SlideShare a Scribd company logo
1 of 34
Evolving Prolog
gene expression programming
InfoQ.com: News & Community Site
• 750,000 unique visitors/month
• Published in 4 languages (English, Chinese, Japanese and Brazilian
Portuguese)
• Post content from our QCon conferences
• News 15-20 / week
• Articles 3-4 / week
• Presentations (videos) 12-15 / week
• Interviews 2-3 / week
• Books 1 / month
Watch the video with slide
synchronization on InfoQ.com!
http://www.infoq.com/presentations
/prolog
Presented at QCon New York
www.qconnewyork.com
Purpose of QCon
- to empower software development by facilitating the spread of
knowledge and innovation
Strategy
- practitioner-driven conference designed for YOU: influencers of
change and innovation in your teams
- speakers and topics driving the evolution and innovation
- connecting and catalyzing the influencers and innovators
Highlights
- attended by more than 12,000 delegates since 2007
- held in 9 cities worldwide
mndrix
The Problem
Lending Club
peer to peer loans
which ones are good?
data!
The Result
98% success
p2pquant.com
note selection
Evolving Prolog
Genetic Algorithms
because giraffes
Candida Ferreira FTW!
Genotype
ATGCTTCGGCAAGACTCAAAAAATA
Phenotype
Ophrys apifera
xkcd 1259
Genotype : Phenotype
Source : AST
*b+a-aQab+//+b+babbabbbababbaaa
Investment strategy
and
FICO >
credit
inquiries <
700 2
Prolog
Why Prolog?
homoiconic
?- writeln(hi).
hi
?- X=writeln(hi).
X = writeln(hi).
?- call($X).
hi
logic variables
?- X=writeln(Message).
X = writeln(Message).
?- X=writeln(Message), Message=hi.
Message = hi,
X = writeln(hi).
?- call($X).
hi
*b+a-aQab+//+b+babbabbbababbaaa
declarative
Fitness Function
internal rate of return
Generations
you kids get off my lawn
98% satisfied
p2pquant.com
thanks
Watch the video with slide synchronization on
InfoQ.com!
http://www.infoq.com/presentations/prolog

More Related Content

More from C4Media

Shifting Left with Cloud Native CI/CD
Shifting Left with Cloud Native CI/CDShifting Left with Cloud Native CI/CD
Shifting Left with Cloud Native CI/CDC4Media
 
CI/CD for Machine Learning
CI/CD for Machine LearningCI/CD for Machine Learning
CI/CD for Machine LearningC4Media
 
Fault Tolerance at Speed
Fault Tolerance at SpeedFault Tolerance at Speed
Fault Tolerance at SpeedC4Media
 
Architectures That Scale Deep - Regaining Control in Deep Systems
Architectures That Scale Deep - Regaining Control in Deep SystemsArchitectures That Scale Deep - Regaining Control in Deep Systems
Architectures That Scale Deep - Regaining Control in Deep SystemsC4Media
 
ML in the Browser: Interactive Experiences with Tensorflow.js
ML in the Browser: Interactive Experiences with Tensorflow.jsML in the Browser: Interactive Experiences with Tensorflow.js
ML in the Browser: Interactive Experiences with Tensorflow.jsC4Media
 
Build Your Own WebAssembly Compiler
Build Your Own WebAssembly CompilerBuild Your Own WebAssembly Compiler
Build Your Own WebAssembly CompilerC4Media
 
User & Device Identity for Microservices @ Netflix Scale
User & Device Identity for Microservices @ Netflix ScaleUser & Device Identity for Microservices @ Netflix Scale
User & Device Identity for Microservices @ Netflix ScaleC4Media
 
Scaling Patterns for Netflix's Edge
Scaling Patterns for Netflix's EdgeScaling Patterns for Netflix's Edge
Scaling Patterns for Netflix's EdgeC4Media
 
Make Your Electron App Feel at Home Everywhere
Make Your Electron App Feel at Home EverywhereMake Your Electron App Feel at Home Everywhere
Make Your Electron App Feel at Home EverywhereC4Media
 
The Talk You've Been Await-ing For
The Talk You've Been Await-ing ForThe Talk You've Been Await-ing For
The Talk You've Been Await-ing ForC4Media
 
Future of Data Engineering
Future of Data EngineeringFuture of Data Engineering
Future of Data EngineeringC4Media
 
Automated Testing for Terraform, Docker, Packer, Kubernetes, and More
Automated Testing for Terraform, Docker, Packer, Kubernetes, and MoreAutomated Testing for Terraform, Docker, Packer, Kubernetes, and More
Automated Testing for Terraform, Docker, Packer, Kubernetes, and MoreC4Media
 
