Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Hiltusten Geneettinen Sukututkimus

3,043 views

Published on

  • Be the first to comment

Hiltusten Geneettinen Sukututkimus

  1. 1. Hiltusten Geneettinen sukututkimus Uusimpia löydöksiä ja perusteita Käsittelen tässä dokumentissa tuoreimpia geneettisen sukututkimuksen löydöksiä yhdistettynä perinteiseen sukututkimukseen. Dokumentti sisältää myös ohjeet dna-tulosten tulkintaan. Dokumentin lopussa on pohdittu dna-testauksen tulevaisuutta ja miten sinun tekemäsi dna- tutkimus saattaa auttaa Hiltusten vaiheiden selvitystä. 2013 Jari Hiltunen Sukuseura Hiltunen r.y. 13.10.2013
  2. 2. Hiltusten geneettinen sukututkimus 1 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Sisällys DNA sukututkimuksessa............................................................................................................................................................................................... 2 Tuorein DNA-löytö.........................................................................................................................................................................................................3 Muita isälinjan löydöksiä opetusmielessä.............................................................................................................................................................. 5 Kauko Hiltunen ja Jari Hiltunen TIP-laskimessa............................................................................................................................................. 5 Mitä muuta Y-DNA voi kertoa?......................................................................................................................................................................... 7 Tapaus Hiltunen – Possakka.............................................................................................................................................................................10 Lähisukulaisuustesti (FamilyFinder)............................................................................................................................................................................11 Esimerkki lähisukulaisuustestillä löytyneestä osumasta ..................................................................................................................................... 13 Äitilinjatesti................................................................................................................................................................................................................... 15 Perusteet........................................................................................................................................................................................................................16 Yleistä.......................................................................................................................................................................................................................16 Deoksiribonukleiinihappo eli DNA.................................................................................................................................................................. 17 DNA:n koostumus .............................................................................................................................................................................................18 DNA:n kopioituminen.......................................................................................................................................................................................18 Geeni...................................................................................................................................................................................................................18 Alleelit.................................................................................................................................................................................................................19 Haploryhmä........................................................................................................................................................................................................19 SNP......................................................................................................................................................................................................................19 STR..................................................................................................................................................................................................................... 20 Senttimorganit (cM)......................................................................................................................................................................................... 20 Longest Block..................................................................................................................................................................................................... 21 IBD ...................................................................................................................................................................................................................... 21 IBS ....................................................................................................................................................................................................................... 21 Markkerit............................................................................................................................................................................................................ 21 CRS, Coding Region, HVR1, HVR2 ja HVS...................................................................................................................................................... 22 Mutaatiot............................................................................................................................................................................................................23 Sekvensointi ...................................................................................................................................................................................................... 24 Kromosomit ja autosomit................................................................................................................................................................................. 24 Ilmaisia työkaluja - Promethease......................................................................................................................................................................25 Johan Habermanin maantarkastusluettelo..................................................................................................................................................... 26 Isälinja - Y-kromosomi (Y-STR, patriarkaalinen sukututkimus)........................................................................................................................ 27 Äitilinja - Mitokondrio (mtDNA, matriarkaalinen sukututkimus).................................................................................................................... 28 Lähisukulaisuustesti – Autosomit (FamilyFinder) .............................................................................................................................................. 29 DNA-tutkimuksen tilaaminen.................................................................................................................................................................................... 30 Tilaaminen FamilyTreeDNA:lta............................................................................................................................................................................ 30 Tulosten analysointia FamilyTreeDNA:ssa ...........................................................................................................................................................32 Tilaaminen 23AndMe:ltä ........................................................................................................................................................................................35 23AndMe päänäytöt:..........................................................................................................................................................................................35 Tulevaisuuden toiveita ja tavoitteita..........................................................................................................................................................................40 Lisätietoutta .................................................................................................................................................................................................................40
  3. 3. Hiltusten geneettinen sukututkimus 2 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ DNA sukututkimuksessa Aloitin sukututkimuksen vuonna 2009 ensimmäisten harmaiden hiusten ilmestyessä ohimolleni. Ennen tuota hetkeä suku ei ollut minua erityisemmin kiinnostanut. Tuolloin en tiennyt edes isäni tai äitini syntymävuotta! Tuosta hetkestä ollaan eletty nyt noin neljä vuotta, johon mahtuu sekä useiden kuukausien hiljaiseloa että lähes ympäripyöreitä päiviä sukututkimuksen parissa. Tuntuu jotenkin oudolle muistella niitä aikoja, kun sukututkimustietokannassani (Legacy Family Tree) oli alle 100 nimeä! Nekin oli hankittu monen päivän istumisella mikrofilmikoneen takana, joko Mikkelin Arkistolaitoksella tai seurakunnissa. Minun oli pakko henkilökohtaisesti käydä arkistoissa, koska alle 100 vuotta vanhoja tietoja ei saa Internetin arkistoista. Vaikka polttoainetta Hanko – Mikkeli – Kuopio edestakaisissa matkoissa kului todella paljon, sain samalla tutustua sukuuni useilla vierailuilla. Valokuvilla ei oikeastaan ole mitään järkevää arvoa sen jälkeen kun valokuvista jotain tietävät ihmiset ovat kuolleet. Sukulaisvierailuiden aikana aloin tekemään sukuhistoriallista tietokantaa, eli skannaamaan suvun vanhimpien valokuvat tarinoineen tietokoneelle. Samalla videoin pieniä koosteita jokaisesta vanhemmasta ihmisestä, jolloin tulevaisuuden sukupolvet voivat nähdä ja kuulla miltä heidän esivanhempansa kuulostivat. Perustin suvulleni http://suku.hiltsu.fi nettisivuston, johon olen päivittänyt viimeisimmät videotervehdykset ja valokuvat tarinoineen. Saamistani valokuvista ja tarinoista olen tuottanut useita sukukalentereita, kuvakirjoja, DVD- videoita ja valokuvallisia sukupuita lähinnä joululahjoiksi (omalla kustannuksella, ilman voiton tavoittelua). Sukukalenteriin olen merkinnyt syntymäpäivät ja muut tärkeät juhlapäivät kuten avioliitot. Kalenteri on otettu hyvin vastaan ja on osaltaan yhdistänyt sukua ainakin siten, että olemme muistaneet sellaisenkin ihmisen syntymäpäivää, jolle normaalisti ei tulisi lähetettyä onnitteluita. Lähtötilanne vuonna 2009 oli siis se, että en tiennyt edes vanhempieni syntymävuotta enkä oikeastaan mitään heidän varhaisista ajoistaan. Tällä hetkellä tietokannassani on reilusti yli 3000 ihmisen tiedot (julkinen sukupuu osoitteessa http://suku.hiltsu.fi/media/julkinen/ ) ja useita hienoja tarinoita heidän vaiheistaan. Tämä on silti vain alkua sille projektille, jonka vuonna 2009 päätin aloittaa. Yksi tuolloin päättämistäni projektin osa-alueista oli dna-tutkimus, niin sukuhistoriallisessa mielessä kuin mahdollisten sairausriskien kartoittamismielessä. Tässä dokumentissa käsittelen DNA:n käyttämistä osana sukututkimusta, joka on tuonut todella paljon lisää tietoa perinteiseen sukututkimukseen. Suurin kiitos kuuluu Paavo Hiltuselle, Sukuseura Hiltunen r.y. perustajajäsenelle ja puheenjohtajalle, joka sai minut asiasta innostumaan. Sukututkimustani aloittaessani en tiennyt Paavon olevan minun pikkuserkku! Olimme molemmat hieman hämmentyneitä kun teetin DNA-testauksen ja havaitsimme omaavamme lähes täysin identtisen Y-kromosomin! Tämä auttoi minua todella paljon eteenpäin, koska Paavo ammattimaisena sukututkijana oli jo selvittänyt suuren osan esi-isiemme vaiheista. Olen yrittänyt saada tähän dokumenttiin sekä geneettisen sukututkimuksen perusteita että viimeaikaisimpia löydöksiä. Aiemmista sukukokouksista olen oppinut sen, että heti alkuun ei kannata selittää liian tarkasti perusteita, koska viimeistään viidentoista minuutin kuluttua ensimmäinen ihminen nukahtaa! Siksi aloitan tämän dokumentin uusimmilla dna-löydöksillä ja geneettisen sukututkimuksen perusteet löydät dokumentin lopusta.
  4. 4. Hiltusten geneettinen sukututkimus 3 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Tuorein DNA-löytö Kaikista tuorein isälinjan dna-löydös on Johan Filipsson Hiltusen ja minun (tätä kautta myös Paavon ja muiden saman Y-kromosomin omaavien) välinen dna-yhteys. Paavo Hiltunen on aiemmin 22.11.2008 jäsenkirjeessä kirjoittanut Johan Filipssonista seuraavaa (suomennos minun): ”Johan muutti v. 1678 Kuusamosta perheineen Ruotsin Lycseleen. Hänen patsaansa paljastettiin v. 1978. Hänellä on nyt siellä noin 50.000 jälkeläistä. (Ruotsissa)!” ”Vargträsk, Lycksele lappmark År 1761 slog sig den första nybyggaren ner i Vargträsk. Knappt hundra år tidigare 1678 koloniserades Örträsk och det var ättlingar till Johan Philipsson Hilduinen som nu sökte sig vidare längs vattendragen för att finna lämpliga boplatser.” ”Vuonna 1761 esiintyi ensimmäinen uudisasukas lähellä Vargträskiä. Lähes sata vuotta aiemmin, vuonna 1678, oli tämän uudisasukkaan isä, Johan Philipsson Hilduinen, etsinyt sopivaa asuinpaikkaa rantoja seuraamalla ja asettunut Örträskiin, Ruotsiin. “Johan Philipsson Hilduinen med hustru (fullständigt namn saknas) och familj startade nybygge 1678. Två år innan hade man huggit ett svedjeland och sått råg. Det gjordes direkt i askan. Åkrar och ängar kom till senare.” Johan Philipsson Hilduinen ja hänen vaimonsa (nimi ei tiedossa) perheineen olivat uudisrakentajia vuonna 1678. Kaksi vuotta aiemmin oli maat kaskettu ja maahan kylvetty ruista. Kaskettu maa oli tuhkaa, josta tuli myöhemmin peltoa ja niittyä. “Träskulpturen, gjord av Bengt Fransson, är en föreställning om hur denne livskraftige man kan ha sett ut. Han som kom att bli anfader till minst 50 000 nu levande svenskar, bl.a. denne Bengt Fransson, en av många som i nutid kunnat härleda sitt släktskap tillbaka till Johan Philipsson Hilduinen. Detta enligt Ossian Egerbladhs skildring från 1965.” Kuvassa oleva Bengt Franssonin tekemä puuveistos kuvaa miltä hän saattoi näyttää eläessään. Bengt on yksi Johan Philipsson Hiltusen nykypäivän noin 50 000 jälkeläisestä ruotsissa. Johan Philipsson Hilduinen syntyi Kuusamossa noin 1620 ja kuoli 1697 Örträskissä, Ruotsissa. Lapsia hänellä oli mm. Samuel Johansson, syntynyt 1645 Kuusamossa, ja kuollut 20.3.1725 Örträskissä, Johan Johansson, syntynyt 1658 Kuusamossa ja kuollut 1718 Örträskissä, Erik Johansson, syntynyt 1660 Kuusamossa, kuollut 1721 Örträskissä ja Margareta Johansdotter, syntynyt Örträskissä ja kuollut 1708 Örträskissä. Kuva 1 - Johan Philipsson veistos
  5. 5. Hiltusten geneettinen sukututkimus 4 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Miten sukulaisuus on vahvistettu dna-analyysillä? Sukulaisuus on vahvistettu Y-kromosomista, joka periytyy suoraviivaisesti isältä pojalle (katso alempana tarkemmin miten tämä tapahtuu). Minä olen vuonna 2009 teettänyt dna-testin, joka on tallennettuna FamilyTreeDNA:n tietokantaan. Tänä vuonna Ingemar Nyman, joka on Johan Philipson Hiltusen Ruotsissa asuva jälkeläinen, on teettänyt myös dna-testin ja tämän testin perusteella meillä molemmilla on sama esi-isä (Y-kromosomi)! Kuva 2 - Yhteisen esi-isän löytymiseen tähtäävän TIP-laskimen (laskimen tarkoitus alempana) tulos Kuva 3 - Y-STR 37 tuloksissa tulos näyttää tällaiselta Mitkä dna-alueet tarkalleen ottaen ovat erilaiset, eivät ole tässä yhteydessä olennaisia tietoja. Odotamme lisää testattuja ja toivomme saavamme tietoa siitä, kuka esi-isistämme muutti pohjoisen pakkoasuttamisen aikaan noille seuduin. Mitä ilmeisimmin joku esi-isistämme on heti Pitkän vihan (25 vuotisen sodan) jälkeen muuttanut pohjoiseen jonka jälkeläinen Johan on ollut. Tällä hetkellä tiedämme, että Hiltusia oli pohjoisessa Pohjan sodan aikaan (1655-1661) ja tätä ennen seuraavat Hiltuset ovat maksaneet veroja pohjoisessa seuraavasti: Paavo (Påhl) Hiltunen v. 1552-83 (v. 1571-83 Puolanka), Pekka (Pehr) Hiltunen v. 1577-85 Puolanka, Yrjö (Jöran) Hiltunen v. 1576-84 v. 1584 Ristijärvi, Hyrynsalmi, Tahvo (Staffan) Hiltunen v. 1558-85. v. 1585 Juarankajärvi ja Antti (Anders) Hiltunen v. 1573-78 Mieslahti. Toivottavasti saamme useampia dna-osumia varmistetuista Johan Philipsson Hiltusen jälkeläisistä. Voimme olla kuitenkin jo nyt iloisia siitä, että olemme saaneet yli 50 000 geneettistä serkkua länsinaapuristamme! Miten paljon heitä vielä löytyykään muista maista jää nähtäväksi.
