Advertisement
Check these out next
Livestock in developing countries: Animal health challenges and opportunities
May. 23, 2013•0 likes•3,230 views
3 likes
Be the first to like this
Show More
views
Total views
0
On Slideshare
0
From embeds
0
Number of embeds
0
Download to read offline
Report
Technology
Business
Presented by Jimmy Smith at the General Assembly of the International Federation for Animal Health, Brussels, 25 April 2013
ILRIFollow
-- at ILRIAdvertisement
Advertisement
Advertisement
Recommended
Working animals: Climate change and public health issues in achieving the Sus...ILRI
Global Agenda for Sustainable Livestock (GASL) and the UN FSSILRI
The One Health research-for-development agenda: Enhance holistic health of pe...ILRI
One health approaches for rabies controlILRI
Research and Innovation for a Decade of Action: One CGIAR’s New Research Port...International Food Policy Research Institute (IFPRI)
One health, three healths, many healthsILRI
Livestock in developing countries: Animal health challenges and opportunities
- Livestock in developing countries: Animal health challenges and opportunities General Assembly of the International Federation for Animal Health, Brussels, 25 April 2013 Jimmy Smith
- OUTLINE The global challenge for agriculture Livestock dimensions The case of animal health A bit about ILRI
- THE GLOBAL CHALLENGE How the world would feed itself sustainably by the time population stabiles? 60% more food than is produced now 75% of this must come from productivity increase While also reducing poverty Coping with the 2 degree temperature scenario --and possibly 4 degrees
- OUTLINE Livestock dimensions of that challenge –but also opportunity
- Percentage increase in demand for livestock products IFPRI-ILRI IMPACT model results Far higher growth in demand will occur in developing countries
- By 2040, 70% of global beef and milk will be produced in developing countries by smallholders in transition IFPRI-ILRI IMPACT model results %
- 0 5 10 15 20 90 95 2000 2004 2005 2008 2009 Milliontonnes Beef Pork PoultryMeat Ovine Trade matters --but local markets matter more The value of meat trade is estimated over $100 billion in 2011, approximately 10 percent of agricultural trade. However, trade of meat account for only 10 percent of total livestock consumption
- THE GLOBAL DEVELOPMENT CHALLENGES The Livestock Dimensions Promoting growth with equity –small holder participation Connecting small holders to markets Raising livestock productivity Animal-human-ecosystems health & food safety Rendering livestock systems more environmentally sustainable Ameliorating the effects of climate change on livestock
- Livestock for livelihoods in the developing world 70% of the world’s rural poor rely on livestock for important parts of their livelihoods. Of the 600 million poor livestock keepers in the world, around two-thirds are rural women. More than half of livestock products are produced by small holders – and growing Up to 40% of benefits from livestock keeping come from non-market, intangible benefits, mostly insurance and financing.
- Livestock keepers in developing countries Density of poor livestock keepers One billion people earning <$2 a day depend on livestock 600 million in south Asia 300 million in sub Saharan Africa ILRI, 2012 0 or no data
- To eat meat or not to eat . . . One billion hungry Two billion overweight
- Addressing GHG inefficiencies in the developing world is an opportunity Herrero et al PNAS (forthcoming) GHG per kg of animal protein produced
- A global water crisis 2 billion people lack access Demand is growing; freshwater is getting scarcer 70% of total freshwater use is for agriculture, of which 31% is for livestock
- Source: (Steinfeld et al. 2006) Large productivity gaps between rich and poor countries are not closing Some developing country regions have gaps of up to 430% in milk
- OUTLINE Animal health issues
- Costs of emerging zoonotic disease outbreaks (US$ billion) Period Costs (conservative estimates) Annual average 6 outbreaks other than SARS -Nipah virus (Malaysia), -West Nile fever (USA), -HPAI (Asia, Europe), -BSE (US), -Rift Valley Fever (Tanzania, Kenya, Somalia) - BSE (UK) costs in 1997-09 only 1998-2009 38.7 SARS 2002-2004 41.5 Total in 12 year period (1998-2009) 80.2 6.7 b 16 Source World Bank 2012
- Annual losses from selected diseases – Africa and South Asia Estimates from BMGF
- • West USA & west Europe hotspots • Last decade: S America & SE Asia
- 199 8 2007 Globalization of transboundary disease: Example African swine fever Threat to $150 billion global pig industry
- OUTLINE A bit about ILRI
- CIMMYT Mexico City Mexico IFPRI Wash. DC USA CIP Lima Peru CIAT Cali Colombia Bioversity International Rome Italy AfricaRice Cotonou Benin IITA Ibadan Nigeria ILRI Nairobi Kenya World Agroforestry Nairobi Kenya ICARDA Aleppo Syrian Arab Rep. ICRISAT Patancheru India IWMI Colombo Sri Lanka IRRI Los Banos Phillippines World Fish Penang Malaysia CIFOR Bogor Indonesia CGIAR Research Centres
- ILRI Offices Mali Nigeria Mozambique Kenya Ethiopia India Sri Lanka China Laos Vietnam Thailand Nairobi: Headquarters Addis Ababa: principal campus In 2012, offices opened in: Kampala, Uganda Harare, Zimbabwe Gaborone, Botswana Office in Bamako, Mali relocated to Ouagadougou, Burkina Faso Dakar, Senegal
- ILRI Nairobi campus A lab in Africa at the foot of Kenya’s Ngong Hills ★
- ILRI resources • Staff: 700 • Budget: $74 million • 30+ scientific disciplines • 150 senior scientists from 39 countries • 56% of internationally recruited staff are from 22 developing countries • 34% of internationally recruited staff are women • Large campuses in Kenya and Ethiopia
