Presented by Vish Nene at the Workshop on the Distribution, Delivery and Improvement of the
Infection and Treatment Method Vaccine for East Coast Fever, Nairobi, 19-20 August 2014
East Coast fever – outlook for a new
vaccine
Vish Nene
Workshop on the distribution, delivery and improvement of the
Infection and Treatment Method vaccine for East Coast fever
Nairobi, 19-20 August 2014
A live vaccine via ITM for the control of ECF
A live infection and treatment based method of vaccination
Caused by Theileria parva – a tick transmitted pathogen
Vaccination method developed by KARI and ILRI in mid-1970’s
The Muguga cocktail a commercial enterprise at CTTBD
Entry points for subunit vaccine intervention
Infected R. appendiculatus ticks
schizont-infected cells
sporozoites
piroplasms
merogony
Antigenic diversity - a hallmark of T. parva
sporozoite
neutralizing Abs
sporozoite
bovine cell
schizont-specific CD8
killer T-cells (CTLs)
CTL
P
CTL
P
Technical advances in DNA/RNA/protein sequencing, glycomics, molecular & cellular biology, immunology, bioinformatics, nano-tech, computational biology, structural biology, microbiomes, etc.
New paradigms in science are accelerating vaccine development research
1.Identification of candidate vaccine antigens
2.Immunogenicity studies with antigens
3.Laboratory challenge studies
4.Contained field trials
p67N
p67M
p67C
21 225
226 571
572 651
9 709
Average
sporozoite
bovine cell
Parasite neutralizing Abs
Antibodies to p67 mediate immunity to ECF
T-cell antigen discovery pipeline at ILRI - I ACTGGTACGTAGGGCATCGATCGACATGATAGAGCATATAGCATGACGATGCGATCGACAGTCGACAGCTGACAGCTGAGGGTGACACCAGCTGCCAGCTGGACCACCATTAGGACAGATGACCACACACAAATAGACGATTAGGACCAGATGAGCCACATTTTAGGAGGACACACACCA Bioinformatics tools Predict ~ 5000 gene sequences & list candidate vaccine antigens Clone genes of vaccine interest Filter genes via IFN-g ELISPOT and lytic assays T. parva genome sequence A Random cDNA library B Candidate CTL antigens Map CTL epitopes
T-cell antigen discovery pipeline at ILRI - II
By Anne Mølgaard
High information
positions
HLA-A0201
Pep de in MHC groove Pep des exhibit a mo f
Various algorithms available for predic on of pep de epitopes
[Peptide]
Control
BoLA-N*04101/
no peptide BoLA-N*04101/Tp227-37 BoLA-N*04101/Tp229-37
CD8+ (PerCP)
Flow cytometry assay
East Coast fever vaccine trials in cattle
One candidate B-cell vaccine antigen
~50% cattle immune to challenge in lab trials
How can this be improved?
Twelve candidate T-cell vaccine antigens
~30% cattle immune to challenge in lab trials
How can this be improved?
An East Coast fever R & D consortium
Inception workshop: 27-29th Jan 2014
Antibodies
Killer T-cells (CTLs)
Map new pathogen antigens
Map host response to infection & vaccination
Comparative pathogen genomics
Fill knowledge gaps for vaccine development & proof-of-concept (POC)
Compare different vaccination systems
Improve live vaccine – sporozoite counts
1.Enumerate live sporozoites
2.Relate sporozoite counts to infectivity
3.Relate sporozoite counts to immunogenicity
Guava easyCyte™ 5 high power laser (Merck-Millipore)
ECF Consortium -POC – in four years
1.Best bet sporozoite antigens
2.Best bet schizont antigens
3.Best bet delivery systems
4.Combination of sporozoite and schizont antigens
Phase 1: 70~80% immunity to defined parasite challenge/defined cattle
Phase 2: broad-spectrum immunity
The presentation has a Creative Commons licence. You are free to re-use or distribute this work, provided credit is given to ILRI.
better lives through livestock
ilri.org