SlideShare a Scribd company logo
1 of 1
Download to read offline
BecA Hub/ILRI Bioinformatics Platform

        What is Bioinformatics?
        Bioinformatics is the application of statistics and computer science to molecular biology. It is a rapidly developing branch of
        Information Technology that seeks to exploit the wealth of DNA and other sequence data that has been generated in the last
        decade. In short, bioinformatics is the key to understanding the molecule of life, DNA.

        Bioinformatics offers tremendous opportunities and has great potential to underpin biotechnological solutions to agricultural
        development constraints.


       DNA - Information flow in the molecule of life
                                                          ATGATTATGGACACTTCTTTGAA
                                                          AAATAATGATGGAGCTTTAGAAG
                                                          CTGATAACAAAAATTATCAAGAT
                                                          TATAAAGCTGAGCCTGATAAAAC
                                                  Gene    AAGCGATGTATTAGATGTTACTA
                                                          AATATAATTCAGTGGTAGATTGT
                                                          TGCCATAAAAATTATTCAACATT
                                                          TACATCTGAATGGTATATTAATG
                                                          AAAGAAAATATAATGATGTTCCA
                                                          GAAGGACCAAAAAATGATTATGG
                                                          ACACTTCTTTGAAAAATAATGAT
                                                          GGAGCTTTAGAAGCTGATAACAA
                                                          AAATTATCAAGATT

       Cell          Chromosome           DNA             DNA sequence              RNA         Protein          Livestock, crops, micro-organisms


         Some of the many projects using the                                               BecA Hub/ILRI Bioinformatics Platform
        BecA Hub/ILRI Bioinformatics Platform
                                                                                     The bioinformatics platform provides advanced
                                                                                     computational capabilities i bi i f
                                                                                            t ti    l     biliti in bioinformatics t all
                                                                                                                              ti to ll
Crop improvement
                                                                                     scientists at the BecA Hub and provides training in all
 Biotechnology applications to combat Cassava Brown Streak
                                                                                     aspects of bioinformatics.
Disease (CBSD)
 Genetic fingerprints for groundnut and pigeon pea                                  The platform provides:
 Fine mapping of Striga resistance in sorghum                                        Access to major sequence databases (USA, EU, etc.)
 Marker-assisted breeding for drought resistance in sorghum                          Access to specialized hardware and sophisticated
                                                                                     commercial and academic software
                                                                                      Sophisticated data analysis capabilities
                                                                                      Access to high performance co put g se ces a d
                                                                                        ccess      g pe o a ce computing services and
                                                                                     grids (CGIAR, EU, USA, etc .)


Vaccines and diagnostics                                                                                              Research Institutes
                                                                                                                         Universities
 Integrated response system for emerging infectious diseases
in East Africa
 East Coast fever (ECF) recombinant vaccine development
 Contagious bovine pleuropneumonia (CBPP) diagnostic and                            European Molecular Biology Network                      Web interface
vaccine development                                                                  EMBRACE Network of Excellence                           Direct access
 Development of new diagnostic assays and epidemiological                           e-Infrastructure (EELA, GEANT, EGEE)
                                                                                     Advanced Research Institutes (EU, USA)                    Broadband
surveillance of viral pathogens of livestock in Africa
                                                                                                                                                 Internet
                                                                                                    Broadband
                                                                                                      Internet




Bioinformatics capacity building
 Training workshops                                                                                                   Direct access
 MSc and PhD student projects                                                                                         Web services
 Online training courses and training materials
                                                                                                                         Broadband
                                                                                                                           Internet
                                                                                     CGIAR – HPC Grid
                                                                                     BecA-ILRI – Kenya (64 CPUs)                           BecA Hub/ILRI
                                                                                     IRRI – Philippines (16 CPUs)                          Bioinformatics
                                                                                     ICRISAT – India (8 CPUs)                                 Platform
                                                                                     CIP – Peru (8 CPUs)

                                                                                    For further information contact:
                                                                                    Dr. Etienne de Villiers (Bioinformatics Group Leader) e.villiers@cgiar.org



                                                                                                                                       ILRI
                                                                                                                           INTERNATIONAL LIVESTOCK RESEARCH INSTITUTE

More Related Content

Viewers also liked

Farmer-participatory research and development for improving feed supply and use
Farmer-participatory research and development for improving feed supply and useFarmer-participatory research and development for improving feed supply and use
Farmer-participatory research and development for improving feed supply and useILRI
 