Navigating Complexity: High-performance Delivery and Discovery Teams
Navigating Complexity: High-performance Delivery and Discovery TeamsNavigating Complexity: High-performance Delivery and Discovery Teams
Navigating Complexity: High-performance Delivery and Discovery TeamsC4Media
 
High Performance Cooperative Distributed Systems in Adtech
High Performance Cooperative Distributed Systems in AdtechHigh Performance Cooperative Distributed Systems in Adtech
High Performance Cooperative Distributed Systems in AdtechC4Media
 
Rust's Journey to Async/await
Rust's Journey to Async/awaitRust's Journey to Async/await
Rust's Journey to Async/awaitC4Media
 
Opportunities and Pitfalls of Event-Driven Utopia
Opportunities and Pitfalls of Event-Driven UtopiaOpportunities and Pitfalls of Event-Driven Utopia
Opportunities and Pitfalls of Event-Driven UtopiaC4Media
 
Datadog: a Real-Time Metrics Database for One Quadrillion Points/Day
Datadog: a Real-Time Metrics Database for One Quadrillion Points/DayDatadog: a Real-Time Metrics Database for One Quadrillion Points/Day
Datadog: a Real-Time Metrics Database for One Quadrillion Points/DayC4Media
 
Are We Really Cloud-Native?
Are We Really Cloud-Native?Are We Really Cloud-Native?
Are We Really Cloud-Native?C4Media
 
CockroachDB: Architecture of a Geo-Distributed SQL Database
CockroachDB: Architecture of a Geo-Distributed SQL DatabaseCockroachDB: Architecture of a Geo-Distributed SQL Database
CockroachDB: Architecture of a Geo-Distributed SQL DatabaseC4Media
 
A Dive into Streams @LinkedIn with Brooklin
A Dive into Streams @LinkedIn with BrooklinA Dive into Streams @LinkedIn with Brooklin
A Dive into Streams @LinkedIn with BrooklinC4Media
 

More from C4Media (20)

Shifting Left with Cloud Native CI/CD
Shifting Left with Cloud Native CI/CDShifting Left with Cloud Native CI/CD
Shifting Left with Cloud Native CI/CD
 
CI/CD for Machine Learning
CI/CD for Machine LearningCI/CD for Machine Learning
CI/CD for Machine Learning
 
Fault Tolerance at Speed
Fault Tolerance at SpeedFault Tolerance at Speed
Fault Tolerance at Speed
 
Architectures That Scale Deep - Regaining Control in Deep Systems
Architectures That Scale Deep - Regaining Control in Deep SystemsArchitectures That Scale Deep - Regaining Control in Deep Systems
Architectures That Scale Deep - Regaining Control in Deep Systems
 
ML in the Browser: Interactive Experiences with Tensorflow.js
ML in the Browser: Interactive Experiences with Tensorflow.jsML in the Browser: Interactive Experiences with Tensorflow.js
ML in the Browser: Interactive Experiences with Tensorflow.js
 
Build Your Own WebAssembly Compiler
Build Your Own WebAssembly CompilerBuild Your Own WebAssembly Compiler
Build Your Own WebAssembly Compiler
 
User & Device Identity for Microservices @ Netflix Scale
User & Device Identity for Microservices @ Netflix ScaleUser & Device Identity for Microservices @ Netflix Scale
User & Device Identity for Microservices @ Netflix Scale
 
Scaling Patterns for Netflix's Edge
Scaling Patterns for Netflix's EdgeScaling Patterns for Netflix's Edge
Scaling Patterns for Netflix's Edge
 
Make Your Electron App Feel at Home Everywhere
Make Your Electron App Feel at Home EverywhereMake Your Electron App Feel at Home Everywhere
Make Your Electron App Feel at Home Everywhere
 
The Talk You've Been Await-ing For
The Talk You've Been Await-ing ForThe Talk You've Been Await-ing For
The Talk You've Been Await-ing For
 
Future of Data Engineering
Future of Data EngineeringFuture of Data Engineering
Future of Data Engineering
 
Automated Testing for Terraform, Docker, Packer, Kubernetes, and More
Automated Testing for Terraform, Docker, Packer, Kubernetes, and MoreAutomated Testing for Terraform, Docker, Packer, Kubernetes, and More
Automated Testing for Terraform, Docker, Packer, Kubernetes, and More
 
Navigating Complexity: High-performance Delivery and Discovery Teams
Navigating Complexity: High-performance Delivery and Discovery TeamsNavigating Complexity: High-performance Delivery and Discovery Teams
Navigating Complexity: High-performance Delivery and Discovery Teams
 
High Performance Cooperative Distributed Systems in Adtech
High Performance Cooperative Distributed Systems in AdtechHigh Performance Cooperative Distributed Systems in Adtech
High Performance Cooperative Distributed Systems in Adtech
 
