Livestock in developing countries: Animal health challenges and opportunities
Livestock in developing countries:
Animal health challenges
and opportunities
General Assembly of the International Federation for
Animal Health, Brussels, 25 April 2013
Jimmy Smith
THE GLOBAL CHALLENGE
How the world would feed itself sustainably by
the time population stabiles?
60% more food than is produced now
75% of this must come from productivity
increase
While also reducing poverty
Coping with the 2 degree temperature scenario
--and possibly 4 degrees
Percentage increase in demand
for livestock products
IFPRI-ILRI IMPACT model results
Far higher growth in demand will occur in developing countries
By 2040, 70% of global beef and milk will be produced
in developing countries by smallholders in transition
IFPRI-ILRI IMPACT model results
%
0
5
10
15
20
90 95 2000 2004 2005 2008 2009
Milliontonnes
Beef Pork PoultryMeat Ovine
Trade matters --but local markets matter more
The value of meat trade
is estimated over $100
billion in 2011,
approximately 10 percent
of agricultural trade.
However, trade of meat
account for only 10
percent of total livestock
consumption
THE GLOBAL DEVELOPMENT CHALLENGES
The Livestock Dimensions
Promoting growth with equity –small holder
participation
Connecting small holders to markets
Raising livestock productivity
Animal-human-ecosystems health & food safety
Rendering livestock systems more
environmentally sustainable
Ameliorating the effects of climate change on
livestock
Livestock for livelihoods in the developing world
70% of the world’s rural poor rely on
livestock for important parts of their
livelihoods.
Of the 600 million poor livestock keepers in
the world, around two-thirds are rural
women.
More than half of livestock products are
produced by small holders – and growing
Up to 40% of benefits from livestock keeping
come from non-market, intangible benefits,
mostly insurance and financing.
Livestock keepers in developing countries
Density of poor
livestock keepers
One billion people earning <$2 a day depend on livestock
600 million in south Asia
300 million in sub Saharan Africa
ILRI, 2012
0 or no data
To eat meat or not to eat . . .
One billion hungry Two billion overweight
Addressing GHG inefficiencies in the
developing world is an opportunity
Herrero et al PNAS (forthcoming)
GHG per kg of animal protein produced
A global water crisis
2 billion people
lack access
Demand is growing;
freshwater is getting
scarcer
70% of total
freshwater use is for
agriculture,
of which 31%
is for livestock
Source: (Steinfeld et al. 2006)
Large productivity gaps between rich
and poor countries are not closing
Some developing country regions have gaps of up to 430% in milk
Costs of emerging zoonotic disease outbreaks
(US$ billion)
Period
Costs (conservative
estimates)
Annual
average
6 outbreaks other than SARS
-Nipah virus (Malaysia),
-West Nile fever (USA),
-HPAI (Asia, Europe),
-BSE (US),
-Rift Valley Fever (Tanzania, Kenya, Somalia)
- BSE (UK) costs in 1997-09 only
1998-2009 38.7
SARS 2002-2004 41.5
Total in 12 year
period (1998-2009)
80.2
6.7 b
16
Source World Bank 2012
Annual losses from selected diseases –
Africa and South Asia
Estimates from BMGF
• West USA & west Europe hotspots
• Last decade: S America & SE Asia
ILRI resources
• Staff: 700
• Budget: $74 million
• 30+ scientific disciplines
• 150 senior scientists from 39 countries
• 56% of internationally recruited
staff are from 22 developing countries
• 34% of internationally recruited staff
are women
• Large campuses in Kenya and Ethiopia
ILRI’s research teams
25
Integrated sciences Biosciences
Animal science for sustainable
productivity
BecA-ILRI hub
Food safety and zoonoses Vaccine platform
Livestock systems and the
environment
Animal bioscience
Livelihoods, gender and impact Feed and forage bioscience
Policy, trade, value chains Bioscience facilities
A portfolio of innovation and vaccine
related technology platforms
Optimizing existing vaccines
Thermostabilization of attenuated viral vaccines
Establishing quality control and process improvement
Reverse vaccinology and immunology
Identification of vaccine antigens
Assessing protein and gene-based vaccine formulations
Pathogen & livestock genomics
Host and pathogen gene expression profiles
Pathogen population structure
Synthetic genomics
Manipulating bacterial genomes
Attenuating viruses by genome engineering
ACTGGTACGTAGGGCATCGA
TCGACATGATAGAGCATATA
GCATGACGATGCGATCGACA
GTCGACAGCTGACAGCTGAG
GGTGACACCAGCTGCCAGCT
GGACCACCATTAGGACAGAT
GACCACACACAAATAGACGA
TTAGGACCAGATGAGCCACA
TTTTAGGAGGACACACACCA
Bioinformatics
tools
Predict gene
sequences and
list candidate
vaccine antigens
Test experimental vaccine
Clone genes of
vaccine interest
(100’s of genes)
Filter genes via
immunological
assays
Pathogen genome mining
(1000’s of genes)
Molecular immunology
tools to assess immune
responses in cattle
(10’s genes)
Opportunity: Employ ‘one health’ for diseases of
intensification and food-borne diseases
Conducting integrated human & livestock
disease surveys: Kenya, Laos, Vietnam, China
Supporting one -health
resource centers in
Vietnam, Thailand and
Indonesia
• Undertaking
participatory
risk analysis for
safe foods in
informal
markets
The presentation has a Creative Commons licence. You are free to re-use or distribute this work, provided credit is
given to ILRI.