Dairy Policy inventory – Ethiopia
Dairy Policy inventory – EthiopiaDairy Policy inventory – Ethiopia
Dairy Policy inventory – EthiopiaILRI
 
Resilience: concepts & implications for CG-wide research collaboration
Resilience: concepts & implications for CG-wide research collaborationResilience: concepts & implications for CG-wide research collaboration
Resilience: concepts & implications for CG-wide research collaborationILRI
 
Using stakeholder platforms to enhance local innovations in the livestock sec...
Using stakeholder platforms to enhance local innovations in the livestock sec...Using stakeholder platforms to enhance local innovations in the livestock sec...
Using stakeholder platforms to enhance local innovations in the livestock sec...ILRI
 
Some Reflections on Agricultural Innovation Systems Methodological Framework
Some Reflections on Agricultural Innovation Systems Methodological FrameworkSome Reflections on Agricultural Innovation Systems Methodological Framework
Some Reflections on Agricultural Innovation Systems Methodological FrameworkILRI
 
Shaping a new CGIAR Mega Program on Livestock and Fish
Shaping a new CGIAR Mega Program on Livestock and FishShaping a new CGIAR Mega Program on Livestock and Fish
Shaping a new CGIAR Mega Program on Livestock and FishILRI
 
Designing community based breeding strategies for indigenous sheep breeds of ...
Designing community based breeding strategies for indigenous sheep breeds of ...Designing community based breeding strategies for indigenous sheep breeds of ...
Designing community based breeding strategies for indigenous sheep breeds of ...ILRI
 
IPMS experiences on research for dairy development: Approaches and lessons
IPMS experiences on research for dairy development: Approaches and lessons  IPMS experiences on research for dairy development: Approaches and lessons
IPMS experiences on research for dairy development: Approaches and lessons ILRI
 

Viewers also liked (8)

Farmer-participatory research and development for improving feed supply and use
Farmer-participatory research and development for improving feed supply and useFarmer-participatory research and development for improving feed supply and use
Farmer-participatory research and development for improving feed supply and use
 
Dairy Policy inventory – Ethiopia
Dairy Policy inventory – EthiopiaDairy Policy inventory – Ethiopia
Dairy Policy inventory – Ethiopia
 
Resilience: concepts & implications for CG-wide research collaboration
Resilience: concepts & implications for CG-wide research collaborationResilience: concepts & implications for CG-wide research collaboration
Resilience: concepts & implications for CG-wide research collaboration
 
Using stakeholder platforms to enhance local innovations in the livestock sec...
Using stakeholder platforms to enhance local innovations in the livestock sec...Using stakeholder platforms to enhance local innovations in the livestock sec...
Using stakeholder platforms to enhance local innovations in the livestock sec...
 
Some Reflections on Agricultural Innovation Systems Methodological Framework
Some Reflections on Agricultural Innovation Systems Methodological FrameworkSome Reflections on Agricultural Innovation Systems Methodological Framework
Some Reflections on Agricultural Innovation Systems Methodological Framework
 
Shaping a new CGIAR Mega Program on Livestock and Fish
Shaping a new CGIAR Mega Program on Livestock and FishShaping a new CGIAR Mega Program on Livestock and Fish
Shaping a new CGIAR Mega Program on Livestock and Fish
 
Designing community based breeding strategies for indigenous sheep breeds of ...
Designing community based breeding strategies for indigenous sheep breeds of ...Designing community based breeding strategies for indigenous sheep breeds of ...
Designing community based breeding strategies for indigenous sheep breeds of ...
 
IPMS experiences on research for dairy development: Approaches and lessons
IPMS experiences on research for dairy development: Approaches and lessons  IPMS experiences on research for dairy development: Approaches and lessons
IPMS experiences on research for dairy development: Approaches and lessons
 

Similar to BecA Hub/ILRI Bioinformatics Platform

Bioinformatics platform: Harnessing bioinformatics for food security and sust...
Bioinformatics platform: Harnessing bioinformatics for food security and sust...Bioinformatics platform: Harnessing bioinformatics for food security and sust...
Bioinformatics platform: Harnessing bioinformatics for food security and sust...ILRI
 
e-BioGrid_NBIC Conference 2011 april 20
e-BioGrid_NBIC Conference 2011 april 20e-BioGrid_NBIC Conference 2011 april 20
e-BioGrid_NBIC Conference 2011 april 20INooren
 