Rust's Journey to Async/await
Rust's Journey to Async/awaitRust's Journey to Async/await
Rust's Journey to Async/await
 
Opportunities and Pitfalls of Event-Driven Utopia
Opportunities and Pitfalls of Event-Driven UtopiaOpportunities and Pitfalls of Event-Driven Utopia
Opportunities and Pitfalls of Event-Driven Utopia
 
Datadog: a Real-Time Metrics Database for One Quadrillion Points/Day
Datadog: a Real-Time Metrics Database for One Quadrillion Points/DayDatadog: a Real-Time Metrics Database for One Quadrillion Points/Day
Datadog: a Real-Time Metrics Database for One Quadrillion Points/Day
 
Are We Really Cloud-Native?
Are We Really Cloud-Native?Are We Really Cloud-Native?
Are We Really Cloud-Native?
 
CockroachDB: Architecture of a Geo-Distributed SQL Database
CockroachDB: Architecture of a Geo-Distributed SQL DatabaseCockroachDB: Architecture of a Geo-Distributed SQL Database
CockroachDB: Architecture of a Geo-Distributed SQL Database
 
A Dive into Streams @LinkedIn with Brooklin
A Dive into Streams @LinkedIn with BrooklinA Dive into Streams @LinkedIn with Brooklin
A Dive into Streams @LinkedIn with Brooklin
 

Recently uploaded

9 Steps For Building Winning Founding Team
9 Steps For Building Winning Founding Team9 Steps For Building Winning Founding Team
9 Steps For Building Winning Founding TeamAdam Moalla
 
Basic Building Blocks of Internet of Things.
Basic Building Blocks of Internet of Things.Basic Building Blocks of Internet of Things.
Basic Building Blocks of Internet of Things.YounusS2
 
UiPath Studio Web workshop series - Day 7
UiPath Studio Web workshop series - Day 7UiPath Studio Web workshop series - Day 7
UiPath Studio Web workshop series - Day 7DianaGray10
 
Introduction to Matsuo Laboratory (ENG).pptx
Introduction to Matsuo Laboratory (ENG).pptxIntroduction to Matsuo Laboratory (ENG).pptx
Introduction to Matsuo Laboratory (ENG).pptxMatsuo Lab
 
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPA
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPAAnypoint Code Builder , Google Pub sub connector and MuleSoft RPA
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPAshyamraj55
 
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdfIaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdfDaniel Santiago Silva Capera
 
OpenShift Commons Paris - Choose Your Own Observability Adventure
OpenShift Commons Paris - Choose Your Own Observability AdventureOpenShift Commons Paris - Choose Your Own Observability Adventure
OpenShift Commons Paris - Choose Your Own Observability AdventureEric D. Schabell
 
Do we need a new standard for visualizing the invisible?
Do we need a new standard for visualizing the invisible?Do we need a new standard for visualizing the invisible?
Do we need a new standard for visualizing the invisible?SANGHEE SHIN
 
Nanopower In Semiconductor Industry.pdf
Nanopower  In Semiconductor Industry.pdfNanopower  In Semiconductor Industry.pdf
Nanopower In Semiconductor Industry.pdfPedro Manuel
 
AI Fame Rush Review – Virtual Influencer Creation In Just Minutes
AI Fame Rush Review – Virtual Influencer Creation In Just MinutesAI Fame Rush Review – Virtual Influencer Creation In Just Minutes
AI Fame Rush Review – Virtual Influencer Creation In Just MinutesMd Hossain Ali
 
Spring24-Release Overview - Wellingtion User Group-1.pdf
Spring24-Release Overview - Wellingtion User Group-1.pdfSpring24-Release Overview - Wellingtion User Group-1.pdf
Spring24-Release Overview - Wellingtion User Group-1.pdfAnna Loughnan Colquhoun
 
Things you didn't know you can use in your Salesforce
Things you didn't know you can use in your SalesforceThings you didn't know you can use in your Salesforce
Things you didn't know you can use in your SalesforceMartin Humpolec
 
UiPath Studio Web workshop series - Day 8
UiPath Studio Web workshop series - Day 8UiPath Studio Web workshop series - Day 8
UiPath Studio Web workshop series - Day 8DianaGray10
 
Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...
Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...
Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...Will Schroeder
 
PicPay - GenAI Finance Assistant - ChatGPT for Customer Service
PicPay - GenAI Finance Assistant - ChatGPT for Customer ServicePicPay - GenAI Finance Assistant - ChatGPT for Customer Service
PicPay - GenAI Finance Assistant - ChatGPT for Customer ServiceRenan Moreira de Oliveira
 
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCostKubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCostMatt Ray
 