  6. 6. Hiltusten geneettinen sukututkimus 5 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Muita isälinjan löydöksiä opetusmielessä FamilyTreeDNA:n tuloksissa isälinjan osumissa (Y-DNA) vasemmalla näkyy montako poikkeamaa (mutaatiota) tutkituissa dna-kohdissa on. Mikäli henkilö on teettänyt haploryhmän (heimoryhmän) testin, näkyy se kaukaisimman esi-isän oikealla puolella. Katso alempana kohdassa ”Perusteet” lisätietoja lyhenteiden merkityksistä. Kuva 4 - Y-DNA67 tuloksia Otetaan lähempään tarkasteluun listan ensimmäinen henkilö, Osmakiven arvoituksesta kirjoittanut Kauko Hiltunen. Kauko Hiltunen ja Jari Hiltunen TIP-laskimessa TIP laskin ottaa huomioon eri markkereiden mutatoitumisnopeudet ja pyrkii antamaan laskennallisen arvion ajankohdasta, jolloin yhteinen esi-isä on voinut elää. Kuva 5 - Kaukon ja Jarin TIP tulos Huomaa, että jokainen generaatio (sukupolvi) on n. 25 vuotta taaksepäin laskettuna, eli 4 generaatiota on n. 100 (1900 luku) vuotta, 8 generaatiota 200 vuotta (1800 luku), 12 generaatiota 300 vuotta (1700 luku), 16 generaatiota 400 vuotta (1600 luku), 20 generaatiota 500 vuotta (1500 luku) ja 25 generaatiota 600 vuotta (1400 luku). //Lauri Koskinen (SuomiDNA-projektin vetäjä): Isän ikä pojan syntymähetkellä vaikuttaa selkeästi mutaatioalttiuteen. On tärkeää ottaa vertailutietoihin mukaan tiedetyt isien yli 40-ja 50-vuotiuksien lukumäärät omassa sukupolviketjussa. Tästä syystä TIP-laskimen näyttämä voi poiketa merkittävästi mikäli isä on ollut lasta tehdessään yli 40-50 vuotias//
  7. 7. Hiltusten geneettinen sukututkimus 6 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Edellä on löydetty geneettinen osuma Jari Hiltusen ja Kauko Hiltusen välillä tutkimalla isälinjaa, eli Y-kromosomia. Sukulaisuus on voitu vahvistaa myös kirkonkirjoista perinteisin sukututkimusmenetelmin seuraavasti: Kuva 6 - Kaukon ja Jarin sukulaisuuslaskuri Yhteinen esi-isämme on Matti Pekanpoika Hiltunen, s. 1718 k. 18.2.1790. Huomaa, että pelkkä ”Steps”, eli mutaatiot, eivät välttämättä kerro suoraan milloin yhteinen esi-isä on elänyt! Tämä johtuu siitä, että dna-mutaatiot voivat ”korjaantua” myöhemmissä sukupolvissa, tai isän ollessa iäkäs, mutaatioita tapahtuukin nopeammin kuin keskimääräisesti tapahtuu. Esimerkin Kauko Hiltunen ”Steps” on -1 kuin minulle lähemmän sukulaisen Paavo Hiltusen ”Steps” on -2. Minun ja Paavon yhteinen esi-isä on Erkki Juhanpoika Hiltunen, s. 24.12.1842 k. 29.6.1920. Minun, Paavon ja Kaukon yhteisten esi-isän iässä on 124 vuoden ero, vaikka Paavon Y-kromosomissa onkin 2 mutaatiota Kaukon yhteen verrattuna.
  8. 8. Hiltusten geneettinen sukututkimus 7 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Mikäli yhteinen esi-isä on löydetty geenitestauksen lisäksi myös perinteisellä sukututkimustavalla, näkyy tämä sukunimiprojektissamme kohdassa ”Root father verified”: Kuva 7 - Otanta Hiltunen DNA Project-sivulta Tällä hetkellä ainoastaan ”Niilon” eli haploryhmän N1C1 tuloksissa on saatu vahvistuksia perinteisin menetelmin. Odotamme lisää tuloksia jotta voimme aloittaa mm. ”Iivarin”, eli I1-haploryhmän perinteistä vahvistusta. Tämä edellyttää myös sopivan sukututkijan löytymistä ”Iivari”-haplolle. Mitä muuta Y-DNA voi kertoa? Y-DNA tuloksista näkee myös isälinjan maantieteellisen/etnisen taustan (Ancestrar Origins) ja mihin kohtaa haplopuuta (eli heimopuu) sijoitut (tässä tapauksessa N1C1 : N-M178). Valitsemalla Haplogroup Migration Map näkee miten ihmiset ovat päätyneet Afrikan Ananaslaaksosta isälinjasi osoittamaan paikkaan. Kuva 8 - Esi-isämme muuttoreitti Jokaisesta haplotyypistä löytyy erikseen tarinat millaisia reittejä esi-isät ovat kulkeneet (katso alla kohdasta ”Lisätietoa” ). Tuloksia voi analysoida myös numerotasolla FamilyTreeDNA:ssa kohdasta Standard Y-STR Values.
  9. 9. Hiltusten geneettinen sukututkimus 8 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Kohdasta Standard Y-STR Values näet eri markkereiden saamat arvot (dna-toistot) ja myös tietoa eri markkereiden mutatoitumis-nopeuksista. Nämä tiedot ovat automaattisesti sijoitettu edellä käsiteltyyn TIP-laskimeen. Esimerkiksi niiden Hiltusten kohdalla, jotka kuuluvat N1C1 N-M178-heimoon (puhutaan ”Niilon” pojista, koska haploryhmä alkaa N:llä), voidaan päätellä seuraavaa: Noin 60 % miehistä kuuluu haploryhmään N (”Niilon poikia”). Tämän klaanin esi-isät ovat kulkeneet pitkän tien Suomeen. Lähi-idästä lähdettyään he koukkaisivat Kiinasta asti Siperian kautta Suomeen. On myös sellaisia näkemyksiä, että tämän mutaation kantajat eivät ole Kiinaan asti itään edenneet ja sieltä pohjoista reittiä Suomen suuntaan siirtyneet, vaan että haploryhmä on syntynyt lännempänä ja Suomeen kulkeutuneiden ryhmän edustajien reitti on ollut eteläisempi. Perushaploryhmä syntyi Siperiassa n. 10 000 vuotta sitten. ”Niilon poikia” voi hyvällä syyllä kutsua ”mammutinmetsästäjiksi”. Tarkemmin suomalaismiehet kuuluvat N-haploryhmästä mutaation kautta syntyneeseen alaryhmään ryhmään N1, sen sisällä valtaosa miehistä alaryhmään N1c1. N1c1 haploryhmän alkuperä on eteläisessä Siperiassa arviolta n. 9.000 vuotta sitten. Noin 8.000 vuotta sitten muutama N1c1-heimolainen päätti lähteä kohti Eurooppaa (N1c1 on edelleen dominoiva Jakuteissa, Chucheissa ja pienessä osaa Aasian kansoja). Ylitettyään Uralin, he asettuivat keski- Volgan tienoille (kutsutaan myös Povolzhe). Myöhemmin, yksi tai kaksi heimoa lähti pitkin Baltian rannikkoa ja asettuivat Liettuaan ja Latviaan. Kuulumme siis osaksi ”Laatokkalaisia” haplotyyppejä (joissain myös Southern-Finns). Näille haplotyypeille ominainen on erityisesti lokuksen 390 alleeli 24. Tämä alleeli on erityisen tyypillinen Laatokanalueella ja Itä-Suomessa. Haplotyypin muita tavallisia alleeleja ovat lokuksen 393 alleeli 14, lokuksen 385a alleeli 11, lokuksen 385b alleeli 13 ja lokuksen 392 alleeli 14. Yksinkertaistaen voi ajatella, että Laatokan alueella asui keskiajalla (ennen vuotta 1500 jKr.) väestö, joiden miehet olivat seitsemän eri esi-isän poikia (eli he edustivat seitsemää isälinjaa). Laatokan alueen ulkopuolella (esimerkiksi Länsi-Suomessa ja idempänä Itä-Euroopassa) asui kyllä saman haploryhmän N1c miehiä, mutta he olivat (kun asioita tarkastellaan lyhyemmällä aikavälillä) eri esi- isien poikia ja edustivat siis eri isälinjoja (”sukuja”) kuin laatokkalaiset; heidän kyseisen lokuksensa alleelit olivat toiset kuin mainitut 14-24-11-13-14. Hiltusten DYS 19 alleeli on muista Savolaisista poiketen 15, joka tarkoittaa tulosuuntaa Viron eteläpuolelta. Alleelia DYS 19 esiintyy Baltiassa ja Keski-Euroopassa. Tästä voidaan päätellä myös että N1C1-Hiltuset tulivat Suomeen Baltian suunnalta, Viron Etelä- puolelta. Latvia-Liettua- Puola suunnalta. Balttian haploryhmä N1c1 alkaa jaksolla 14 23 15. Ei ole kuitenkaan selvää, onko heidän esi-isänsä olleet 14 23 15 vai paremminkin 14 24 15. Eikä ole täysin selvää, onko N1c1 tullut Suomeen Latviasta (Viron kautta) vai Uralin ja Karjalan kautta.