BecA-ILRI Hub genomics and bioinformatics platforms
BecA-ILRI Hub genomics and bioinformatics platformsBecA-ILRI Hub genomics and bioinformatics platforms
BecA-ILRI Hub genomics and bioinformatics platformsILRI
 
Software Pipelines: The Good, The Bad and The Ugly
Software Pipelines: The Good, The Bad and The UglySoftware Pipelines: The Good, The Bad and The Ugly
Software Pipelines: The Good, The Bad and The UglyJoão André Carriço
 
Bioinformatics Core at AGERI Present and Future
Bioinformatics Core at AGERI Present and FutureBioinformatics Core at AGERI Present and Future
Bioinformatics Core at AGERI Present and FutureRABNENA Network
 
wolstencroft-ogf20-astro
wolstencroft-ogf20-astrowolstencroft-ogf20-astro
wolstencroft-ogf20-astrowebuploader
 
A Reliable Password-based User Authentication Scheme for Web-based Human Geno...
A Reliable Password-based User Authentication Scheme for Web-based Human Geno...A Reliable Password-based User Authentication Scheme for Web-based Human Geno...
A Reliable Password-based User Authentication Scheme for Web-based Human Geno...Thitichai Sripan
 
BITS: Basics of sequence databases
BITS: Basics of sequence databasesBITS: Basics of sequence databases
BITS: Basics of sequence databasesBITS
 
Dr. Nanyingi Technology Keynote
Dr. Nanyingi Technology KeynoteDr. Nanyingi Technology Keynote
Dr. Nanyingi Technology KeynoteNanyingi Mark
 
VistaMilk Communication Technologies Research
VistaMilk Communication Technologies ResearchVistaMilk Communication Technologies Research
VistaMilk Communication Technologies ResearchWalton Institute
 
Cebit Brochure01 31oct08
Cebit Brochure01 31oct08Cebit Brochure01 31oct08
Cebit Brochure01 31oct08martindudziak
 
Bio Chip Project Report
Bio Chip Project ReportBio Chip Project Report
Bio Chip Project Reportpiyu k
 
SEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSIS
SEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSISSEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSIS
SEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSISIRJET Journal
 
Animal Repellent System for Smart Farming Using AI and Deep Learning
Animal Repellent System for Smart Farming Using AI and Deep LearningAnimal Repellent System for Smart Farming Using AI and Deep Learning
Animal Repellent System for Smart Farming Using AI and Deep LearningIRJET Journal
 
EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...
EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...
EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...Dag Endresen
 
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...Yole Developpement
 
Tim Malthus_Towards standards for the exchange of field spectral datasets
Tim Malthus_Towards standards for the exchange of field spectral datasetsTim Malthus_Towards standards for the exchange of field spectral datasets
Tim Malthus_Towards standards for the exchange of field spectral datasetsTERN Australia
 

Similar to BecA Hub/ILRI Bioinformatics Platform (20)

Bioinformatics platform: Harnessing bioinformatics for food security and sust...
Bioinformatics platform: Harnessing bioinformatics for food security and sust...Bioinformatics platform: Harnessing bioinformatics for food security and sust...
Bioinformatics platform: Harnessing bioinformatics for food security and sust...
 
e-BioGrid_NBIC Conference 2011 april 20
e-BioGrid_NBIC Conference 2011 april 20e-BioGrid_NBIC Conference 2011 april 20
e-BioGrid_NBIC Conference 2011 april 20
 
BecA-ILRI Hub genomics and bioinformatics platforms
BecA-ILRI Hub genomics and bioinformatics platformsBecA-ILRI Hub genomics and bioinformatics platforms
BecA-ILRI Hub genomics and bioinformatics platforms
 
Software Pipelines: The Good, The Bad and The Ugly
Software Pipelines: The Good, The Bad and The UglySoftware Pipelines: The Good, The Bad and The Ugly
Software Pipelines: The Good, The Bad and The Ugly
 
Bioinformatics Core at AGERI Present and Future
Bioinformatics Core at AGERI Present and FutureBioinformatics Core at AGERI Present and Future
Bioinformatics Core at AGERI Present and Future
 
wolstencroft-ogf20-astro
wolstencroft-ogf20-astrowolstencroft-ogf20-astro
wolstencroft-ogf20-astro
 
A Reliable Password-based User Authentication Scheme for Web-based Human Geno...
A Reliable Password-based User Authentication Scheme for Web-based Human Geno...A Reliable Password-based User Authentication Scheme for Web-based Human Geno...
A Reliable Password-based User Authentication Scheme for Web-based Human Geno...
 