Videogame localization & technology_ how to enhance the power of translation.pdf
Videogame localization & technology_ how to enhance the power of translation.pdfVideogame localization & technology_ how to enhance the power of translation.pdf
Videogame localization & technology_ how to enhance the power of translation.pdfinfogdgmi
 
Bird eye's view on Camunda open source ecosystem
Bird eye's view on Camunda open source ecosystemBird eye's view on Camunda open source ecosystem
Bird eye's view on Camunda open source ecosystemAsko Soukka
 
Cybersecurity Workshop #1.pptx
Cybersecurity Workshop #1.pptxCybersecurity Workshop #1.pptx
Cybersecurity Workshop #1.pptxGDSC PJATK
 
Meet the new FSP 3000 M-Flex800™
Meet the new FSP 3000 M-Flex800™Meet the new FSP 3000 M-Flex800™
Meet the new FSP 3000 M-Flex800™Adtran
 

Recently uploaded (20)

9 Steps For Building Winning Founding Team
9 Steps For Building Winning Founding Team9 Steps For Building Winning Founding Team
9 Steps For Building Winning Founding Team
 
Basic Building Blocks of Internet of Things.
Basic Building Blocks of Internet of Things.Basic Building Blocks of Internet of Things.
Basic Building Blocks of Internet of Things.
 
UiPath Studio Web workshop series - Day 7
UiPath Studio Web workshop series - Day 7UiPath Studio Web workshop series - Day 7
UiPath Studio Web workshop series - Day 7
 
Introduction to Matsuo Laboratory (ENG).pptx
Introduction to Matsuo Laboratory (ENG).pptxIntroduction to Matsuo Laboratory (ENG).pptx
Introduction to Matsuo Laboratory (ENG).pptx
 
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPA
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPAAnypoint Code Builder , Google Pub sub connector and MuleSoft RPA
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPA
 
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdfIaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
 
OpenShift Commons Paris - Choose Your Own Observability Adventure
OpenShift Commons Paris - Choose Your Own Observability AdventureOpenShift Commons Paris - Choose Your Own Observability Adventure
OpenShift Commons Paris - Choose Your Own Observability Adventure
 
Do we need a new standard for visualizing the invisible?
Do we need a new standard for visualizing the invisible?Do we need a new standard for visualizing the invisible?
Do we need a new standard for visualizing the invisible?
 
Nanopower In Semiconductor Industry.pdf
Nanopower  In Semiconductor Industry.pdfNanopower  In Semiconductor Industry.pdf
Nanopower In Semiconductor Industry.pdf
 
AI Fame Rush Review – Virtual Influencer Creation In Just Minutes
AI Fame Rush Review – Virtual Influencer Creation In Just MinutesAI Fame Rush Review – Virtual Influencer Creation In Just Minutes
AI Fame Rush Review – Virtual Influencer Creation In Just Minutes
 
Spring24-Release Overview - Wellingtion User Group-1.pdf
Spring24-Release Overview - Wellingtion User Group-1.pdfSpring24-Release Overview - Wellingtion User Group-1.pdf
Spring24-Release Overview - Wellingtion User Group-1.pdf
 
Things you didn't know you can use in your Salesforce
Things you didn't know you can use in your SalesforceThings you didn't know you can use in your Salesforce
Things you didn't know you can use in your Salesforce
 
UiPath Studio Web workshop series - Day 8
UiPath Studio Web workshop series - Day 8UiPath Studio Web workshop series - Day 8
UiPath Studio Web workshop series - Day 8
 
Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...
Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...
Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...
 
PicPay - GenAI Finance Assistant - ChatGPT for Customer Service
PicPay - GenAI Finance Assistant - ChatGPT for Customer ServicePicPay - GenAI Finance Assistant - ChatGPT for Customer Service
PicPay - GenAI Finance Assistant - ChatGPT for Customer Service
 
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCostKubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
 
Videogame localization & technology_ how to enhance the power of translation.pdf
Videogame localization & technology_ how to enhance the power of translation.pdfVideogame localization & technology_ how to enhance the power of translation.pdf
Videogame localization & technology_ how to enhance the power of translation.pdf
 
Bird eye's view on Camunda open source ecosystem
Bird eye's view on Camunda open source ecosystemBird eye's view on Camunda open source ecosystem
Bird eye's view on Camunda open source ecosystem
 
Cybersecurity Workshop #1.pptx
Cybersecurity Workshop #1.pptxCybersecurity Workshop #1.pptx
Cybersecurity Workshop #1.pptx
 
Meet the new FSP 3000 M-Flex800™
Meet the new FSP 3000 M-Flex800™Meet the new FSP 3000 M-Flex800™
Meet the new FSP 3000 M-Flex800™
 

Evolving Prolog