  10. 10. Hiltusten geneettinen sukututkimus 9 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ ”Niilo-haplotyypin” Hiltusten geneettinen haplotyyppi on siis osittain Balttia ja osittain Suomalaista. Tyypilliset arvot ovat:  DYS 390 : 23 (Baltti), 24 (Suomi)  DYS 459 a ja b : 9 ja 9 (Baltti), 10 ja 10 (Suomi)  DYS 464 a ja b : 14 ja 14 (Baltti), 13 ja 13 (Suomi)  YCA IIb : 20 (Baltti), 18 (Suomi)  DYS 442 : 14 (Baltti), 12 tai 13 (Suomi)  CDYa ja b: ovat yleensä pienempiä kuin 37 ja 37 (Baltit) ja suurempia kuin 36 ja 36 (Suomi). ”Niilo-haplotyypin” Hiltusten esi-isä asui Suomessa jo ainakin 3.000 - 4.000 vuotta sitten. Meidän geeneillämme ei pitäisi olla mitään tekemistä Saksalaisten kanssa (tosin, joku meidän esi- isistämme n. 8-9 vuosisadan tienoilla on voinut osallistua Viikinkien retkiin länsi-eurooppalaisia vastaan). Pohjoisen Puolan Yatviagian heimolla oli haploryhmä N1c1. Oletetaan, että vanhat Preussilaiset ovat Suomalais-Ugrilaisten (N1c1) ja Goottien (R1b1) sekoitus höystettynä Normaaneilla (I1a). Yatviagianit ajettiin itä-Preussiin germaanisen (teutonisen) ritarikunnan ritarien toimesta. Eli itä- Preussista periytyvistä Saksalaisista löytyy haploa N1c1, mutta itse N1c1:llä ei ole mitään tekemistä Saksan kansakunnan kanssa. Hiltusten jakso 14 23 15 on nimenomaan "Baltti-jakso" (löytyy siis Liettuasta, Latviasta ja Puolan pohjois-osasta, eli Yatviagineista). Haplotyyppimme kuuluu ehdottomasti alkuperäiseen Suomalaiseen haaraan. Liettuan ja Latvian populaatio on arviolta tasan jakautunut N1c1 ja R1a1 haploihin. Yhden olettaman mukaan N1c1 olisi asettunut alueelle ensin ja myöhemmin indo-eurooppalainen R1a1 olisi vallannut osan. Tämä selittäisi ehkä indo-eurooppalaisen balttikielien (Latvian, Liettuan, Yatavian, Preussin ja Kuronian) esiintymisen alueilla. Puolalaiset eivät ymmärrä Liettualaisia, mutta Slaavilaiset sanat ovat yhdistyneet kieleen. Hiltusissa on myös paljon ”Iivarin” poikia, eli haploryhmää I1 ja muutamia ”Riston poikia”, eli haploryhmää R1. Noin 29 % suomalaismiehistä kuuluu haploryhmään I (”Iivarin poikia”). Poika, joka tämä mutaation sai, syntyi Balkanilla 25–30 000 vuotta sitten, kun mannerjäätikkö oli laajimmillaan. Sieltä haploryhmä levisi vuosituhansien kuluessa länteen ja sitten pohjoiseen, kun ilmasto lämpeni ja jään reuna pakeni. Suomalaiset kuuluvat haploryhmään I1, joka syntyi oletettavasti Pohjois-Ranskassa. 5000-6000 vuotta sitten haploryhmä oli Tanskan salmien luona ja siirtyi siitä Ruotsiin. Suomeen tätä germaanis-skandinaavista asutusta levisi useana aaltona, jo ennen viikinkiaikaa. Suomen yleisin I- alaryhmä on I1d3a, joka on ilmeisesti syntynyt jo Suomen kamaralla. Yksi geneettisen sukututkimuksen tavoitteista onkin löytää mikä on Hiltusten OIKEA haploryhmä! Onko ensimmäinen ”Hilduin” ollut N1C1- vai I1-heimolainen. Tuloksia näet DNA-projektimme sivuilta. Tällä hetkellä ainoastaan N1C1-ryhmässä on löydetty yhteisiä paperijälkiä.
  11. 11. Hiltusten geneettinen sukututkimus 10 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Tapaus Hiltunen – Possakka Joskus käy niin, että sukunimi ei noudata patriarkaalista isälinjaa. Tällaisia tapauksia ovat esimerkiksi naispuolisen aviottomat lapset sekä Pohjois-Suomen ja Länsi-Suomen vanha tapa määritellä sukunimi talon mukaan. Eräs jakautuminen Hiltusista muihin sukunimiin on tapahtunut 1600-luvun puolivälin tienoilla, jolloin jostain syystä Elin Påsa on ollut naimisissa esi-isämme Johannes Hiltusen (s. 1631 ja k. 4.6.1721) kanssa. Se miksi sukunimi Hiltunen ei ole seurannut isälinjaa on arvoitus. Noin vuoden 1626 Habermanin maakirjassa on maininta samaisesta v. 1631 syntyneestä Johan Hilduinista, jonka isä on Paavo (Påhl) Hiltunen. Påhl on ollut yksi mm. N1C1- Hiltunen sukuhaaran yleisimmistä nimistä. Hyvin suurella todennäköisyydellä yhteinen esi-isä löytyy n. 1400-luvun alusta. Yhden markkerin mutatoituminen kestää n. 200 sukupolvea, sukupolven ollessa laskennallisesti 25- vuotta. Possakan ja Hiltusen yhteinen esi-isä on myös geneettisesti vahvistettavissa oleva asia: Kuva 9 - Possakka - Hiltunen TIP laskimessa Mitä ilmeisimmin Possakka, siis geneettisesti tässä tapauksessa Hiltunen, liittyy Örträskin Johan Philipsson Hiltusen vaiheisiin pohjoista asuttaessa. Sukuseuran tiedostoissa on analysoituna muitakin löytöjä. Ne henkilöt, jotka ovat liittyneet Hiltunen DNA-projektiin saavat aina ajantasaisimmat tiedot uusista tuloksista.
  12. 12. Hiltusten geneettinen sukututkimus 11 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Lähisukulaisuustesti (FamilyFinder) Lähisukulaisuustestistä käytetään lyhennettä FF (FamilyFinder). Lähes kaikki testausyritykset käyttävät tähän samaa teknologiaa. Tarkemmat tiedot siitä miten lähisukulaisuustesti tehdään, löydät alempana kohdasta ”Perusteet”. Lähisukulaisuustestissä perinteisen sukututkimus tulee keskittää sekalinjaan. Käytännössä tämä tarkoittaa sitä, että sekä testattavan että kohdehenkilön (FF osuman) kohdalla kannattaa pyrkiä tuottamaan kuusi sukupolvea käsittävä sukukaavio. Esimerkiksi minä ja vaimoni olemme FamilyFinder-testin mukaan 3-4 serkkuja (joka mitä ilmeisimmin on hyvin ylioptimistinen arvio). Sukulaisuutta selventääkseni olen tehnyt vähintään kuusi sukupolvea käsittävän sukupuun omista vanhemmistani: sekä vaimoni vanhemmista:
  13. 13. Hiltusten geneettinen sukututkimus 12 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Yhdessä sukupiirakassa on 63 ihmistä, eli näissä yhteensä 252 ihmistä. Tällä tavoin voi päätellä sekä sukunimistä että paikkakunnista mitä kautta dna-yhteys (eli kromosomifraktiot) olisivat voineet tulla. Tämä vaihe on erittäin työlästä ja loppujen lopuksi kromosomifraktiot voivat tulla useampaa sukulinjaa pitkin, koska ennen ihmiset liikkuivat vähän ja usein avioiduttiin saman kylän ihmisten kanssa. Alla lähisukutesti lajiteltuna päivämääräjärjestykseen (ei sukulaisuussuhdejärjestykseen, joka on oletus): Kuva 10 - Family Finder näkymä Match Date tarkoittaa päivää jolloin osuma on tietokannasta löydetty, Relationship Range tarkoittaa laskennallista sukulaisuusuhdetta, Known Relationship on tunnettu sukulaisuus (perinteisin sukututkimusmentelmin löydetty), Chared cM ovat yhteiset Senttimorganit ja Ancestral Surnames ovat esivanhempien sukunimiä. Esimerkissä näkyy viidentenä ylhäällä lapsi, jolla testatun kanssa on yli 3000 kappaletta jaettuja senttimorganeita ja muut on arvioitu olevan 2-3 serkkuja alle 200 senttimorganilla. Mikäli testaa sekä lapsen että itsensä voi testin perusteella päätellä mitkä geenit (SNPt) ovat tulleet isältä ja mitkä äidiltä (kromosomiparien muodostuksessa toinen tulee isältä toinen äidiltä).
  14. 14. Hiltusten geneettinen sukututkimus 13 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Esimerkki lähisukulaisuustestillä löytyneestä osumasta Tässä tapauksessa FamilyFinder näytti henkilöille sukulaisuussuhteeksi 2-3 serkku. Tarkemmin tarkasteltuna tulos näytti seuraavalta: Nimi Shared cM Longest Block Malli Mallinen 164.30 15.34 Kromosomi Alku Loppu Centimorgan Osuvat SNPt 1 59380613 61882090 46813 800 1 160941664 162570029 41549 500 1 167284043 169006067 13881 500 1 185695696 189431595 12816 700 1 193232479 196022772 15707 500 2 11883265 20626094 28795 2484 2 29990034 31617062 15036 600 2 72074073 77509668 33725 1300 2 134556625 138242472 3.00 900 3 11537627 13011932 43497 600 3 102225259 107838105 20576 1200 5 154589273 157064519 30682 600 6 20312690 30367636 14093 5000 6 30524532 32519013 18264 3000 6 32707977 33292872 22282 1000 6 112750918 115139266 45658 500 6 126064295 130105402 30348 700 7 47762189 49713005 41396 500 8 63524869 65832026 31413 500 10 5814921 6996192 21245 600 10 16448878 18499288 12451 700 11 14181459 16194663 45689 500 11 70559577 74543755 41397 800 12 20668638 21525661 3.00 600 12 33401350 39538156 14642 800 12 85594351 94908476 43040 2200 12 118775846 123284511 41791 894 15 63740056 67617062 34790 979 17 47625736 51016835 45748 800 17 70358800 72470047 41338 576 18 63006929 64902105 35125 685 18 71860022 76116152 15.34 1459 19 19167147 34687643 18841 1400 19 43539271 47181356 46539 984 19 47604239 51489670 16224 1000 20 15519727 17317589 13971 792 20 46375897 48352524 28915 600 20 54467042 55639715 27820 500 Kuva 11 - Kromosomiselaimen näkymä Chromosome Browserilla voi tarkastella mitkä kromosomin pätkät ovat tulleet verrattavalta ihmiseltä. Kuvassa sininen on isältä tulleet kromosomit ja oranssilla on ”Malli Mallisen” kanssa yhteneväiset kromosomit.
