Molecular-Biology.ppt
lect-1-Basics-of-Molecular-Biology.pptAmosWafula3
 
lect-1-Basics-of-Molecular-Biology.ppt
lect-1-Basics-of-Molecular-Biology.pptlect-1-Basics-of-Molecular-Biology.ppt
lect-1-Basics-of-Molecular-Biology.pptmuhammedsayfadin
 
Nucleic Acids Structure and Functions
Nucleic Acids Structure and FunctionsNucleic Acids Structure and Functions
Nucleic Acids Structure and FunctionsAtif Khirelsied
 
CELL REPLICATION.pptx
CELL REPLICATION.pptxCELL REPLICATION.pptx
CELL REPLICATION.pptxRizaCatli2
 
Basics of Molecular Biology
Basics of Molecular BiologyBasics of Molecular Biology
Basics of Molecular BiologyTapeshwar Yadav
 
Structure of DNA and RNA and its functions
Structure of DNA and RNA and its functionsStructure of DNA and RNA and its functions
Structure of DNA and RNA and its functionsJeevan287994
 
Basics of molecular biology
Basics of molecular biologyBasics of molecular biology
Basics of molecular biologyMangesh Bhosale
 
DNA vs RNA and Comparison.pptx
DNA vs RNA  and Comparison.pptxDNA vs RNA  and Comparison.pptx
DNA vs RNA and Comparison.pptxYousefMElshrek
 
molecular bilogy lab medical third year
molecular bilogy lab medical   third yearmolecular bilogy lab medical   third year
molecular bilogy lab medical third yearalhamily556677
 
DNA replication, transcription, and translation
DNA replication, transcription, and translationDNA replication, transcription, and translation
DNA replication, transcription, and translationjun de la Ceruz
 
FUnction and Structure of DNA and RNA.pptx
FUnction and Structure of DNA and RNA.pptxFUnction and Structure of DNA and RNA.pptx
FUnction and Structure of DNA and RNA.pptxpaolo Macarayo
 
Mira_Nucleotides_NucleicA_Chemistry_Metabolism.pptx
Mira_Nucleotides_NucleicA_Chemistry_Metabolism.pptxMira_Nucleotides_NucleicA_Chemistry_Metabolism.pptx
Mira_Nucleotides_NucleicA_Chemistry_Metabolism.pptxMira426412
 
DNA_RNA_11_.ppt.pptx
DNA_RNA_11_.ppt.pptxDNA_RNA_11_.ppt.pptx
DNA_RNA_11_.ppt.pptxMEENUDOLIA1
 
Molecular biology dna, rna, rep, trancr, transl (autosaved)
Molecular biology  dna, rna, rep, trancr, transl (autosaved)Molecular biology  dna, rna, rep, trancr, transl (autosaved)
Molecular biology dna, rna, rep, trancr, transl (autosaved)Ministry of Education, Ethiopia
 

Similar to DNA Replication Lesson Activity (20)

Molecular genetics 1 win q
Molecular genetics 1 win qMolecular genetics 1 win q
Molecular genetics 1 win q
 
Basics of molecular biology
Basics of molecular biologyBasics of molecular biology
Basics of molecular biology
 
Basics of molecular biology tools and techniques
Basics of molecular biology tools and techniquesBasics of molecular biology tools and techniques
Basics of molecular biology tools and techniques
 
Basics of molecular biology
Basics of molecular biologyBasics of molecular biology
Basics of molecular biology
 
lect-1-Basics-of-Molecular-Biology.ppt
lect-1-Basics-of-Molecular-Biology.pptlect-1-Basics-of-Molecular-Biology.ppt
lect-1-Basics-of-Molecular-Biology.ppt
 
lect-1-Basics-of-Molecular-Biology.ppt
lect-1-Basics-of-Molecular-Biology.pptlect-1-Basics-of-Molecular-Biology.ppt
lect-1-Basics-of-Molecular-Biology.ppt
 
Rna structure
Rna structureRna structure
Rna structure
 
Nucleic Acids Structure and Functions
Nucleic Acids Structure and FunctionsNucleic Acids Structure and Functions
Nucleic Acids Structure and Functions
 