NRNB EAC Report 2011
NRNB EAC Report 2011NRNB EAC Report 2011
NRNB EAC Report 2011
 
BITS: Basics of sequence databases
BITS: Basics of sequence databasesBITS: Basics of sequence databases
BITS: Basics of sequence databases
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Dr. Nanyingi Technology Keynote
Dr. Nanyingi Technology KeynoteDr. Nanyingi Technology Keynote
Dr. Nanyingi Technology Keynote
 
VistaMilk Communication Technologies Research
VistaMilk Communication Technologies ResearchVistaMilk Communication Technologies Research
VistaMilk Communication Technologies Research
 
Sinnott Paper
Sinnott PaperSinnott Paper
Sinnott Paper
 
Cebit Brochure01 31oct08
Cebit Brochure01 31oct08Cebit Brochure01 31oct08
Cebit Brochure01 31oct08
 
Bio Chip Project Report
Bio Chip Project ReportBio Chip Project Report
Bio Chip Project Report
 
SEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSIS
SEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSISSEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSIS
SEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSIS
 
Animal Repellent System for Smart Farming Using AI and Deep Learning
Animal Repellent System for Smart Farming Using AI and Deep LearningAnimal Repellent System for Smart Farming Using AI and Deep Learning
Animal Repellent System for Smart Farming Using AI and Deep Learning
 
EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...
EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...
EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...
 
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...
 
Tim Malthus_Towards standards for the exchange of field spectral datasets
Tim Malthus_Towards standards for the exchange of field spectral datasetsTim Malthus_Towards standards for the exchange of field spectral datasets
Tim Malthus_Towards standards for the exchange of field spectral datasets
 

More from ILRI

How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...ILRI
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...ILRI
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...ILRI
 
A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...ILRI
 
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...ILRI
 
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesPreventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesILRI
 
Preventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseasePreventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseaseILRI
 
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistancePreventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistanceILRI
 
Food safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesFood safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesILRI
 
Food safety research LMIC
Food safety research LMICFood safety research LMIC
Food safety research LMICILRI
 
The application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaThe application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaILRI
 
One Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldOne Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldILRI
 
Reservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaReservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaILRI
 
Minyoo ya mbwa
Minyoo ya mbwaMinyoo ya mbwa
Minyoo ya mbwaILRI
 
Parasites in dogs
Parasites in dogsParasites in dogs
Parasites in dogsILRI
 
Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...ILRI
 
Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...ILRI
 
Livestock in the agrifood systems transformation
Livestock in the agrifood systems transformationLivestock in the agrifood systems transformation
Livestock in the agrifood systems transformationILRI
 
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...ILRI
 
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsPractices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsILRI
 

More from ILRI (20)

How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
 
A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...
 
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
 
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesPreventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
 
Preventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseasePreventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne disease
 
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistancePreventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
 
Food safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesFood safety research in low- and middle-income countries
Food safety research in low- and middle-income countries
 
Food safety research LMIC
Food safety research LMICFood safety research LMIC
Food safety research LMIC
 
The application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaThe application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern Africa
 
One Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldOne Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the field
 
Reservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaReservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in Uganda
 
Minyoo ya mbwa
Minyoo ya mbwaMinyoo ya mbwa
Minyoo ya mbwa
 
Parasites in dogs
Parasites in dogsParasites in dogs
Parasites in dogs
 
Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...
 
Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...
 