  15. 15. Hiltusten geneettinen sukututkimus 14 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Pelkkien kromosomifraktioiden tutkiminen ei antanut tarvittavaa suuntaa sukututkimukselle, mutta sukunimilistan perusteella aloimme tutkimaan tarkemmin mistä kautta edellä mainitut kromosomifraktiot ovat tulleet ja saimme selville, että kohdehenkilöt ovat 7. serkkuja, eivät 2-3 serkkuja. Useammasta eri lähteestä on tullut ilmi se, että FamilyTreeDNA:n ja 23AndMe:n laskemat sukulaisuussuhteet ovat liian optimistisia. Edellä olleen esimerkin sukulaisuussuhde perinteisin sukututkimusmenetelmin näyttää seuraavalta: Kuva 12 - Sukulaisuussuhdelaskuri Yhteinen esi-isä, Joosef Abrahaminpoika Pajunen, on syntynyt 1721 ja kuollut 3.4.1793. Yhteinen esi- äiti, Maria Heikintytär Asikainen, syntynyt 1723 ja kuollut 14.10.1769. Tästä nähdään, että koska laskennallinen sukulaisuus perustuu IBD:hen (Identical By Descent), antaa se automaattisesti ylioptimistisen kuvan sukulaisuudesta. On myös sellaisia teorioita, että koska suomalaiset ovat ”sisäsiittoisia”, dna-fragmenttien paikkansapitävyys meidän osaltamme olisi vaikeammin määriteltävissä kuin niissä kansoissa, joissa geneettisiä esivanhempia on ollut enemmän. Tätä selittää ns. ”pullonkaulailmiö”. // Suomalaisasutuksen leviäminen Itä- ja Pohjois-Suomeen: asuttaminen alkoi todenteolla Kustaa Vaasan luvatessa kruunun maita idässä ja pohjoisessa kenelle tahansa joka ryhtyisi niitä asuttamaan. Tällöin lähti ns. vanhan asutuksen alueelta yksittäisiä perheitä tai muutamia perheitä samasta kylästä ja perusti uuden, alkuun vain muutaman talon kylän ”valtaamilleen” seuduille. Kylät kasvoivat ja muutaman perustajajäsenen geenit joutuivat satunnaisvaihtelun (engl. random drift) kohteiksi. //Wikipedia
  16. 16. Hiltusten geneettinen sukututkimus 15 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Äitilinjatesti Äitilinjaa testaavaa testiä kutsutaan nimillä mtDNA, FullSequence ja FGS. Katso alempana kohdasta ”Perusteet” millä tavoin äitilinjatesti tehdään. Mitokondriossa tapahtuu vähemmän mutaatioita kuin esimerkiksi autosomeissa tai Y- krommosomissa. Tästä syystä osumia voi olla esimerkiksi HVR1 ja HVR2 mukaan tuhansia, jolloin osumien sovittaminen sukututkimukseen on lähes mahdotonta. Kuva 13 - Äitilinjatestin tuloksia Minulla ei ole vielä yhtään varmistettua osumaa äitilinjatestin kautta. Tämä johtunee siitä, että matriarkaalista sukututkimusta (äitilinjaa) tehdään vähemmän kuin patriarkaalista sukututkimusta (isälinjaa). Tarkoitukseni on aloittaa Hiltunen DNA-projektin äitilinjatutkimus heti kuin se vain on mahdollista. Onnistuminen edellyttää, että dna-tutkituilla ovat hyvät taustatiedot omasta äitilinjastaan. FMS tarkoittaa koko mitokondrion käsittävää testiä (mtFullSequence), eli Full Mitochondrial Sequence, joka käsittää viimeiset 16 sukupolvea äitilinjassa. Mikäli olet teettänyt FMS:n, voit halutessasi antaa luvan siirtää tietosi Geenipankkiin (GeneBank) tieteellistä tutkimusta varten. Kannatta huomioida, että geenipankista tulosta voi katsoa kuka tahansa, mutta mistään ei voi päätellä henkilöä, johon näyte liittyy. Mikäli haluat, voit vertailla itse GenBank:ssa olevia näytteitä itseesi. Esimerkiksi jäämies Öz:stä on otettu koko mitokondrion käsittävä näyte, johon voit itseäsi verrata. Esimerkin H-haploryhmä on muodostunut läntisessä tai kaakkois-aasiassa noin 20-25 000 vuotta sitten. Joillakin testausyrityksillä, kuten 23AndMe, on tapana listata joitakin kuuluisuuksia, jotka ovat olleet samaa heimoa, tässä tapauksessa H-haploryhmään on liitetty Luke the Evangelist, Marie Antoinette, Napoleon Bonaparte, Prinssi Philip, Susan Sarandon. Kuva 14 - Esi-äidin muuttoreitit
  17. 17. Hiltusten geneettinen sukututkimus 16 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Perusteet Tässä osassa kirjoitan auki dna-tutkimuksen perusteita. Tekstiä on ymmärrettävyyden vuoksi yksinkertaistettu. Internetistä löydät tarkempaa tietoa. Katso kohta ”Lisätietoja”. Yleiskäsityksen saat katsomalla tämän videon (hakusana Youtubessa: Löydä esi-isäsi! Käytä dna-testausta!). Yleistä Geenisukututkimus eli geneettinen genealogia on sukututkimuksen tekemistä genetiikan menetelmin. Tiettyjä DNA-jaksoja vertailemalla voidaan arvioida yksilöiden sukulaisuussuhteita ja viimeisimmän yhteisen esivanhemman elinajankohtaa. Ihmisryhmien välisten geenivertailujen kautta voidaan selvittää kansojen välisiä sukulaisuussuhteita, alkuperää ja muuttoliikkeitä pitkien aikojen takaa. Autosomaalisen DNA:n tutkimisella voidaan yrittää määrittää yksilön etnistä taustaa. //Wikipedia DNA-testillä voidaan selvittää muun muassa:  kahden yksilön keskinäinen sukulaisuus  saman sukunimen kantajien keskinäinen sukulaisuus  yksilön isä- tai äitilinjan historia  yksilön biomaantieteellinen ja etninen tausta  kansojen muuttoliikkeet ja geneettinen historia Isälinjan (patriarkaalisessa) DNA-sukututkimuksessa tutkitaan (Y-kromosomia), äitilinjan (matriarkaalisessa) sukututkimuksessa tutkitaan äideiltä perittyä mitokondriota ja lähisukulaisia tutkitaan autosomeista. Mitä DNA voi kertoa minulle? Testattavan henkilön tuloksia verrataan tietokannassa oleviin muiden ihmisten teettämien dna-testien valmiisiin tuloksiin, jolloin sukulaisuus voidaan todentaa. Joillakin testaavilla yrityksillä testin lisänä tulee arvio etnisestä taustasta tai esimerkiksi minkä verran sinussa on Neaderntalin ihmistä. Mitä jos näytteeni ei vastaan ketään tietokannassa? Joskus sinun tulee olla kärsivällinen. Yhä useampi henkilö ymmärtää sukuhistoriallisen perimätiedon testauksen merkityksen ja ajan mittaan tietokanta kasvaa. FamilyTreeDNA-yritys on testannut satoja tuhansia ihmisiä. Pitääkö minun kaivaa esi-isäni ylös haudasta saadakseni hänen DNA:nsa? Ei pidä. Operaatio on kallis ja erittäin byrokraattinen sekä aiheuttaa kaikenlaisia sosiaalisia ongelmia. Koska Y-kromosomi jatkuu koko isälinjan lähes muuntumattomana, lähellä oleva tulos toisen miespuolisen henkilön kanssa johtaa yhteisen esi-isän löytämiseen. Sinulla tulee olla miespuolinen sukulainen samassa suvussa tehdäksesi testin.
  18. 18. Hiltusten geneettinen sukututkimus 17 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Minulla on esipolvitaulu (sukupuu), kuinka määrittelen yhteisen esi-isän? Mitä enemmän ihmiset testaavat ja saavat tuloksia sukunimiprojektissa, sitä enemmän tietoa on saatavilla. Mutaatiot pois lukien, esi-isiltä peritty allekirjoitus (haplotyyppi) alkaa olla paljastettu. Toivottavasti jollakin toisella projektissa on perinteinen paperiversio sukuhistoriasta auttamaan esipolvitaulusi ratkaisua. Mikä testi minun tulisi ottaa? Vastaus riippuu tavoitteistasi ja rahatilanteestasi. Jos tavoitteesi on löytää lähin sukuhistoriallinen yhteensopivuus, erityisesti tapauksessa esipolvitaulun perintölinjassa, aloita testillä jossa on eniten markkereita. Jos taloutesi ei kestä muutaman sadan euron testausta, valitse tällöin vähiten markkereita sisältävä testi ja tilaa lisäanalyysejä myöhemmin (analyysit tehdään aiemmista näytteistä, joita esim. FamilyTreeDNA säilyttää ilmaiseksi 25 vuotta ja voit hyödyntää niitä myöhemmin). Deoksiribonukleiinihappo eli DNA Deoksiribonukleiinihappo eli DNA on nukleiinihappo, joka sisältää kaikkien eliöiden solujen geneettisen materiaalin. Eliön lisääntyessä geneettinen materiaali kopioituu ja välittyy jälkeläisille. Jos yhden ihmisen solun DNA avattaisiin yhdeksi nauhaksi, tulisi pituudeksi noin kaksi metriä. Yhden ihmisen kaikkien solujen DNA yhteensä ylettyisi Maasta Kuuhun ja takaisin. DNA sitoo koko elävän luonnon yhteen. Ihmisen perimästä vain noin 1,5 % on proteiineja koodaavaa DNA:ta //Wikipedia Kuva 16 - perusparien muodostuminen Kuva 15 - DNA Heliksi
  19. 19. Hiltusten geneettinen sukututkimus 18 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ DNA:n koostumus DNA koostuu kahdesta makromolekyylistä, jotka ovat sitoutuneet toisiinsa typpiemäsosien välisin vetysidoksin. Nämä molekyylit koostuvat kolmenlaisista yksiköistä: 1. pentoosisokeri 1.1 deoksiriboosi 2. typpiemäkset 2.1 adeniini (A) 2.2 guaniini (G) 2.3 sytosiini (C) 2.4 tymiini (T) 3. fosforihappo Huomaa, että emäkset voivat yhdistyä ainoastaan joko T+A (TA) tai G+C (GC). DNA:n kopioituminen Solun jakautuessa myös sen DNA on kopioitava. Kopioitaessa DNA:n kaksoiskierre avautuu ja DNA:n molemmat säikeet täydennetään täydelliseksi kopioksi. DNA:n kopioituminen on semikonservatiivista, sillä syntyneiden uusien DNA-molekyylien toinen juoste on aina peräisin alkuperäisestä DNA-molekyylistä. Ihmisen yhden kromosomin DNA:ssa on keskimäärin 150 miljoonaa emäsparia, joita voidaan kopioida 50 emäsparia sekunnissa. Kokonaisuudessaan kopiointi kestää vain tunnin, kun se aloitetaan monesta kohdasta yhtäaikaisesti. Geeni Geeni eli perintötekijä on biologisen informaation yksikkö, joka on tallentunut DNA:n nukleiinihappoihin. Geeni voi esimerkiksi sisältää rakennusohjeet tietylle proteiinille. Näin geenien toiminta vaikuttaa perimmäisellä tavalla kaikkien eliöiden ulkoasuun ja ominaisuuksiin, joita myös ympäristötekijät muokkaavat. Ihmisen DNA on järjestynyt solun tumasta löytyviksi kromosomeiksi. Kuva 17 - DNA Helixi Kuva 18 - DNA:n kopioituminen
