Advertisement
Advertisement

More Related Content

Similar to East Coast fever—Outlook for a new vaccine (20)

Advertisement

More from ILRI(20)

Recently uploaded(20)

Advertisement

East Coast fever—Outlook for a new vaccine

  1. East Coast fever – outlook for a new vaccine Vish Nene Workshop on the distribution, delivery and improvement of the Infection and Treatment Method vaccine for East Coast fever Nairobi, 19-20 August 2014
  2. A live vaccine via ITM for the control of ECF A live infection and treatment based method of vaccination Caused by Theileria parva – a tick transmitted pathogen Vaccination method developed by KARI and ILRI in mid-1970’s The Muguga cocktail a commercial enterprise at CTTBD
  3. Entry points for subunit vaccine intervention Infected R. appendiculatus ticks schizont-infected cells sporozoites piroplasms merogony Antigenic diversity - a hallmark of T. parva sporozoite neutralizing Abs sporozoite bovine cell schizont-specific CD8 killer T-cells (CTLs) CTL P CTL P
  4. Technical advances in DNA/RNA/protein sequencing, glycomics, molecular & cellular biology, immunology, bioinformatics, nano-tech, computational biology, structural biology, microbiomes, etc. New paradigms in science are accelerating vaccine development research 1.Identification of candidate vaccine antigens 2.Immunogenicity studies with antigens 3.Laboratory challenge studies 4.Contained field trials
  5. p67N p67M p67C 21 225 226 571 572 651 9 709 Average sporozoite bovine cell Parasite neutralizing Abs Antibodies to p67 mediate immunity to ECF
  6. A novel human antibody discovery platform
  7. T-cell antigen discovery pipeline at ILRI - I ACTGGTACGTAGGGCATCGATCGACATGATAGAGCATATAGCATGACGATGCGATCGACAGTCGACAGCTGACAGCTGAGGGTGACACCAGCTGCCAGCTGGACCACCATTAGGACAGATGACCACACACAAATAGACGATTAGGACCAGATGAGCCACATTTTAGGAGGACACACACCA Bioinformatics tools Predict ~ 5000 gene sequences & list candidate vaccine antigens Clone genes of vaccine interest Filter genes via IFN-g ELISPOT and lytic assays T. parva genome sequence A Random cDNA library B Candidate CTL antigens Map CTL epitopes
  8. T-cell antigen discovery pipeline at ILRI - II By Anne Mølgaard High information positions HLA-A0201 Pep de in MHC groove Pep des exhibit a mo f Various algorithms available for predic on of pep de epitopes [Peptide] Control BoLA-N*04101/ no peptide BoLA-N*04101/Tp227-37 BoLA-N*04101/Tp229-37 CD8+ (PerCP) Flow cytometry assay
  9. Mapped parasite CTL antigens/epitopes CTL epitope Peptide sequence MHC class I gene BoLA sero-type Tp1214-224 VGYPKVKEEML N*01301 A18 (HD6) Tp227-37 SHEELKKLGML T2b~ Tp249-59 KSSHGMGKVGK N*01201 A10 (T2a) Tp296-104 FAQSLVCVL T2c~ Tp298-106 QSLVCVLMK N*01201 A10 (T2a) Tp4328-336 TGASIQTTL N*00101 A10 (5.1) Tp587-95 SKADVIAKY T5~ Tp7206-214 EFISFPISL T7~ Tp8379-387 CGAELNHFL N*00101 A10 (5.1)
  10. East Coast fever vaccine trials in cattle One candidate B-cell vaccine antigen ~50% cattle immune to challenge in lab trials How can this be improved? Twelve candidate T-cell vaccine antigens ~30% cattle immune to challenge in lab trials How can this be improved?
  11. An East Coast fever R & D consortium Inception workshop: 27-29th Jan 2014
  12. Antibodies Killer T-cells (CTLs) Map new pathogen antigens Map host response to infection & vaccination Comparative pathogen genomics Fill knowledge gaps for vaccine development & proof-of-concept (POC) Compare different vaccination systems
  13. Improve live vaccine – sporozoite counts 1.Enumerate live sporozoites 2.Relate sporozoite counts to infectivity 3.Relate sporozoite counts to immunogenicity Guava easyCyte™ 5 high power laser (Merck-Millipore)
  14. Vaccines? Novel acaricides? Anti-tick? A role for vector control?
  15. ECF Consortium -POC – in four years 1.Best bet sporozoite antigens 2.Best bet schizont antigens 3.Best bet delivery systems 4.Combination of sporozoite and schizont antigens Phase 1: 70~80% immunity to defined parasite challenge/defined cattle Phase 2: broad-spectrum immunity
  16. The presentation has a Creative Commons licence. You are free to re-use or distribute this work, provided credit is given to ILRI. better lives through livestock ilri.org
Advertisement