CELL REPLICATION.pptx
CELL REPLICATION.pptxCELL REPLICATION.pptx
CELL REPLICATION.pptx
 
Basics of Molecular Biology
Basics of Molecular BiologyBasics of Molecular Biology
Basics of Molecular Biology
 
Structure of DNA and RNA and its functions
Structure of DNA and RNA and its functionsStructure of DNA and RNA and its functions
Structure of DNA and RNA and its functions
 
Basics of molecular biology
Basics of molecular biologyBasics of molecular biology
Basics of molecular biology
 
DNA vs RNA and Comparison.pptx
DNA vs RNA  and Comparison.pptxDNA vs RNA  and Comparison.pptx
DNA vs RNA and Comparison.pptx
 
molecular bilogy lab medical third year
molecular bilogy lab medical   third yearmolecular bilogy lab medical   third year
molecular bilogy lab medical third year
 
DNA replication, transcription, and translation
DNA replication, transcription, and translationDNA replication, transcription, and translation
DNA replication, transcription, and translation
 
FUnction and Structure of DNA and RNA.pptx
FUnction and Structure of DNA and RNA.pptxFUnction and Structure of DNA and RNA.pptx
FUnction and Structure of DNA and RNA.pptx
 
Mira_Nucleotides_NucleicA_Chemistry_Metabolism.pptx
Mira_Nucleotides_NucleicA_Chemistry_Metabolism.pptxMira_Nucleotides_NucleicA_Chemistry_Metabolism.pptx
Mira_Nucleotides_NucleicA_Chemistry_Metabolism.pptx
 
DNA_RNA_11_.ppt.pptx
DNA_RNA_11_.ppt.pptxDNA_RNA_11_.ppt.pptx
DNA_RNA_11_.ppt.pptx
 
D na and rna
D na and rnaD na and rna
D na and rna
 
Molecular biology dna, rna, rep, trancr, transl (autosaved)
Molecular biology  dna, rna, rep, trancr, transl (autosaved)Molecular biology  dna, rna, rep, trancr, transl (autosaved)
Molecular biology dna, rna, rep, trancr, transl (autosaved)
 

More from JezzcelPiring

Elements and Compounds.pptx
Elements and Compounds.pptxElements and Compounds.pptx
Elements and Compounds.pptxJezzcelPiring
 
Week-9-Energy-changes-in-Chemical-Reactions.pptx
Week-9-Energy-changes-in-Chemical-Reactions.pptxWeek-9-Energy-changes-in-Chemical-Reactions.pptx
Week-9-Energy-changes-in-Chemical-Reactions.pptxJezzcelPiring
 
disaster-risk-reduction-and-disaster-risk-management-ppt.pptx
disaster-risk-reduction-and-disaster-risk-management-ppt.pptxdisaster-risk-reduction-and-disaster-risk-management-ppt.pptx
disaster-risk-reduction-and-disaster-risk-management-ppt.pptxJezzcelPiring
 
Basic Concept Of Hazard (PPT).pptx
Basic Concept Of Hazard (PPT).pptxBasic Concept Of Hazard (PPT).pptx
Basic Concept Of Hazard (PPT).pptxJezzcelPiring
 
Homogeneous Vs. Heterogeneous.pptx
Homogeneous Vs. Heterogeneous.pptxHomogeneous Vs. Heterogeneous.pptx
Homogeneous Vs. Heterogeneous.pptxJezzcelPiring
 
Grade 3 Unit 4 Lesson 2 The Water Cycle.ppt
Grade 3 Unit 4 Lesson 2 The Water Cycle.pptGrade 3 Unit 4 Lesson 2 The Water Cycle.ppt
Grade 3 Unit 4 Lesson 2 The Water Cycle.pptJezzcelPiring
 
DRRR-Powerpoint.pptx
DRRR-Powerpoint.pptxDRRR-Powerpoint.pptx
DRRR-Powerpoint.pptxJezzcelPiring
 
ICT Integration.pptx
ICT Integration.pptxICT Integration.pptx
ICT Integration.pptxJezzcelPiring
 