  20. 20. Hiltusten geneettinen sukututkimus 19 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Alleelit Alleelit ovat saman geenin vaihtoehtoisia muotoja, joilla on kromosomissa sama lokus eli paikka. Kuinka testaajat päätyvät numeroimaan alleelit ja miksi jotkut ovat matalia ja toiset korkeita? Markkerit numeroidaan löytäjänsä mukaan. Numeroarvo kertoo siitä miten useasti DNA-koodi toistaa itseään kyseisessä markkerissa. Esimerkiksi, jos toistuva koodi on CAT (Sytosiini, Adeniini, Tymiini) eli esimerkiksi CATCATCATCAT, silloin numeroarvo on 4. Toistuva koodi voi lisääntyä tai vähentyä sen mukaan miten mutaatio tekee koodista kopion (esim. CATCATCATCATCAT) tai poistaa kopion (CATCATCAT). Se, miksi joissakin markkereissa on vähemmän toistoa kuin toisissa, ei ole tätä nykyä tiedossa. Haploryhmä Haploryhmä on keskenään lähisukuisten DNA:n haplotyyppien joukko tai tietyn geenin tai genominosan kehityslinja tietyn lajin sisällä. Haploryhmien taajuudet usein vaihtelevat maantieteellisesti lajin esiintymisalueen eri osissa. Erityisesti ihmisillä eri mantereiden ja eri etnisten ryhmien haplotyyppikoostumus vaihtelee, ja tämä vaihtelu on syntynyt ihmisen levittäytyessä maapallolle alkukodistaan. Haplotyyppien esiintymisestä ja jakaumasta voidaan jäljittää yksilöiden etnistä alkuperää ja populaatioiden tai kansojen historiaa. Termi haplotyyppi ja haploryhmä voi periaatteessa viitata mihin tahansa DNA- tai kromosomialueeseen. Käytännössä haploryhmiä on ihmisellä tutkittu lähinnä mitokondrion DNA:sta ja Y-kromosomista, jotka molemmat periytyvät vain toiselta vanhemmalta jälkeläisille haploidina, niin ettei niissä tapahdu rekombinaatiota. Siksi niiden polveutumishistoria on varsin helppo määrittää. //Wikipedia Haploryhmä voidaan ajatella myös eräänlaisena ”heimona”. SNP Yhden nukleotidin polymorfismi, yhden emäksen monimuotoisuus, SNP eli snippi (engl. single nucleotide polymorphism, SNP) on populaatiossa esiintyvä pistemutaation aiheuttama ero DNA- ketjussa, geneettinen polymorfismi joka perustuu yksittäisen emäsparin vaihdokseen. // Wikipedia (Kuva David Hall). Kuva 19 - SNP DNA helixissä
  21. 21. Hiltusten geneettinen sukututkimus 20 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ STR Mikrosatelliitti eli SSR- tai STR-markkeri (simple sequence repeat, short tandem repeat) on DNA- alue (lokus), joka koostuu muutaman emäsparin aiheen toistoista. Tyypillinen dinukleotiditoistoista koostuva mikrosatelliitti on esimerkiksi CACACACACACACA eli (CA)7. Genomissa esiintyessään mikrosatelliittien pituus, so. toistojen lukumäärä, vaihtelee yksilöiden välillä ja niitä voidaan käyttää tehokkaina merkkiominaisuuksina populaatiogeneettisissä tutkimuksissa, rikostutkinnassa, isyystestauksessa ja geenikartoituksessa. Mikrosatelliittien runsaan vaihtelevuuden takia ne ovat erittäin tehokkaita yksilöiden erottelussa "geneettisinä sormenjälkinä" (genetic fingerprints): jo muutamalla merkkigeenillä voidaan luotettavasti tunnistaa yksilöitä ja varmistaa sukulaisuussuhteita. Mikrosatelliittimarkkerit jaotellaan toistojakson pituuden perusteella, mono- di- tri- ja tetranukleotidimarkkereihin, joissa toistojakson pituus on joko yksi, kaksi, kolme tai neljä emästä. Mikrosatelliittilokuksen eri alleelit puolestaan eroavat toisistaan perättäisten toistojaksojen kappalemäärän perusteella //Wikipedia. Kuva Foter, free license. Senttimorganit (cM) Senttimorgani (Centimorgans) on yksikkö, jolla mitataan geneettistä yhteyttä. Se määritellään kromosomien positioiden etäisyytenä (kutsutan myös loci tai markkeri). Yksi senttimorgani on 1/100 Morgania. 1 cM vastaa karkeasti ottaen 1 miljoonaa emäsparia DNA:ta ja yhden prosentin rekombinaatiofraktiota. Rekombinaatiofraktion ja karttaetäisyyden tarkka suhde määritellään karttafunktioiden avulla. Senttimorganeita käytetään erityisesti autosomitesteissä, joilla etsitään lähisukulaisuutta vertailemalla kaikista 46 kromosomista otettuja SNP:tä. Esimerkki kromosomien periytyvyydestä (kuva dnainheritance.com): Kuva 21 - Ihmisen 23 kromosomia ja periytymimalli Kuva 20 - STR:t ja Geenit
  22. 22. Hiltusten geneettinen sukututkimus 21 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Longest Block Pisin yhteinen DNA-segmentti, joka ilmaistaan Senttimorganeina. IBD IBD tulee sanoista Identical By Descent (laskevasti identtiset). Tämä tarkoittaa sitä, että DNA- osumat tuleva esivanhemmalta. IBD voi viitata yhteen mutaatioon tai DNA-segmenttiin. Mikäli mutaatio tai DNA-segmentti on sama useammalla ihmisellä, tulee se yhteiseltä esivanhemmalta. FamilyFinderin sukulaisuussuhteen ennuste vaatii minimimäärän yhteneväisiä tuloksia määrittämään segmentin olevan IBD. Tästä syystä lähisukulaisuusarviot voivat olla liian optimistisia. IBS IBS tulee sanoista Identical By State (identtiset olomuodot), tarkoittaen sitä, että DNA on yhteneväinen yhteensattuman vuoksi, ei sukulaisuuden vuoksi. Markkerit Markkeri on joko geeni tai dna-sekvenssi (jakso) tietyssä kromosomin positiossa, jolla voidaan eritellä henkilöt tai esimerkiksi eliölajit. Markkeri voidaan esittää muutoksena (esimerkiksi mutaation seurauksena). Geneettinen markkeri voi olla lyhyt dna-sekvenssi, kuten SNP tai pitkä dna-sekvenssi, kuten mikrosateliitti eli SSR. Lähettämäsi sylkinäytteen sisältämistä epiteelisoluista eristetään genominen DNA ja osia siitä sekvensoidaan PCR-menetelmää hyväksikäyttämällä (polymeraasientsyymin kopiomenetelmä). Genomista etsitään tunnettuja typpiemästen (A,T,G,C) toistojaksoja: esimerkiksi markkeri ”GATA H4” on [TAGA]nATGGATAGATTA [GATG]p AA [TAGA]q jossa voi esimerkiksi olla toistuvaa koodia ”GAGACCTAAGCAGAGATGTTGGTTTTC” 13 kertaa. Tässä tapauksessa markkeri GATA H4 saisi arvon 13. Mikä merkitystä on geneettisesti hitaasti siirtyvien ja nopeasti siirtyvien markkereiden välillä? Erot hitaasti ja nopeasti siirtyvien markkereiden välillä tarkoittaa sitä miten usein mutaatio tapahtuu. Koska nopeasti siirtyvät markkerit ovat todennäköisimpiä mutaatioille, voimme odottaa mutaation tapahtuneen lähiaikoina. Hitaasti siirtyvät markkerit mutatoituvat epätodennäköisimmin, eli jos markkeri mutatoituu, näkyy tulokset useamman sukupolven välillä. Toki mikä tahansa mutaatio voi tapahtua milloin tahansa, mutta todennäköisyys on hitaasti siirtyvillä markkereilla pienempi. Jos henkilön A ja B välillä on mutaatio nopeasti siirtyvissä markkereissa ja henkiöiden C ja D välillä mutaatio on hitaasti siirtyvissä markkereissa, tuolloin meidän ennusteemme siitä milloin yhteinen esi-isä on elänyt on nuorin A:lle ja B:lle kuin C:lle ja D:lle. Olen lukenut että isän ja pojan markkerit voivat poiketa 12-markkerin testissä. Onko tämä jokin tietty markkeri? Mutaatiot voivat tapahtua satunnaisesti ja missä tahansa markkerissa, tosin jotkin markkerit mutatoituvat todennäköisemmin kuin toiset (hitaat vs. nopeat). Tuloksissa ne markkerit, jotka on määritetty nopeasti mutatoituvaksi, on merkitty punaisella. Normaalisti mutaatio tapahtuu laskennallisesti kerran kahdessasadassa sukupolvessa. Nopeat mutaatiot tapahtuvat n. kerran sadassa sukupolvessa.
  23. 23. Hiltusten geneettinen sukututkimus 22 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ CRS, Coding Region, HVR1, HVR2 ja HVS CRS tarkoittaa vuonna 1981 tehtyä Cambride Reference Seqeuceneä, eli referenssinäytettä, johon muita verrataan. Poikkeamat ilmoitetaan tähän näytteeseen verrattuna. rCRS tarkoittaa uudempaa vuonna 1999 julkaistua CRS versiota. Koko mtDNA genomi löytyy Geenipankista nimellä NC_012920.1 tai tästä linkistä http://www.ncbi.nlm.nih.gov/nuccore/NC_012920 Monilla eri työkaluilla voi verrata omaa mitokondriota CRS:ää. Se ei kuitenkaan ole kovin mielekästä, koska pelkkien dna-sekvenssien näkeminen ei kerro mitä tehtävää geeni esimerkiksi tekee, kuten alla olevasta esimerkistä näkee: Mol tarkoittaa molekyyliä, J01415.2 on vanha CRS-referenssinäyte. Alignment: Local DNA homologies. Parameters: Both strands. Method: FastScan - Max Score Mol 1 J01415.2 (1 to 16569) Mol 2 Jari Hiltunen mtDNA (1 to 16571) Number of sequences to align: 2 Settings: Similarity significance value cutoff: >= 60% Homology Block: Percent Matches 99 Score 16539 Length 16569 Mol 1 1 to 16569, Mol 2 1 to 16571 J01415.2 1 gatcacaggtctatcaccctattaaccactcacgggagctctccatgcatttggtatttt Jari Hiltunen mt 1 gatcacaggtctatcaccctattaaccactcacgggagctctccatgcatttggtatttt J01415.2 61 cgtctggggggtatgcacgcgatagcattgcgagacgctggagccggagcaccctatgtc Jari Hiltunen mt 61 cgtctggggggtatgcacgcgatagcattgcgagacgctggagccggagcaccctatgtc J01415.2 121 gcagtatctgtctttgattcctgcctcatcctattatttatcgcacctacgttcaatatt Jari Hiltunen mt 121 gcagtatctgtctttgattcctgcctcatcctattatttatcgcacctacgttcaatatt J01415.2 181 acaggcgaacatacttactaaagtgtgttaattaattaatgcttgtaggacataataata Jari Hiltunen mt 181 acaggcgaacatacttactaaagtgtgttaattaattaatgcttgtaggacataataata J01415.2 241 acaattgaatgtctgcacagccactttccacacagacatcataacaaaaaatttccacca Jari Hiltunen mt 241 acaattgaatgtctgcacagccgctttccacacagacatcataacaaaaaatttccacca J01415.2 301 aa-ccccccct-cccccgcttctggccacagcacttaaacacatctctgccaaaccccaa Jari Hiltunen mt 301 aacccccccctccccccgcttctggccacagcacttaaacacatctctgccaaaccccaa J01415.2 359 aaacaaagaaccctaacaccagcctaaccagatttcaaattttatcttttggcggtatgc Jari Hiltunen mt 361 aaacaaagaaccctaacaccagcctaaccagatttcaaattttatcttttggcggtatgc Mitokondriossa on kaksi aluetta, kontrollialue ja koodaava alue. Kontrollialuetta kutsutaan HVR:ksi, eli Hypervariable (Control) Region. Hypervariable tarkoittaa nopeasti muuttuvaa. Kontrollialue jaetaan yleensä kahdeksi eri alueeksi, HVR-1 ja HVR-2. HVR1 alkaa kohdasta 16001 loppuen 16569. HVR2 alkaa 00001 päättyen 00574. Nämä alueet eivät sisällä mitään muuta tietoa kuin sukulinjaan liittyvää tietoa, joiden perusteella määritellään haploryhmä, eli heimo. HVR1 ja HVR2 yhdessä muodostavat HVS:n eli Hyper Variable Segmentin. Koodaava alue, eli Coding Region (CR) on alue, joka sisältää mitokondriossa olevia geenejä. Koska se sisältää geenejä, sen oletetaan olevan hitaammin mutatoituva kuin kuin kontrollialue. Koodaavaa aluetta käytetään haploryhmien muodostukseen. Koodaava alue alkaa kohdasta 00575 loppuen 16000.