- ILRI’s research teams 25 Integrated sciences Biosciences Animal science for sustainable productivity BecA-ILRI hub Food safety and zoonoses Vaccine platform Livestock systems and the environment Animal bioscience Livelihoods, gender and impact Feed and forage bioscience Policy, trade, value chains Bioscience facilities
- A portfolio of innovation and vaccine related technology platforms Optimizing existing vaccines Thermostabilization of attenuated viral vaccines Establishing quality control and process improvement Reverse vaccinology and immunology Identification of vaccine antigens Assessing protein and gene-based vaccine formulations Pathogen & livestock genomics Host and pathogen gene expression profiles Pathogen population structure Synthetic genomics Manipulating bacterial genomes Attenuating viruses by genome engineering ACTGGTACGTAGGGCATCGA TCGACATGATAGAGCATATA GCATGACGATGCGATCGACA GTCGACAGCTGACAGCTGAG GGTGACACCAGCTGCCAGCT GGACCACCATTAGGACAGAT GACCACACACAAATAGACGA TTAGGACCAGATGAGCCACA TTTTAGGAGGACACACACCA Bioinformatics tools Predict gene sequences and list candidate vaccine antigens Test experimental vaccine Clone genes of vaccine interest (100’s of genes) Filter genes via immunological assays Pathogen genome mining (1000’s of genes) Molecular immunology tools to assess immune responses in cattle (10’s genes)
- Opportunity: Employ ‘one health’ for diseases of intensification and food-borne diseases Conducting integrated human & livestock disease surveys: Kenya, Laos, Vietnam, China Supporting one -health resource centers in Vietnam, Thailand and Indonesia • Undertaking participatory risk analysis for safe foods in informal markets
- The presentation has a Creative Commons licence. You are free to re-use or distribute this work, provided credit is given to ILRI. better lives through livestock ilri.org
Editor's Notes
- 70% of the world’s rural poor: LID. Updates
- This update was done in 2012 as part of the DFID mapping project. Estimates of poor livestock keepers vary from around 700 million to over a billion depending on the source.
- Period Disease (Country) Start Estimate 1986-2009 Bovine Spongiform Encephalopathy (UK) 1986 15,500,000,000 6.1 billion in 1997-2009 1994 Plague (India) 1994 2,000,000,000 Sept. 1998-April 1999 Nipah virus (Malaysia) 1998 671,000,000 January 1999-Dec. 2008 West Nile fever (USA) 1999 400,000,000 Nov. 2002-July 2003 Severe Acute Respiratory Syndrome (CD, China, ROW)2002 41,500,000,000 January 2004-January 2009Highly Pathogenic Avian Influenza (Asia) 2004 20,000,000,000 2003-2007 Bovine Spongiform Encephalopathy (USA) 2004 11,000,000,000 Oct. 2005-Jan. 2009 Highly Pathogenic Avian Influenza (Europe) 2005 500,000,000 Nov. 2005-January 2009 Highly Pathogenic Avian Influenza (Africa) 2005 Nov. 2006-May 2007 Rift Valley Fever (Tanzania, Kenya, Somalia) 2006 30,000,000 per year without SARS 48,329,000,000 2,301,380,952 SARS 41,500,000,000 1,976,190,476 Total in 1986-2006 89,829,000,000 4,277,571,429 Total in 1998-2009 only 80,201,000,000 6,683,416,667 without SARS 38,701,000,000 3,225,083,333 SARS 41,500,000,000 3,458,333,333 Annual avg (12 yrs) for 7 outbreaks is $3.2 b If SARS is once in 12-yrs event, the annual cost is $3.5 b Moreover, there are other zoonotic diseases that are not included in this calculation. For instance HIV/AIDs which imposes heavy human, social and economic costs. At present, programs to control the disease are spending on the order of $10 billion per year – if we had included this, the total costs would be even more staggering. Costs of a flu pandemic would range from about 5x the impact of these 8 outbreaks in a mild flu scenario (455 billion) to about 40 x in a severe flu scenario ($3.1 trillion). Most of these costs would be indirect.
- In the same study, we also mapped emerging zoonotic events between 1940 and 2012. Those of the last decade are shown as blue dots, while earlier events are coloured red. In recent years, more events have been reported from the rapidly intensifying regions of S America and SE Asia
- No vaccine for ASF, disease affects trade and market access. Wiped out half pig population in Madagascar in the late 1990’s.
- We are investigating the links between climate change, novel irrigation and the emergence of new diseases Our high-throughput facilities support ‘virus hunting’ and discovery of new pathogens. Last year we published the first ever report of Nduma virus in pigs We are also working on decision support tools, to allow early detection of outbreaks – one of these tools has been adopted by the Kenya vet services. We have developed a lateral flow test for the rapid diagnosis of cysticercosis: this is now being tested in the field As well as improving the ECF infection and treatment method, we are developing new vaccines for ECF and CBPP and testing vaccine strategies (showing for example that AI vaccination it is ineffective in the backyard sector in Indonesia)
- This is a list of some by no means all of the activities under the major banners. Others include: tools to measure antibody and cellular immune responses characterization of protective immune responses cataloging genes and genome evolution molecular markers for diagnostic purposes p athogen and host population dynamics: distribution and diversity deciphering gene function
- We are supporting 3 regional centers for One Health research in Vietnam, Thailand and Indonesia Later this year a book will be published capturing 10 years research in informal food markets We have pioneered integrated human & livestock multiple diseases surveys in Africa and Asia
Advertisement