Earthquake Hazard (PPT).pptx
Earthquake Hazard (PPT).pptxEarthquake Hazard (PPT).pptx
Earthquake Hazard (PPT).pptxJezzcelPiring
 
Chapter 5 (UCSP).pptx
Chapter 5 (UCSP).pptxChapter 5 (UCSP).pptx
Chapter 5 (UCSP).pptxJezzcelPiring
 
CHAPTER 8 (SOCIAL AND POLITICAL STRATIFICATION).pptx
CHAPTER 8 (SOCIAL AND POLITICAL STRATIFICATION).pptxCHAPTER 8 (SOCIAL AND POLITICAL STRATIFICATION).pptx
CHAPTER 8 (SOCIAL AND POLITICAL STRATIFICATION).pptxJezzcelPiring
 
Chapter 2 (Understanding Culture and Society).pptx
Chapter 2 (Understanding Culture and Society).pptxChapter 2 (Understanding Culture and Society).pptx
Chapter 2 (Understanding Culture and Society).pptxJezzcelPiring
 
CHAPTER 6 (SOCIAL INSTITUTION).pptx
CHAPTER 6 (SOCIAL INSTITUTION).pptxCHAPTER 6 (SOCIAL INSTITUTION).pptx
CHAPTER 6 (SOCIAL INSTITUTION).pptxJezzcelPiring
 
CHAPTER 7 (POLITICAL INSTITUTION).pptx
CHAPTER 7 (POLITICAL INSTITUTION).pptxCHAPTER 7 (POLITICAL INSTITUTION).pptx
CHAPTER 7 (POLITICAL INSTITUTION).pptxJezzcelPiring
 

More from JezzcelPiring (16)

Elements and Compounds.pptx
Elements and Compounds.pptxElements and Compounds.pptx
Elements and Compounds.pptx
 
Week-9-Energy-changes-in-Chemical-Reactions.pptx
Week-9-Energy-changes-in-Chemical-Reactions.pptxWeek-9-Energy-changes-in-Chemical-Reactions.pptx
Week-9-Energy-changes-in-Chemical-Reactions.pptx
 
disaster-risk-reduction-and-disaster-risk-management-ppt.pptx
disaster-risk-reduction-and-disaster-risk-management-ppt.pptxdisaster-risk-reduction-and-disaster-risk-management-ppt.pptx
disaster-risk-reduction-and-disaster-risk-management-ppt.pptx
 
Basic Concept Of Hazard (PPT).pptx
Basic Concept Of Hazard (PPT).pptxBasic Concept Of Hazard (PPT).pptx
Basic Concept Of Hazard (PPT).pptx
 
Homogeneous Vs. Heterogeneous.pptx
Homogeneous Vs. Heterogeneous.pptxHomogeneous Vs. Heterogeneous.pptx
Homogeneous Vs. Heterogeneous.pptx
 
BigBang.pptx
BigBang.pptxBigBang.pptx
BigBang.pptx
 
Solutions.pptx
Solutions.pptxSolutions.pptx
Solutions.pptx
 
Grade 3 Unit 4 Lesson 2 The Water Cycle.ppt
Grade 3 Unit 4 Lesson 2 The Water Cycle.pptGrade 3 Unit 4 Lesson 2 The Water Cycle.ppt
Grade 3 Unit 4 Lesson 2 The Water Cycle.ppt
 
DRRR-Powerpoint.pptx
DRRR-Powerpoint.pptxDRRR-Powerpoint.pptx
DRRR-Powerpoint.pptx
 
ICT Integration.pptx
ICT Integration.pptxICT Integration.pptx
ICT Integration.pptx
 
Earthquake Hazard (PPT).pptx
Earthquake Hazard (PPT).pptxEarthquake Hazard (PPT).pptx
Earthquake Hazard (PPT).pptx
 
Chapter 5 (UCSP).pptx
Chapter 5 (UCSP).pptxChapter 5 (UCSP).pptx
Chapter 5 (UCSP).pptx
 