  24. 24. Hiltusten geneettinen sukututkimus 23 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Mutaatiot Mutaatio on muutos organismin geneettisen materiaalin DNA:n (nukleotidi)järjestyksessä. DNA-vaurioita syntyy jatkuvasti, tuhansia päivässä, mutta koska solun DNA-korjausmekanismit ovat varsin tehokkaat, vain murto-osa muutoksista jää pysyviksi. Mutaatioita pidetään evoluution eteenpäin vievänä voimana, jossa luonnonvalinta poistaa vähemmän suotuisat (tai vahingolliset) mutaatiot geneettisestä varastosta, kun taas suotuisammat (tai hyödylliset) kumuloituvat. Onko tiettyjen markkereiden mutatoitumisella jotain merkitystä? Toiset markkerit ovat todennäköisempiä mutaatioille kuin toiset ja se mikä markkeri mutatoituu voi vaikuttaa laskelmiin siitä kuinka lähisukulaisia testattavat yksilöt ovat. Yleisesti ottaen mutaatio tapahtuu kerran kahdessasadassa (200) sukupolvessa laskennallisen sukupolven ollessa 25-vuotta. Kuinka monta virhettä voidaan olettaa olevan veljesten välillä ja ensimmäisten serkkujen välillä isälinjassa? 12 markkerissa? 37 markkerissa? Voit olettaa veljesten ja ensimmäisten serkkujen välillä olevan täysin samat 37 markkeria, mutta on mahdollista että mutaatio on tapahtunut juuri kyseisessä sukupolvessa jolloin pieniä eroja voi löytyä Kuinka DNA-laboratorio voi kertoa missä markkeri 391 alkaa näytteessä jotta he voivat laskea toistuvuuden ja mihin markkeri loppuu? Onko olemassa jokin osoitin joka kertoo että markkeri on DYS391 eikä joku muu? Jokainen markkeri sijaitsee tietyssä kohtaa Y-DNA:ta. Kun markkeri on löydetty ja työstetty, tutkija toimittaa myös indikaattorin joka pystyy paikallistamaan markkerin alun. Laborantti voi tällöin laskea koodin toistumisen alusta lähtien. Kuva 22 - Mutaation syntyminen
  25. 25. Hiltusten geneettinen sukututkimus 24 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Sekvensointi Sekvensointi on menetelmä nukleiinihapon nukleotidijärjestyksen ja mahdollisesti edelleen polypeptidin aminohappojärjestyksen selvittämiseksi. Nukeotidisekvenssejä vertaamalla voidaan myös arvioida geenien evolutiivista sukulaisuutta, tunnistaa sekvensoitu DNA-jakso tai verrata eri yksilöiden tai organismien genomien ominaisuuksia. Tuloksena sekvensoinnista saadaan tulosliuska, josta nähdään muun muassa koneen laskema emäsjärjestys sekä nukleotidien antamat fluoresenssipiikit. Sininen väri on C (Sytosiini), vihreä A (Adeiini), keltainen G (Guaniini) ja punainen T (Tymiini). Kuva 23 - Sekvensointitulos Kromosomit ja autosomit Ihmisen somaattisissa soluissa kromosomeja on yhteensä 46. Toinen vastinkromosomeista on aina peritty äidiltä ja toinen isältä. Sukusoluissa on aina haploidinen kromosomisto , joka ihmisellä on 23. Ihmisellä kromosomit 1–22 ovat autosomeja, eli niillä ei ole vaikutusta sukupuolen määräytymiseen. Sukupuolen määräävät X- ja Y-sukupuolikromosomit. Naisen sukupuolikromosomipari on XX ja miehen XY. X-kromosomia ei voi hyödyntää sukututkimuksessa Y-kromosomin tapaan, koska sen periytyminen ei ole suoraviivaista. X-kromosomia hyödynnetään muutamien X-kromosomissa olevien perinnöllisten tautien seurannassa. Y-kromosomitutkimus voidaan suorittaa vain miehiltä, mitokondrio- ja autosomitutkimus sekä miehiltä että naisilta. Onko mahdollista määrittää minkä X-kromosomin sain isältäni? Ei ilman suurta määrää lisäinformaatiota. Kun DNA:si on analysoitu, saat kaksi tulosta (alleelit) jokaisesta markkerista, mutta on mahdotonta kertoa mikä alleeli tuli isältäsi. Jos voit analysoida isäsi DNA:n, saat vastauksen välittömästi. Jos et voi analysoida isäsi DNA:ta, mutta sinulla on paljon siskoja, voit mahdollisesti päätellä mikä alleeli tuli isältäsi. Kaikilla siskoillasi tulee olla sama alleeli isältäsi, mutta äitisi voi siirtää yhden hänen kahdesta alleelistaan, eli tuloksena on satunnainen efekti: voit saada tai olla saamatta vastaavuutta siskoihisi äitilinjan kautta.
  26. 26. Hiltusten geneettinen sukututkimus 25 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Ilmaisia työkaluja - Promethease Mikäli sinua kiinnostaa tarkastella millaisia sairausriskejä, lääkeherkkyyksiä tai periytyviä sairauksia sinulla saattaa olla, ilman 23AndMe-tilausta, voit teettää FamilyTreeDNA:lla FamilyFinder-testin ja ladata tulokset tiedostoksi omalle tietokoneellesi. Lataus tapahtuu kohdasta FamilyFinder – Download Raw Data. Kuva 24 - Raakadatan latausnappula Tiedosto siirretään omalta koneelta www.snpedia.com kautta löytyvään ilmaiseen sovellukseen tai vaihtoehtoisesti voidaan käyttää nopeampaa www-sovellusta, joka maksaa 5 dollaria per raportti osoitteessa https://promethease.com/ondemand ja täältä valitaan Upload from your computer. Saat vastauksena raporttitiedoston, jossa on sekä graafinen käyttöliittymä että tekstipohjainen. Kuva 25 - Promethease raportti Raportista voi porautua syvemmälle tietoihin ja perusteisiin, miten mikäkin riski on laskettu. Joitakin eroavaisuuksia 23AndMe-tuloksiin on olemassa enkä ole tähän hetkeen pystynyt selvittämään mistä erot voisivat johtua (molemmat referoivat samoja tutkimuksia). Tarkastelemalla useampaa suvun jäsenen testitulosta voi päätellä millaiset sairaudet tai ominaisuudet periytyvät.
  27. 27. Hiltusten geneettinen sukututkimus 26 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Lisää ilmaisia työkaluja löytyy mm. Geenipankista, esimerkiksi GEO2R tai BLAST. Mikäli olet teettänyt äitilinjasta mtFullDNA (FGS) testin, voit ladata ns. FASTA-tiedoston ja siirtää sen esimerkiksi BLAST-tykaluun ja analysoida, millaisia proteiineja mitokondriossasi olevat geenit koodaavat. Lisäksi mitokondriosta voidaan eri työkaluilla analysoida tiedettyjä ilmiöitä. Tässä näet esimerkiksi erään ihmisen mitokondrion sekvenssin. Suvun historian tarkastelu antaa hyvin osviittaa siihen, millaisia tautiperimiä suvussasi saattaa olla. Vaikka dna-tutkimus paljastaisi riskin johonkin sairauteen, sairauden aktivoituminen voi edellyttää sellaisia elintapoja, jotka edesauttavat sairauden kehitystä (epigenetiikka huomioiden). Esimeriksi dna-testi voi osoittaa riskin sairastua Alzaimeriin suureksi, mutta mikäli suvussa ei ole ollut Alzaimeria, kannattaa tällöin paneutua siihen miten esivanhemmat ovat eläneet, mitä he ovat syöneet ja millainen elämäntyyli heillä on ollut (ruoka ja psykosomaattiset lähtökohdat). Vaikka DNA koodaakin RNA:ta, joka koodaa aminohappoja jotka taasen muodostavat proteiineja, dna sinänsä on vain geenin ilmentymä. Se, miten geenit aktivoituvat tai sammuvat tai jopa liikkuvat, käy ilmi mm. seuraavista kahdesta Robert Sapolskyn luennosta: molekyyligenetiikka 1 ja molekyyligenetiikka 2. Johan Habermanin maantarkastusluettelo Usein vanhimmissa dokumenteissa viitataan Habermanin tarkastusluetteloon. Suunnilleen vuonna 1626 vouti Johan Henrichson Haberman ryhtyi laatimaan ajantasaista laitosta Savon maantarkastusluettelosta. Pohja-aineistona hänellä oli käytössään 1560-luvun alussa laadittu maantarkastusluettelo, joka on myöhemmin hävinnyt. Käsikirjoitus on säilynyt vain Pien-Savon kihlakunnasta eli Savon linnaläänin pohjois- ja itäsyrjältä. Samanlaisen luettelon Haberman on nähtävästi laatinut Suur-Savostakin (Mikkelin seudulta), mutta se on hävinnyt. Pien-Savon luettelosta on kadoksissa sivuja Säämingin ja Rantasalmen hallintopitäjän osalta. Johan Habermanin maantarkastusluettelossa paikannustietoina on käytetty kylännimiä, mikä on hyvin poikkeuksellista. Samaten erikoista on se, että kaskista on mainittu tuotto (= viljasadon määrä) sekä paikan puusto ja kasken kiertoaika. Niityistä on mainittu korjattava heinämäärä. Nämä uudenlaiset merkinnät osoittavat, että Haberman on kerännyt maantarkastusluetteloon uutta aineistoa. Habermanin maakirjan alue käsittää Tavinsalmen, Iisalmen, Rantasalmen ja Säämingin hallintopitäjät (kahdessa viimeksi mainitussa on aukkoja). Erityisen arvokkaita ovat Pohjois-Savoa koskevat merkinnät, sillä alue on asutettu juuri vähän ennen maantarkastusluettelon laatimista 1500- luvun lopulla. Verkkojulkaisu löytyy osoitteesta http://scripta.kotus.fi/www/verkkojulkaisut/julk2/
  28. 28. Hiltusten geneettinen sukututkimus 27 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Isälinja - Y-kromosomi (Y-STR, patriarkaalinen sukututkimus) Y-kromosomi siirtyy isältä pojalle lähes muuttumattomana. Y-kromosomi ei siirry koskaan tytölle. Y-STR-markkereissa tapahtuvia mutaatioita tapahtuu satunnaisesti, keskimäärin kerran kahdessasadassa sukupolvessa, sukupolven ollessa n. 25 vuotta. ”DNA-Aatami” on syntynyt n. 200 000 vuotta sitten Afrikan ananaslaaksossa, josta lähtien voimme tarkastella heimojemme kulkureittejä maapallolla. Ensimmäiset 12-markkeria ovat lähinnä ”varhaisten sukujuurien” merkkejä, joka voi tuottaa positiivisen tuloksen useiden sukunimien välillä. Tällaiset löydökset yleensä kertovat siitä että esivanhempasi ovat periytyneet yhteisestä kantaisästä ennen sukunimien käyttöönottoa. Suosittelemme isälinjassa vähintään 67-markkerin testiä. Miksi on niin tärkeää testata vähintään kolme ihmistä kullakin linjalla? Tämä siksi että voimme muodostaa esi-isiltä perityn haplotyypin ja voimme pois sulkea isälinjaan liittymättömät tapahtumat (NPE). Tämä on erityisen tärkeää esimerkiksi silloin kun testaajat vaativat tietää periytyvätkö he kuuluisasta henkilöstä. Mitä tulisi tehdä sen jälkeen kun minut on testattu … miten voin käyttää tietoa hyväkseni paikallistaakseni paperilla olevia sukutietoja? Mitä muita testejä voidaan tehdä asian helpottamiseksi? Pitääkö minun testata toinen sukuhaara … miten se auttaa? Jos sinulla ei ole tulosta joka osoittaa sukulaisuutta, tuolloin sinun tulee odottaa uusia tuloksia. Jos sinulla on tulos, ota yhteys kyseiseen henkilöön jolla voi mahdollisesti olla paremmat paperilla olevat tiedot sukuhistoriasta. Testaa useilla markkereilla parantaaksesi testituloksen vastaavuutta. Toisen sukuhaaran testaaminen voi olla hyödyllistä mutaatioiden löytämiseksi. Kuva 28 - Isälinjan periytyminen Kuva 27 - X ja Y kromosomi mikroskoopissa Kuva 26 - Isän antama Y kromosomi
