Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

BeCA-ILRI Bioinformatics Platform

979 views

Published on

Poster prepared for the Exhibition during the African Union 2010 Summit, Theme—ICT in Africa: Challenges & Prospects for Development, held at UNECA, Addis Ababa, Ethiopia, 29 Jan-2 Feb 2010.

Published in: Technology, Business
  • Be the first to comment

BeCA-ILRI Bioinformatics Platform

  1. 1. BecA-ILRI Bioinformatics Platform What is Bioinformatics? Bioinformatics is a rapidly developing branch of Information Technology that seeks to exploit the wealth of genome and expressed sequence tag (EST) data that has been generated in the last decade. Bioinformatics offers tremendous opportunities and has great potential to underpin biotechnological solutions to agricultural development constraints. In short, bioinformatics is the key to understanding the molecule of life, DNA DNA - Information flow in the molecule of life AT GATTAT G G A CA CTTCTTT G AAAAATAAT GAT G G A G CTTTA G AA G CT GATAACAAAAATTAT CAA GATTATAAA G CT G A G C CT Gene G ATAAAACAA G C G AT GTATTA G AT GTTACTAAATATAATTCA GT G GTA G ATT GTT G C CATAAA AATTATTCAACATTTACATCT G AAT G GTATATTAAT GAAA G A AAATATAAT GAT GTTC CA G AA G G A C CAAAAAAT GATTAT G G ACA CTTCTTT GAAAAATAAT G AT G G A G CTTTA GAA G CT GAT AACAAAAATTATCAA G ATT Cell Chromosome DNA DNA sequence Protein Livestock, crops, microorganisms Impact of Bioinformatics BecA-ILRI Bioinformatics Platform for eastern and central Africa Bioinformatics is the application of information technology and computer science to the field of molecular biology. Its primary The BecA-ILRI Bioinformatics Platform provides application has been in genomics involving large-scale DNA sequencing. Some areas that have been significantly advanced computational capabilities in bioinformatics to influenced include: all BecA-ILRI scientists and provide training in all aspects of bioinformatics. Crop improvement •Nutritional enhancement The platform provides: •Insect pest resistance access to major sequence databases (USA, EU, etc…) •Molecular breeding access to specialized hardware and sophisticated •Drought tolerance commercial and academic software sophisticated data analysis capabilities Vaccine and diagnostics access to High performance computing services and Livestock diseases grids (CGIAR, EU, USA, etc …) Human diseases Microbial biotechnology Research Institutes Design microorganisms for: Universities Cleaning up waste Alternative energy European Molecular Biology Network Web interface EMBRACE Network of Excellence Current Projects using Bioinformatics platform e-Infrastructure (EELA, GEANT, EGEE) Direct access Advanced Research Institutes (EU, USA) Broadband Internet Crop improvement Broadband Biotechnology applications to combat Cassava Brown Streak Internet Disease Development of genetic fingerprints for groundnut and pigeon pea Fine mapping of Striga resistance in sorghum Marker assisted breeding for drought resistance in sorghum Vaccines and diagnostics Direct access Integrated response system for emerging infectious diseases in Web services East Africa East Coast fever recombinant vaccine development Broadband Contagious bovine pleuropneumonia (CBPP) diagnostic and Internet vaccine development CGIAR – HPC Grid Development of new diagnostic assays and epidemiological ILRI – Kenya (64 CPUs) BecA-ILRI surveillance of viral pathogens of livestock in Africa IRRI – Philippines (16 CPUs) Bioinformatics Bioinformatics capacity building ICRISAT – India (8CPUs) platform CIP – Peru (8 CPUs) ILRI INTERNATIONAL LIVESTOCK RESEARCH INSTITUTE

×