CHAPTER 8 (SOCIAL AND POLITICAL STRATIFICATION).pptx
CHAPTER 8 (SOCIAL AND POLITICAL STRATIFICATION).pptxCHAPTER 8 (SOCIAL AND POLITICAL STRATIFICATION).pptx
CHAPTER 8 (SOCIAL AND POLITICAL STRATIFICATION).pptx
 
Chapter 2 (Understanding Culture and Society).pptx
Chapter 2 (Understanding Culture and Society).pptxChapter 2 (Understanding Culture and Society).pptx
Chapter 2 (Understanding Culture and Society).pptx
 
CHAPTER 6 (SOCIAL INSTITUTION).pptx
CHAPTER 6 (SOCIAL INSTITUTION).pptxCHAPTER 6 (SOCIAL INSTITUTION).pptx
CHAPTER 6 (SOCIAL INSTITUTION).pptx
 
CHAPTER 7 (POLITICAL INSTITUTION).pptx
CHAPTER 7 (POLITICAL INSTITUTION).pptxCHAPTER 7 (POLITICAL INSTITUTION).pptx
CHAPTER 7 (POLITICAL INSTITUTION).pptx
 

Recently uploaded

ACC 2024 Chronicles. Cardiology. Exam.pdf
ACC 2024 Chronicles. Cardiology. Exam.pdfACC 2024 Chronicles. Cardiology. Exam.pdf
ACC 2024 Chronicles. Cardiology. Exam.pdfSpandanaRallapalli
 
Culture Uniformity or Diversity IN SOCIOLOGY.pptx
Culture Uniformity or Diversity IN SOCIOLOGY.pptxCulture Uniformity or Diversity IN SOCIOLOGY.pptx
Culture Uniformity or Diversity IN SOCIOLOGY.pptxPoojaSen20
 
ENGLISH6-Q4-W3.pptxqurter our high choom
ENGLISH6-Q4-W3.pptxqurter our high choomENGLISH6-Q4-W3.pptxqurter our high choom
ENGLISH6-Q4-W3.pptxqurter our high choomnelietumpap1
 
Karra SKD Conference Presentation Revised.pptx
Karra SKD Conference Presentation Revised.pptxKarra SKD Conference Presentation Revised.pptx
Karra SKD Conference Presentation Revised.pptxAshokKarra1
 
Incoming and Outgoing Shipments in 3 STEPS Using Odoo 17
Incoming and Outgoing Shipments in 3 STEPS Using Odoo 17Incoming and Outgoing Shipments in 3 STEPS Using Odoo 17
Incoming and Outgoing Shipments in 3 STEPS Using Odoo 17Celine George
 
Visit to a blind student's school🧑‍🦯🧑‍🦯(community medicine)
Visit to a blind student's school🧑‍🦯🧑‍🦯(community medicine)Visit to a blind student's school🧑‍🦯🧑‍🦯(community medicine)
Visit to a blind student's school🧑‍🦯🧑‍🦯(community medicine)lakshayb543
 
THEORIES OF ORGANIZATION-PUBLIC ADMINISTRATION
THEORIES OF ORGANIZATION-PUBLIC ADMINISTRATIONTHEORIES OF ORGANIZATION-PUBLIC ADMINISTRATION
THEORIES OF ORGANIZATION-PUBLIC ADMINISTRATIONHumphrey A Beña
 
AMERICAN LANGUAGE HUB_Level2_Student'sBook_Answerkey.pdf
AMERICAN LANGUAGE HUB_Level2_Student'sBook_Answerkey.pdfAMERICAN LANGUAGE HUB_Level2_Student'sBook_Answerkey.pdf
AMERICAN LANGUAGE HUB_Level2_Student'sBook_Answerkey.pdfphamnguyenenglishnb
 
How to Add Barcode on PDF Report in Odoo 17
How to Add Barcode on PDF Report in Odoo 17How to Add Barcode on PDF Report in Odoo 17
How to Add Barcode on PDF Report in Odoo 17Celine George
 