  29. 29. Hiltusten geneettinen sukututkimus 28 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Mitä tarkoittaa jos saan tulokseksi esimerkiksi "Genetic distance -2"? Arvo tarkoittaa sitä, että joko yksi DYS-arvo poikkeaa vertailtavasti kahdella (eli toistoja kaksi vähemmän) tai sitä että kaksi eri DYS-arvo poikkeaa yhdellä. Näet ajantasaiset tiedot sukunimiprojektimme sivuilta . Isäni Y-DNA haploryhmä on R1b. Hänen tyttärenään, tarkoittaako tämä sitä että minunkin haploryhmä on R1b? Ei. Koska olet nainen, isäsi ei antanut sinulle hänen Y-kromosomiansa (muutoin olisi mies, koska ”Y” tarkoittaa miespuolista). Isäsi ei myöskään antanut hänen mtDNA:sa sinulle koska saat mtDNA:si äidiltäsi. Miesten ja naisten haploryhmät poikkeavat toisistaan. Mitä tarkoittaa ”+” tai ”-” merkinnän P40 jälkeen? Esimerkkinä olen nähnyt P40- ja P40+ merkintöjä. Merkintä ”+” tarkoitta sitä että testituloksesi on positiivinen kyseiselle SNP (Single Nucleotide Polymorphism) mutaatiolle ja ”-” tarkoittaa sitä että tulos on negatiivinen kyseiselle markkerille. P40 on markkerin nimi. Tarkoittaako P40- sitä ettei P40 markkeria löytynyt ollenkaan vai tarkoittaako se sitä että P40 esiintyi mutta siinä ei ollut kaavan/kuvion toistoja? Markkeri P40 on yksittäinen nukleotidi Y-kromosomissa joka esiintyy kahdessa tilassa … alkuperäinen tila (esimerkiksi C) ja mutatoitunut tila (esimerkiksi T). Sillä ei ole kooditoistoa. Se on yksittäinen nukleotidinen monimuotoisuus, eli SNP (lausutaan ”snip”). Jos testattu mies osoittautuu positiiviseksi alkuperäiselle C-arvolle SNP:ssä, hän on tuolloin P40-. Jos hänellä on mutatoitunut arvo T SNP:ssä, hän on tuolloin P40+. Äitilinja - Mitokondrio (mtDNA, matriarkaalinen sukututkimus) Mitokondrio on soluelin, jossa solun soluhengitys tapahtuu. Mitokondrion DNA on ihmisellä 16 569 emäksen mittainen rengasmainen DNA-molekyyli. Lapsi saa hedelmöityksessä mitokondrion vain äidiltä. Mitokondrioiden määrä solussa vaihtelee solun energiatarpeesta riippuen. Runsaasti energiaa kuluttavissa soluissa, kuten lihaksissa, mitokondrioita on runsaasti. Mitokondriossa on omaa DNA:ta (mtDNA). Mitokondriot periytyvät aina äidiltä, ja niitä voidaankin käyttää apuna yksilöntunnistuksessa. Punasoluissa ei ole mitokondrioita. //Wikipedia Äitilinjan kantaäitinä pidetään noin 200 000 vuotta sitten Afrikassa elänyttä naista, jota kutsutaan ”Mitokondrio-Eevaksi”. Kuva 29 - yksi kahdesta mitokondriosta
  30. 30. Hiltusten geneettinen sukututkimus 29 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Liittyen mtDNA-testini tuloksiin, sain tuolokseeni mutaation CRS16519C? Olenko oikeassa olettaessani että T numeron edessä on CRS (Cambridge Reference Sequence) näyte? Kyllä, CRS käyttää T:tä tällä kohtaa. Mutaatio 16519 on todella yleinen muutamissa haploryhmissä, eli se on ”hotspot” – kohta joka on mutatoitunut itsenäisesti muutamia kertoja. Tätä kutsutaan rinnakkaiseksi mutaatioksi. Ovatko CRS-jakson numerot 10,343 ja 12,564 vanhempia kuin markkeri numerolla 16,999? Ei, ne eivät ole vanhempia eikä nuorempia. Numerot viittaavaat mtDNA:n jaksoon, eli toisin sanoen, numerot kertovat tarkasti missä mtDNA:n nukleotidissä mutaatio sijaitsee. mtDNA sisältää 16,569 paria (tai nukleotidiä, tai yksinkertaisemmin DNA- koodimerkkiä), eli nukleotidit ovat numeroita 1:stä 16569:n. Lähisukulaisuustesti – Autosomit (FamilyFinder) Lähisukulaisuustestissä tulokset arvioidaan päättelemällä jaettuja kromosominpätkiä (Shared cM, centimorgans) sekä miten pitkiä kromosomipätkät ovat. Tarkastelussa on mukana kaikki testatut SNPt ja kromosomit, ei pelkästään sukupuolen määrittävät X tai Y kromosomit. Kun kahdella testatulla on samanlaiset kromosomipätkät, päätellään, ovatko pätkät alentuvasti yhtäläiset (IBD, Identical By Descent). Mikäli ne ovat, lasketaan sukulaisuussuhde perustuen jaettujen dna-segmenttien määrän ja koon perusteella. Kuva 30 - Kromosomiselaimessa neljän eri ihmisen kromosomifraktiot
  31. 31. Hiltusten geneettinen sukututkimus 30 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ DNA-tutkimuksen tilaaminen Nykyisin on useita eri tarjoajia geenitestaukselle. Suosittelemme FamilyTreeDNA:n käyttämistä, koska heillä on suurimmat tietokannat ennestään testatuista ihmisistä. Mikälli sukututkimuksen sijaan perinnölliset sairaudet tai sairausalttiudet kiinnostavat, suosittelemme 23AndMe.com palveluita. Huomaa, että autosomitestit tehdään lähes samanlaisella laitteistolla jokaisessa testausyrityksessä ja niiden tulokset voidaan siirtää pienellä kustannukselle ainakin 23AndMe:stä FamilyTreeDNA:lle (FamilyFinder). On olemassa myös ilmaisia tietokantoja, joihin voi halutessaan ladata tuloksensa. Tällaiset tietokannat pyrkivät kokoamaan tuloksia useammista palveluyrityksistä. Ongelmana on kuitenkin tietoturva ja palvelun pitkäikäisyys, koska ne toimivat useimmiten vapaaehtoisten lahjoittajien toimesta. Hiltunen DNA-projektin kautta saat alennusta tilaamistasi DNA-testeistä. Alempana ohjeet tilauksen tekemiseen. Tilaaminen FamilyTreeDNA:lta FamilyTreeDNA on eniten geneettiseen sukututkimukseen käytetty palvelu ja sisältää tällä hetkellä (lokakuu 2013) 654 254 tallennetta tietokannassaan:  7,726 Sukunimiprojektia  297,888 ainutlaatuista sukunimeä  487,072 Y-DNA tallennetta (isälinja)  179,909 Y-DNA 25-markkerin tallennetta (isälinja)  159,497 Y-DNA 37-markkerin tallennetta (isälinja)  75,534 Y-DNA 67-markkerin tallennetta (isälinja)  167,182 mtDNA tallennetta (äitilinja)  30,264 FGS tallennetta (Full Sequence äitilinja) Johtuen FamilyTreeDNA:n tietokannan suuruudesta, suosittelemme käyttämään FamilyTreeDNA:ta. Päätä, oletko kiinnostunut isä- vai äitilinjasta vai lähisukulaisista sekä siitä, paljonko olet valmis maksamaan tutkimuksesta. Halvin tutkimus maksaa alle 100 euroa ja kallein lähes tuhat euroa. Yksi dollari on tällä hetkellä noin 0,7 euroa. Tarjouksia on Hiltunen-sukunimiprojektimme sivuilla ja kannattaa katsoa myös SuomiDNA- projektin hinnat, sillä ne voivat olla edullisemmat kuin omamme (voit liittyä useampaan projektiin samalla hinnalla). Maksu tapahtuu luottokortilla ennen näytteenottokitin postittamista. Tuloksia varten tarvitset sähköpostiosoitteen. Lähetä sylkinäytteesi ykkösluokan kirjeenä (hinta n. 0,85 euroa) Yhdysvaltoihin FamilyTreeDNA:lle. Helpointa tilauksen aloittaminen on mennä http://sukuseura.hiltsu.fi sivustolle ja sieltä valinta ”Osta testi tästä”. Linkki tilauslomakkeeseen http://www.familytreedna.com/group- join.aspx?&group=Hiltunen&vGroup=hiltunen
  32. 32. Hiltusten geneettinen sukututkimus 31 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Testien hinnat muuttuvat tarjousten mukaan. Suosittelemme isälinjaa tutkittaessa Y-DNA67-testiä ja äitilinjaa tutkittaessa mtFullSequence (FGS). Sivustolla on myös tarjouksia yhdistetyistä testeistä. Painamalla Order Now saat valinnan sukupuolestasi ja valinnan siitä mitä olet tilaamassa. Painamalla Next pääset sivulle, jossa kysytään tiedot testattavasta henkilöstä sekä maksajan tiedot. Voit tilata testin esimerkiksi lahjaksi. Sinulla tulee olla sekä sähköpostiosoite että luottokortti tilausta tehdessäsi! Tehtyäsi tilauksen saat vahvistusviestin sähköpostiisi, jossa on käyttäjätunnuksesi ja salasanasi. Esimerkiksi ” Thank you for ordering the Family Finder, International Shipping tests. Your kit number is 123456 and your password is 654321”. SÄILYTÄ TÄMÄ VIESTI! Tilauksen jälkeen kuluu noin 2-3 viikkoa ja saat näytteenottokitin kotiisi. Se sisältää kaksi puikkoa, joilla hierotaan voimakkaasti suun sisäpuolelta poskea. Puikossa olevaan huopaan jää poskessa olevia soluja, joista dna voidaan erotella. On normaalia, että voimakkaasti poskea raapiessa näytteeseen tulee mukaan hieman verta, josta ei voida genomista dna:ta erottaa. Tämä ei haittaa, ellei verta ole merkittävästi. Muista allekirjoittaa pieni lomake, jolla annat luvan tulostesi siirtämiseksi tietokantaan. Tämä ei vielä tarkoita sitä, että tuloksistasi tulisi julkisia. Lomakkeella annat analyysin suorittavalle laboratoriolle (alihankkijalle) oikeuden toimittaa tietosi FamilyTreeDNA:lle ja oikeuden säilyttää näytettäsi mahdollisia uusia tutkimuksia ajatellen. Kaksi näytettä, yksi molemmista poskista, palautetaan säilöntäaineella varustetussa vialissa postitse FamilyTreeDNA:lle (kirjekuori osoitteineen mukana). Sinun tulee ostaa ykkösluokan postimerkki kirjettä varten. Palautettuasi näytteen kestää noin 1-3 kuukautta kun ensimmäiset tulokset saapuvat. Ajankohta riippuu siitä, minkä verran muita tilauksia on tullut. Yhdellä kertaa tehdään tuhansia analyysejä, koska yhden analyysin tekeminen kerrallaan ei olisi kustannustehokasta. Näytteenotosta on olemassa erilaisia videoita, kuten esimerkiksi tämä. Löydät lisää Youtubesta hakusanalla ”Familytree DNA collection”. Kuva 31 - Testikitti
  33. 33. Hiltusten geneettinen sukututkimus 32 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Tulosten analysointia FamilyTreeDNA:ssa Kun tulokset ovat valmiit, saat sähköpostiisi ilmoituksen. Tämän jälkeen sinun tulee kirjautua FamilyTreeDNA:n sivuille ja antaa lupa tietojesi julkaisemiseen. Samalla kannattaa täyttää perustiedot kohdassa My Account – Personal Profile: Mikäli käytät sukututkimusohjelmistoa, josta voi tallentaa tiedot GEDCOM- formaatissa, kannattaa sinun tehdä siirtotiedosto ja valita ”Import Genealogy”. Voit piilottaa alle 100- vuotta vanhat tiedot järjestelmässä, eli sinun ei tarvitse niitä GEDCOM- tiedostostasi piilottaa. Skandinaavisten merkkien kanssa on ollut usein ongelmaa, eli joudut käymään Surnames (sukunimet) läpi käsin siirron jälkeen. On suositeltavaa lisätä sukunimiin paikkakunta, jossa henkilö on asunut tai syntynyt. Siirrettyäsi GEDCOM-tiedoston, voivat muut käyttäjät tarkastella sukupuutasi (yli 100 vuotta vanhoja tietoja). Kuva 33 - GEDCOM:sta tuotettu sukupuu Kuva 32 - Profiilinäyttö
  34. 34. Hiltusten geneettinen sukututkimus 33 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Sukunimien editoiminen tapahtuu kohdasta My Account – Surnames. Muista laittaa paikkakunta sukunimiin. Mikäli toit tiedot GEDCOM-siirtotiedoston kautta, skandinaaviset merkit kannattaa korjata oikeaksi selvyyden vuoksi. Kuva 34 - Sukunimien editointinäyttö Muista laittaa tiedot myös vanhimmasta tiedossa olevasta esi-isästä ja esi-äidistä kohtaan ”Most Distant Ancestors”. Kuva 35 - Vanhimmat tiedossa olevat esivanhemmat Uusista osumista, eli sukulaisuuksista, saat ilmoituksen sähköpostiisi aina kun tietokantaan tulee uusia tuloksia. Ne näkyvät kyseisen testin kohdalla kohdassa ”Matches”. Uusimman osuman saat lajittelemalla osumat päivämääräjärjestykseen.