Livestock in the agrifood systems transformation
Livestock in the agrifood systems transformationLivestock in the agrifood systems transformation
Livestock in the agrifood systems transformation
 
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
 
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsPractices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
 

Recently uploaded

Scanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsScanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsRizwan Syed
 
DevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platformsDevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platformsSergiu Bodiu
 
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek SchlawackFwdays
 
H2O.ai CEO/Founder: Sri Ambati Keynote at Wells Fargo Day
H2O.ai CEO/Founder: Sri Ambati Keynote at Wells Fargo DayH2O.ai CEO/Founder: Sri Ambati Keynote at Wells Fargo Day
H2O.ai CEO/Founder: Sri Ambati Keynote at Wells Fargo DaySri Ambati
 
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024BookNet Canada
 
Search Engine Optimization SEO PDF for 2024.pdf
Search Engine Optimization SEO PDF for 2024.pdfSearch Engine Optimization SEO PDF for 2024.pdf
Search Engine Optimization SEO PDF for 2024.pdfRankYa
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 3652toLead Limited
 
Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Commit University
 
"Debugging python applications inside k8s environment", Andrii Soldatenko
"Debugging python applications inside k8s environment", Andrii Soldatenko"Debugging python applications inside k8s environment", Andrii Soldatenko
"Debugging python applications inside k8s environment", Andrii SoldatenkoFwdays
 
Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024Enterprise Knowledge
 
The Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsThe Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsPixlogix Infotech
 
Advanced Computer Architecture – An Introduction
Advanced Computer Architecture – An IntroductionAdvanced Computer Architecture – An Introduction
Advanced Computer Architecture – An IntroductionDilum Bandara
 
What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024Stephanie Beckett
 
Powerpoint exploring the locations used in television show Time Clash
Powerpoint exploring the locations used in television show Time ClashPowerpoint exploring the locations used in television show Time Clash
Powerpoint exploring the locations used in television show Time Clashcharlottematthew16
 
TeamStation AI System Report LATAM IT Salaries 2024
TeamStation AI System Report LATAM IT Salaries 2024TeamStation AI System Report LATAM IT Salaries 2024
TeamStation AI System Report LATAM IT Salaries 2024Lonnie McRorey
 
Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Mattias Andersson
 
SAP Build Work Zone - Overview L2-L3.pptx
SAP Build Work Zone - Overview L2-L3.pptxSAP Build Work Zone - Overview L2-L3.pptx
SAP Build Work Zone - Overview L2-L3.pptxNavinnSomaal
 
Vertex AI Gemini Prompt Engineering Tips
Vertex AI Gemini Prompt Engineering TipsVertex AI Gemini Prompt Engineering Tips
Vertex AI Gemini Prompt Engineering TipsMiki Katsuragi
 
Story boards and shot lists for my a level piece
Story boards and shot lists for my a level pieceStory boards and shot lists for my a level piece
Story boards and shot lists for my a level piececharlottematthew16
 
DSPy a system for AI to Write Prompts and Do Fine Tuning
DSPy a system for AI to Write Prompts and Do Fine TuningDSPy a system for AI to Write Prompts and Do Fine Tuning
DSPy a system for AI to Write Prompts and Do Fine TuningLars Bell
 

Recently uploaded (20)

Scanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsScanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL Certs
 
DevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platformsDevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platforms
 
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
 
H2O.ai CEO/Founder: Sri Ambati Keynote at Wells Fargo Day
H2O.ai CEO/Founder: Sri Ambati Keynote at Wells Fargo DayH2O.ai CEO/Founder: Sri Ambati Keynote at Wells Fargo Day
H2O.ai CEO/Founder: Sri Ambati Keynote at Wells Fargo Day
 
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
 
Search Engine Optimization SEO PDF for 2024.pdf
Search Engine Optimization SEO PDF for 2024.pdfSearch Engine Optimization SEO PDF for 2024.pdf
Search Engine Optimization SEO PDF for 2024.pdf
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365
 
Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!
 
"Debugging python applications inside k8s environment", Andrii Soldatenko
"Debugging python applications inside k8s environment", Andrii Soldatenko"Debugging python applications inside k8s environment", Andrii Soldatenko
"Debugging python applications inside k8s environment", Andrii Soldatenko
 
Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024
 
The Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsThe Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and Cons
 
Advanced Computer Architecture – An Introduction
Advanced Computer Architecture – An IntroductionAdvanced Computer Architecture – An Introduction
Advanced Computer Architecture – An Introduction
 
What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024
 
Powerpoint exploring the locations used in television show Time Clash
Powerpoint exploring the locations used in television show Time ClashPowerpoint exploring the locations used in television show Time Clash
Powerpoint exploring the locations used in television show Time Clash
 
TeamStation AI System Report LATAM IT Salaries 2024
TeamStation AI System Report LATAM IT Salaries 2024TeamStation AI System Report LATAM IT Salaries 2024
TeamStation AI System Report LATAM IT Salaries 2024
 
Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?
 