Choosing the Right CBSE School A Comprehensive Guide for Parents
Choosing the Right CBSE School A Comprehensive Guide for ParentsChoosing the Right CBSE School A Comprehensive Guide for Parents
Choosing the Right CBSE School A Comprehensive Guide for Parentsnavabharathschool99
 
Like-prefer-love -hate+verb+ing & silent letters & citizenship text.pdf
Like-prefer-love -hate+verb+ing & silent letters & citizenship text.pdfLike-prefer-love -hate+verb+ing & silent letters & citizenship text.pdf
Like-prefer-love -hate+verb+ing & silent letters & citizenship text.pdfMr Bounab Samir
 
Grade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdf
Grade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdfGrade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdf
Grade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdfJemuel Francisco
 
Earth Day Presentation wow hello nice great
Earth Day Presentation wow hello nice greatEarth Day Presentation wow hello nice great
Earth Day Presentation wow hello nice greatYousafMalik24
 
What is Model Inheritance in Odoo 17 ERP
What is Model Inheritance in Odoo 17 ERPWhat is Model Inheritance in Odoo 17 ERP
What is Model Inheritance in Odoo 17 ERPCeline George
 
How to do quick user assign in kanban in Odoo 17 ERP
How to do quick user assign in kanban in Odoo 17 ERPHow to do quick user assign in kanban in Odoo 17 ERP
How to do quick user assign in kanban in Odoo 17 ERPCeline George
 
Barangay Council for the Protection of Children (BCPC) Orientation.pptx
Barangay Council for the Protection of Children (BCPC) Orientation.pptxBarangay Council for the Protection of Children (BCPC) Orientation.pptx
Barangay Council for the Protection of Children (BCPC) Orientation.pptxCarlos105
 
USPS® Forced Meter Migration - How to Know if Your Postage Meter Will Soon be...
USPS® Forced Meter Migration - How to Know if Your Postage Meter Will Soon be...USPS® Forced Meter Migration - How to Know if Your Postage Meter Will Soon be...
USPS® Forced Meter Migration - How to Know if Your Postage Meter Will Soon be...Postal Advocate Inc.
 

Recently uploaded (20)

YOUVE_GOT_EMAIL_PRELIMS_EL_DORADO_2024.pptx
YOUVE_GOT_EMAIL_PRELIMS_EL_DORADO_2024.pptxYOUVE_GOT_EMAIL_PRELIMS_EL_DORADO_2024.pptx
YOUVE_GOT_EMAIL_PRELIMS_EL_DORADO_2024.pptx
 
ACC 2024 Chronicles. Cardiology. Exam.pdf
ACC 2024 Chronicles. Cardiology. Exam.pdfACC 2024 Chronicles. Cardiology. Exam.pdf
ACC 2024 Chronicles. Cardiology. Exam.pdf
 
Culture Uniformity or Diversity IN SOCIOLOGY.pptx
Culture Uniformity or Diversity IN SOCIOLOGY.pptxCulture Uniformity or Diversity IN SOCIOLOGY.pptx
Culture Uniformity or Diversity IN SOCIOLOGY.pptx
 
ENGLISH6-Q4-W3.pptxqurter our high choom
ENGLISH6-Q4-W3.pptxqurter our high choomENGLISH6-Q4-W3.pptxqurter our high choom
ENGLISH6-Q4-W3.pptxqurter our high choom
 
Karra SKD Conference Presentation Revised.pptx
Karra SKD Conference Presentation Revised.pptxKarra SKD Conference Presentation Revised.pptx
Karra SKD Conference Presentation Revised.pptx
 
Incoming and Outgoing Shipments in 3 STEPS Using Odoo 17
Incoming and Outgoing Shipments in 3 STEPS Using Odoo 17Incoming and Outgoing Shipments in 3 STEPS Using Odoo 17
Incoming and Outgoing Shipments in 3 STEPS Using Odoo 17
 
Visit to a blind student's school🧑‍🦯🧑‍🦯(community medicine)
Visit to a blind student's school🧑‍🦯🧑‍🦯(community medicine)Visit to a blind student's school🧑‍🦯🧑‍🦯(community medicine)
Visit to a blind student's school🧑‍🦯🧑‍🦯(community medicine)
 