  35. 35. Hiltusten geneettinen sukututkimus 34 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ FamilytreeDNA:n päänäytöllä näet tilaamiesi testien tulokset, voit tulostaa sertifikaatteja, analysoida tietoja erilaisilla työkaluilla ja viestittää geneettisille sukulaisillesi. Kuva 36 - Päänäyttö Vasemmalla olevat tiedotteet ja viestit kannattaa lukea säännöllisesti. Usein kohdassa ”Messages” voi olla pyyntö vahvistaa esimerkiksi sukulaisuus, joka saattaa auttaa sinua löytämään perinteisellä tavalla sukulaisuussuhde jonkun toisen testatun sukupuusta.
  36. 36. Hiltusten geneettinen sukututkimus 35 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Tilaaminen 23AndMe:ltä Testausyritys 23AndMe:n lähtökohtana on käyttää Illumina Omnischip- pohjaista SNP-analyysiä, joka on huomattavasti edullisempaa kuin DNA:n sekvensoiminen esimerkiksi PCR:ää hyödyntäen. Omnichip on lähes sama kuin mitä FamilyTreeDNA käyttää FamilyFinder-palvelussaan (autosomit). Mikäli olet teettänyt testing 23AndMe:ssä, voit siirtää ns. raakadatan (raw data) FamilyTreeDNA:han pientä korvausta vastaan. Yritys tarjoaa lähes samat tiedot kuin FamilyTreeDNA, mutta lisäksi tulee paljon tietoa erilaisista perinnöllisistä sairauksista, lääkeherkkyyksistä ja muista ominaisuuksista. Tietokannan koko on yli 100 000 (vuonna 2012). Tilaus tapahtuu 23AndMe.com sivustolta ja hinta on ollut pitkään 99 dollaria + toimituskulut. Tilauksella sitoutuu olemaan vähintään vuoden jäsenenä (9 dollaria per kuukausi). Kokonaishinnaksi tulee siis 99 dollaria + 12 x 9 dollaria + toimituskulut n. 150 dollaria. Analyysi tehdään syljestä. 23AndMe päänäytöt: Päänäytöt ovat vähän kuin Windows 8:ssa ja hieman sekavat . Näytöistä voi porautua syvemmälle tutkimustietoihin ja lähes kaikki tiedot voi ladata vaikka Excel-formaatissa. Kohdasta My Results avautuu seuraavat valikot: Kuva 37 - 23AndMe päävalikko
  37. 37. Hiltusten geneettinen sukututkimus 36 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Kohdasta Family & Friends avautuu seuraava valikko: Kuva 38 - Family & Friends alavalikko DNA-sukulaisuudet näyttävät samalla tavalla autosomeista mitattuja Senttimorganeita ja niistä laskettuja sukulaisuusarvioita kuten FamilyTreDNA:n FmailyFinderissa. Manage Sharingilla voidaan määritellä ketkä näkevät tietosi. FamilyTree voidaan tehdä joko käsin tai siirtää GEDCOM- tiedostosta. FamilyTraits tulee kyseeseen silloin jos useampi ihminen on teettänyt testin ja olette syöttäneet suvussa periytyvistä sairauksista tietojanne systeemiin. Kohdasta Research & Community aukeaa seuraava valikko: Kuva 39 - Research & Community alavalikko Surveys liittyy meneillään oleviin korrelatiivisiin tutkimuksiin. Quick Questions on lyhyitä muutaman rivin kyselyitä. Discoveries ovat uusia dna-löydöksiä. Initiatives ovat aloitteita. Community on keskustelufoorumi.
  38. 38. Hiltusten geneettinen sukututkimus 37 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ DNA Relatives valikosta näet autosomeista laskettuna lähimmät sukulaisesi. Kuva 40 - DNA sukulaisuusvalikko Näytöllä on autosomeista näytetään montako % yhteistä dna:ta kohdehenkilön kanssa jaatte, heidän listaamiaan sukunimiä ja paikkakuntia. Tältä näytöltä voi myös pyytää geenitietojen jakamista, joko terveystietojen kanssa tai ilman. Terveystietoja ei kannata jakaa ellei ole 100% varma, että tiedot saava henkilö ei käytä niitä sinua vastaan (esimerkiksi Yhdysvalloissa vakuutusyhtiöt voivat rajata sairauskorvauksia mikäli saavat geneettiset riskit tietoonsa). Gene-Wide Comparison näytöllä näet montako prosenttia sinä ja henkilöt, jotka ovat antaneet luvan tietojen jakamiseen kanssasi vastaatte koko genomin osalta. Voit vertailla myös erilaisia ominaisuuksia, kuten karvaan maun maistaminen, immuunijärjestelmän toimivuus, geenien ennustaman BMI:n jne. Kuva 41 - Geenien vertailuvalikko
  39. 39. Hiltusten geneettinen sukututkimus 38 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Health Overview näytöllä näytetään yleissilmäys eri terveysaiheisiin valintoihin. Elevated Risks ovat kohonneet riskit (on olemassa myös alentuneet riskit näyttö), Inherited Condition ovat periytyvät sairaudet, Traits ovat ominaisuuksia kuten esimerkiksi maistatko karvaan maun vai et, Drug Response kertoo tietoa siitä millä tavoin eri lääkeaineet saattavat sinun kohdallasi toimia. Terveyteen liittyviä raportteja on noin 200 kpl, geneettisesti periytyviä sairauksia 50 kpl, ominaisuuksia 60 ja lääkeaineisiin liittyviä raportteja 24. Määrä kasvaa muutamalla per vuosi aina kun uusia tutkimustuloksia tulee. Kuva 42 - Terveyden yleisnäkymä Esimerkiksi kuuluisia näyttelijä Angelica Jolie leikkuutti rintansa pois juuri tämän testin tuloksen perusteella. Hänen suvussaan oli rintasyöpägeeni, joka moninkertaistaa rintasyövän riskin. Tämä on ehkä parasta mitä 23AndMe:ssä tulee lisänä, mutta toisaalta myös ahdistavinta. Geenien merkitys sairauksien puhkeamisessa selittää 0-100% riippuen geenistä. Geenien lisäksi ympäristötekijät, epigenetiikka, säätelee geenien aktivaatiota ja tätä kautta sairauksien syntymistä ja ominaisuuksiamme. Tällä tavoin pelkkä korrelaatio voi viedä metsään ja pahasti. Toisaalta on myös tilanteita, joissa on erittäin tärkeää tietää genetiikkansa. Esimerkiksi nutrigenomiikka on uusi tieteenala, joka pyrkii löytämään juuri sinulle sopivan ruokavalion.
  40. 40. Hiltusten geneettinen sukututkimus 39 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Mikäli teettää testin useammasta sukulaisesta, voi päätellä millaiset sairaudet tai ominaisuudet periytyvät suvussa. Koska et voi täysin tietää miten geenitietoa tullaan sinua tai sukulaisiasi vastaan käyttämään, on terveyteen liittyvien dna-tulosten pitäminen salaisena tärkeää! Ancestry Overview näyttöllä näet yleissilmäyksen etnisestä taustasi, montako eri tason geneettistä serkkua tietokannassa on, mistä isäsi ja äitisi ovat tulleet sekä listaus sukunimistä, joita esiintyy geneettisillä serkuillasi. Kuva 43 - Sukututkimuksen yleisnäkymä
  41. 41. Hiltusten geneettinen sukututkimus 40 / 41 Geneettinen sukututkimus - Sukuseura Hiltunen r.y. - Kotisivu: http://sukuseura.hiltsu.fi DNA projekti: http://www.familytreedna.com/public/hiltunen/ Tulevaisuuden toiveita ja tavoitteita Henkilökohtaisesti jatkan sekalinjaisesti geneettisten sukulaisten löytymistä. Tämän lisäksi keskityn myös terveyteen liittyvien geenien analysointia ja pyrin luomaan jälkipolville sellaisia ohjeita, joilla he pystyvät välttämään sellaiset sairaudet, joihin elintavoilla voi vaikuttaa (mikäli tällaisia on). Sukuseura Hiltunen r.y. toiminnan kannalta tärkeitä tavoitteita on löytää Hiltusten alkuperäinen haploryhmä, ryhmitellä tulokset paikkakunnittain esimerkiksi ”Iivarin poikiin” tai ”Niilon poikiin”. Esimerkiksi Tuusniemellä ja Puolangassa on paljon ”Iivarin poikia”, eli I1-haploryhmään kuuluvia Hiltusia ja Kuopiosta Ruotsiin ”Niilon poikia”, eli N1C1-haploryhmään kuuluvia Hiltusia. Mikäli tämä dokumentti herätti mielenkiintosi, mutta jokin asia jäi sinulta epäselväksi, voit ottaa minuun yhteyttä sähköpostilla osoitteeseen jari ät hiltsu.fi. DNA-testien hinnat ovat laskeneet huomattavasti ja halvimmillaan esimerkiksi lähisukulaisuustestin hinta on noin 75 euroa. Mikä parasta, rahalle saatava vastine on ikuista, eikä mitään kertakulutusjuttua. DNA-tietous lisääntyy joka päivä huimaa vauhtia ja mitä enemmän ihmiset testauttavat , sitä enemmän tiedämme historiastamme! DNA-testi lahjaksi ostettuna on ikimuistoinen. Se ei vanhene koskaan. Hangossa 13.10.2013, Jari Hiltunen Lisätietoutta  Hiltunen DNA projekti http://www.familytreedna.com/public/hiltunen/  Sukuseura Hiltunen http://sukuseura.hiltsu.fi/  Suomi DNA projekti http://www.familytreedna.com/public/finland  FamilyTreeDNA http://www.familytreedna.com/  23AndMe https://www.23andme.com/  Lisää tietoutta Haploryhmistä http://fi.wikipedia.org/wiki/Haploryhm%C3%A4  Kuuluisien ihmisten haploryhmiä http://en.wikipedia.org/wiki/List_of_haplogroups_of_notable_people  Genealogy 101 http://dna-explained.com/  Roberta Estesin ”DNA Explained” http://www.dnaexplain.com/about/resume.asp  Geenipankki http://www.ncbi.nlm.nih.gov/genbank/  Y-STR mutaationopeudet http://en.wikipedia.org/wiki/List_of_Y-STR_markers  Mitokondrion mutaationopeus http://en.wikipedia.org/wiki/Mutation_rate  Mitkondrionaaliset sairaudet http://www.nature.com/scitable/topicpage/mtdna-and- mitochondrial-diseases-903  Ihmisen evoluutio http://en.wikipedia.org/wiki/Human_evolution  Meioosin perusteet http://www.dnainheritance.kahikatea.net/crossover.html

×