better lives through livestock
ilri.org
Editor's Notes
70% of the world’s rural poor: LID. Updates
This update was done in 2012 as part of the DFID mapping project. Estimates of poor livestock keepers vary from around 700 million to over a billion depending on the source.
Period Disease (Country) Start Estimate 1986-2009 Bovine Spongiform Encephalopathy (UK) 1986 15,500,000,000 6.1 billion in 1997-2009 1994 Plague (India) 1994 2,000,000,000 Sept. 1998-April 1999 Nipah virus (Malaysia) 1998 671,000,000 January 1999-Dec. 2008 West Nile fever (USA) 1999 400,000,000 Nov. 2002-July 2003 Severe Acute Respiratory Syndrome (CD, China, ROW)2002 41,500,000,000 January 2004-January 2009Highly Pathogenic Avian Influenza (Asia) 2004 20,000,000,000 2003-2007 Bovine Spongiform Encephalopathy (USA) 2004 11,000,000,000 Oct. 2005-Jan. 2009 Highly Pathogenic Avian Influenza (Europe) 2005 500,000,000 Nov. 2005-January 2009 Highly Pathogenic Avian Influenza (Africa) 2005 Nov. 2006-May 2007 Rift Valley Fever (Tanzania, Kenya, Somalia) 2006 30,000,000 per year without SARS 48,329,000,000 2,301,380,952 SARS 41,500,000,000 1,976,190,476 Total in 1986-2006 89,829,000,000 4,277,571,429 Total in 1998-2009 only 80,201,000,000 6,683,416,667 without SARS 38,701,000,000 3,225,083,333 SARS 41,500,000,000 3,458,333,333 Annual avg (12 yrs) for 7 outbreaks is $3.2 b If SARS is once in 12-yrs event, the annual cost is $3.5 b Moreover, there are other zoonotic diseases that are not included in this calculation. For instance HIV/AIDs which imposes heavy human, social and economic costs. At present, programs to control the disease are spending on the order of $10 billion per year – if we had included this, the total costs would be even more staggering. Costs of a flu pandemic would range from about 5x the impact of these 8 outbreaks in a mild flu scenario (455 billion) to about 40 x in a severe flu scenario ($3.1 trillion). Most of these costs would be indirect.
In the same study, we also mapped emerging zoonotic events between 1940 and 2012. Those of the last decade are shown as blue dots, while earlier events are coloured red. In recent years, more events have been reported from the rapidly intensifying regions of S America and SE Asia
No vaccine for ASF, disease affects trade and market access. Wiped out half pig population in Madagascar in the late 1990’s.
We are investigating the links between climate change, novel irrigation and the emergence of new diseases Our high-throughput facilities support ‘virus hunting’ and discovery of new pathogens. Last year we published the first ever report of Nduma virus in pigs We are also working on decision support tools, to allow early detection of outbreaks – one of these tools has been adopted by the Kenya vet services. We have developed a lateral flow test for the rapid diagnosis of cysticercosis: this is now being tested in the field As well as improving the ECF infection and treatment method, we are developing new vaccines for ECF and CBPP and testing vaccine strategies (showing for example that AI vaccination it is ineffective in the backyard sector in Indonesia)
This is a list of some by no means all of the activities under the major banners. Others include: tools to measure antibody and cellular immune responses characterization of protective immune responses cataloging genes and genome evolution molecular markers for diagnostic purposes p athogen and host population dynamics: distribution and diversity deciphering gene function
We are supporting 3 regional centers for One Health research in Vietnam, Thailand and Indonesia Later this year a book will be published capturing 10 years research in informal food markets We have pioneered integrated human & livestock multiple diseases surveys in Africa and Asia