THEORIES OF ORGANIZATION-PUBLIC ADMINISTRATION
THEORIES OF ORGANIZATION-PUBLIC ADMINISTRATIONTHEORIES OF ORGANIZATION-PUBLIC ADMINISTRATION
THEORIES OF ORGANIZATION-PUBLIC ADMINISTRATION
 
AMERICAN LANGUAGE HUB_Level2_Student'sBook_Answerkey.pdf
AMERICAN LANGUAGE HUB_Level2_Student'sBook_Answerkey.pdfAMERICAN LANGUAGE HUB_Level2_Student'sBook_Answerkey.pdf
AMERICAN LANGUAGE HUB_Level2_Student'sBook_Answerkey.pdf
 
How to Add Barcode on PDF Report in Odoo 17
How to Add Barcode on PDF Report in Odoo 17How to Add Barcode on PDF Report in Odoo 17
How to Add Barcode on PDF Report in Odoo 17
 
Choosing the Right CBSE School A Comprehensive Guide for Parents
Choosing the Right CBSE School A Comprehensive Guide for ParentsChoosing the Right CBSE School A Comprehensive Guide for Parents
Choosing the Right CBSE School A Comprehensive Guide for Parents
 
FINALS_OF_LEFT_ON_C'N_EL_DORADO_2024.pptx
FINALS_OF_LEFT_ON_C'N_EL_DORADO_2024.pptxFINALS_OF_LEFT_ON_C'N_EL_DORADO_2024.pptx
FINALS_OF_LEFT_ON_C'N_EL_DORADO_2024.pptx
 
Like-prefer-love -hate+verb+ing & silent letters & citizenship text.pdf
Like-prefer-love -hate+verb+ing & silent letters & citizenship text.pdfLike-prefer-love -hate+verb+ing & silent letters & citizenship text.pdf
Like-prefer-love -hate+verb+ing & silent letters & citizenship text.pdf
 
YOUVE GOT EMAIL_FINALS_EL_DORADO_2024.pptx
YOUVE GOT EMAIL_FINALS_EL_DORADO_2024.pptxYOUVE GOT EMAIL_FINALS_EL_DORADO_2024.pptx
YOUVE GOT EMAIL_FINALS_EL_DORADO_2024.pptx
 
Grade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdf
Grade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdfGrade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdf
Grade 9 Quarter 4 Dll Grade 9 Quarter 4 DLL.pdf
 
Earth Day Presentation wow hello nice great
Earth Day Presentation wow hello nice greatEarth Day Presentation wow hello nice great
Earth Day Presentation wow hello nice great
 
What is Model Inheritance in Odoo 17 ERP
What is Model Inheritance in Odoo 17 ERPWhat is Model Inheritance in Odoo 17 ERP
What is Model Inheritance in Odoo 17 ERP
 
How to do quick user assign in kanban in Odoo 17 ERP
How to do quick user assign in kanban in Odoo 17 ERPHow to do quick user assign in kanban in Odoo 17 ERP
How to do quick user assign in kanban in Odoo 17 ERP
 
Barangay Council for the Protection of Children (BCPC) Orientation.pptx
Barangay Council for the Protection of Children (BCPC) Orientation.pptxBarangay Council for the Protection of Children (BCPC) Orientation.pptx
Barangay Council for the Protection of Children (BCPC) Orientation.pptx
 
USPS® Forced Meter Migration - How to Know if Your Postage Meter Will Soon be...
USPS® Forced Meter Migration - How to Know if Your Postage Meter Will Soon be...USPS® Forced Meter Migration - How to Know if Your Postage Meter Will Soon be...
USPS® Forced Meter Migration - How to Know if Your Postage Meter Will Soon be...
 