SAP Build Work Zone - Overview L2-L3.pptx
SAP Build Work Zone - Overview L2-L3.pptxSAP Build Work Zone - Overview L2-L3.pptx
SAP Build Work Zone - Overview L2-L3.pptx
 
Vertex AI Gemini Prompt Engineering Tips
Vertex AI Gemini Prompt Engineering TipsVertex AI Gemini Prompt Engineering Tips
Vertex AI Gemini Prompt Engineering Tips
 
Story boards and shot lists for my a level piece
Story boards and shot lists for my a level pieceStory boards and shot lists for my a level piece
Story boards and shot lists for my a level piece
 
DSPy a system for AI to Write Prompts and Do Fine Tuning
DSPy a system for AI to Write Prompts and Do Fine TuningDSPy a system for AI to Write Prompts and Do Fine Tuning
DSPy a system for AI to Write Prompts and Do Fine Tuning
 

BecA Hub/ILRI Bioinformatics Platform

  • 1. BecA Hub/ILRI Bioinformatics Platform What is Bioinformatics? Bioinformatics is the application of statistics and computer science to molecular biology. It is a rapidly developing branch of Information Technology that seeks to exploit the wealth of DNA and other sequence data that has been generated in the last decade. In short, bioinformatics is the key to understanding the molecule of life, DNA. Bioinformatics offers tremendous opportunities and has great potential to underpin biotechnological solutions to agricultural development constraints. DNA - Information flow in the molecule of life ATGATTATGGACACTTCTTTGAA AAATAATGATGGAGCTTTAGAAG CTGATAACAAAAATTATCAAGAT TATAAAGCTGAGCCTGATAAAAC Gene AAGCGATGTATTAGATGTTACTA AATATAATTCAGTGGTAGATTGT TGCCATAAAAATTATTCAACATT TACATCTGAATGGTATATTAATG AAAGAAAATATAATGATGTTCCA GAAGGACCAAAAAATGATTATGG ACACTTCTTTGAAAAATAATGAT GGAGCTTTAGAAGCTGATAACAA AAATTATCAAGATT Cell Chromosome DNA DNA sequence RNA Protein Livestock, crops, micro-organisms Some of the many projects using the BecA Hub/ILRI Bioinformatics Platform BecA Hub/ILRI Bioinformatics Platform The bioinformatics platform provides advanced computational capabilities i bi i f t ti l biliti in bioinformatics t all ti to ll Crop improvement scientists at the BecA Hub and provides training in all  Biotechnology applications to combat Cassava Brown Streak aspects of bioinformatics. Disease (CBSD)  Genetic fingerprints for groundnut and pigeon pea The platform provides:  Fine mapping of Striga resistance in sorghum  Access to major sequence databases (USA, EU, etc.)  Marker-assisted breeding for drought resistance in sorghum  Access to specialized hardware and sophisticated commercial and academic software  Sophisticated data analysis capabilities  Access to high performance co put g se ces a d ccess g pe o a ce computing services and grids (CGIAR, EU, USA, etc .) Vaccines and diagnostics Research Institutes Universities  Integrated response system for emerging infectious diseases in East Africa  East Coast fever (ECF) recombinant vaccine development  Contagious bovine pleuropneumonia (CBPP) diagnostic and European Molecular Biology Network Web interface vaccine development EMBRACE Network of Excellence Direct access  Development of new diagnostic assays and epidemiological e-Infrastructure (EELA, GEANT, EGEE) Advanced Research Institutes (EU, USA) Broadband surveillance of viral pathogens of livestock in Africa Internet Broadband Internet Bioinformatics capacity building  Training workshops Direct access  MSc and PhD student projects Web services  Online training courses and training materials Broadband Internet CGIAR – HPC Grid BecA-ILRI – Kenya (64 CPUs) BecA Hub/ILRI IRRI – Philippines (16 CPUs) Bioinformatics ICRISAT – India (8 CPUs) Platform CIP – Peru (8 CPUs) For further information contact: Dr. Etienne de Villiers (Bioinformatics Group Leader) e.villiers@cgiar.org ILRI INTERNATIONAL LIVESTOCK RESEARCH INSTITUTE