DNA Replication Lesson Activity

  • 1.
  • 2.
  • 4.
  • 5.
  • 6. You are given a piece of paper with a questions/phrases in it, and they need to find the students whose holding the other piece of paper with an answer on it.
  • 8. Each group will be given a puzzle that the students will need to arrange and hold it for the next activity.
  • 10. After you complete the puzzle flip it and you will see a jumbled letters, arrange it, paste the picture at the board and write the word below it.
  • 12. At the end of the lesson the students should be able to: • describe the building blocks of DNA, RNA and proteins; • differentiate the structural and functional characteristics of DNA and RNA; • characterized the different levels of protein structure and • apply and translate the given coding sequences.
  • 14. Pick a representative in each group. The representative will be given a description and he/she had to do is draw the description, and the rest of the group will guess the word.
  • 15. is a term used to describe the physical structure of DNA
  • 16. is the structure of the simplest type of RNA
  • 17. basic unit from which something is built up
  • 18. A functional group characterized by a phosphorus atom bonded to four oxygen atoms (three single bonds and one double bond).
  • 19. • Francis Harry Compton Crick OM FRS (8 June 1916 – 28 July 2004) was an English molecular biologist, biophysicist, and neuroscientist. • The fundamental theory of central dogma was developed by Francis Crick in 1958. DNA → RNA → protein
  • 20. • A nucleotide is the basic building block of nucleic acids (RNA and DNA). • A nucleotide consists of a sugar molecule (either ribose in RNA or deoxyribose in DNA) attached to a phosphate group
  • 21.
  • 22. • deoxyribonucleic acid • it contains the genetic information used in the development and functioning of all known living organisms. • mostly found in the nucleus. • double helix • Adenine, Thymine, Guanine, Cytosine
  • 23. • Ribonucleic acid • RNA helps in the synthesis of proteins in our body. • single-stranded • adenine, guanine, cytosine, and uracil
  • 24.
  • 25.
  • 26. • it provides the template for protein synthesis during translation. • it carries the genetic code from DNA during transcription, in the form of triplets of nucleotides called codons.
  • 27. • usually found in the ribosome. • rRNAs combine with proteins and enzymes in the cytoplasm to form ribosomes, which act as the site of protein synthesis.
  • 28. • transfer of amino acids during protein synthesis. • reads the genetic code during translation. • also act as adapters in the translation of the genetic sequence of mRNA into proteins. Thus, they are also called adapter molecules.
  • 29.
  • 30. • Proteins are among the most abundant organic molecules in living systems and are way more diverse in structure and function than other classes of macromolecules.
  • 31.
  • 32. • The simplest level of protein structure, primary structure, is simply the sequence of amino acids in a polypeptide chain.
  • 33. • Refers to local folded structures that form within a polypeptide due to interactions between atoms of the backbone.
  • 34. • Three dimensional folding pattern of a protein due to interactions between the R groups of the amino acids that make up the protein.
  • 35. • The quaternary structure of a protein is how its subunits are oriented and arranged with respect to one another.
  • 36.
  • 37.
  • 38. • Cells decode mRNAs by reading their nucleotides in groups of three, called codons. • used to translate a genetic code into a sequence of amino acids.
  • 39.
  • 40.
  • 41.
  • 43. 5' ATG CAT AGA TTA GGA TAT CCC AGA TAG 3' 5' UAC GUA UCU AAU CCU AUA GGG UCU AUC 3'
  • 45. 1) 5’ AAATCTATCGGGTCTATACCTTTAGGT 3’ 2) 5’ GTAGCATCATCGTCCCCTCTGCTAGAT 3’
  • 46. 5’ AAA TCT ATC GGG TCT ATA CCT TTA GGT 3’ 5’ UUU AGA UAG CCC AGA UAU GGA AAU CCA 3’ mRNA Proteins 5’ PHE ARG STOP PRO ARG TYR GLY ASN PRO 3’
  • 47. 5’ GTA GCA TCA TCG TCC CCT CTG CTA GAT 3’ 5’ UUU AGA UAG CCC AGA UAU GGA AAU CCA 3’ mRNA Proteins 5’ HIS ARG SER SER ARG GLY ASP ASP LEU 3’
  • 48. Directions: Using the template below. Draw the structure of the 4 structure of protein and write it's characteristic.
  • 49. Direction: Choose and write the letter of the correct answer.
  • 50. Direction: Choose and write the letter of the correct answer.