Advertisement
BecA Hub/ILRI Bioinformatics Platform
Upcoming SlideShare
BeCA-ILRI Bioinformatics PlatformBeCA-ILRI Bioinformatics Platform
Loading in ... 3
1 of 1
Advertisement

More Related Content

Advertisement

More from ILRI(20)

Recently uploaded(20)

Advertisement

BecA Hub/ILRI Bioinformatics Platform

  1. BecA Hub/ILRI Bioinformatics Platform What is Bioinformatics? Bioinformatics is the application of statistics and computer science to molecular biology. It is a rapidly developing branch of Information Technology that seeks to exploit the wealth of DNA and other sequence data that has been generated in the last decade. In short, bioinformatics is the key to understanding the molecule of life, DNA. Bioinformatics offers tremendous opportunities and has great potential to underpin biotechnological solutions to agricultural development constraints. DNA - Information flow in the molecule of life ATGATTATGGACACTTCTTTGAA AAATAATGATGGAGCTTTAGAAG CTGATAACAAAAATTATCAAGAT TATAAAGCTGAGCCTGATAAAAC Gene AAGCGATGTATTAGATGTTACTA AATATAATTCAGTGGTAGATTGT TGCCATAAAAATTATTCAACATT TACATCTGAATGGTATATTAATG AAAGAAAATATAATGATGTTCCA GAAGGACCAAAAAATGATTATGG ACACTTCTTTGAAAAATAATGAT GGAGCTTTAGAAGCTGATAACAA AAATTATCAAGATT Cell Chromosome DNA DNA sequence RNA Protein Livestock, crops, micro-organisms Some of the many projects using the BecA Hub/ILRI Bioinformatics Platform BecA Hub/ILRI Bioinformatics Platform The bioinformatics platform provides advanced computational capabilities i bi i f t ti l biliti in bioinformatics t all ti to ll Crop improvement scientists at the BecA Hub and provides training in all  Biotechnology applications to combat Cassava Brown Streak aspects of bioinformatics. Disease (CBSD)  Genetic fingerprints for groundnut and pigeon pea The platform provides:  Fine mapping of Striga resistance in sorghum  Access to major sequence databases (USA, EU, etc.)  Marker-assisted breeding for drought resistance in sorghum  Access to specialized hardware and sophisticated commercial and academic software  Sophisticated data analysis capabilities  Access to high performance co put g se ces a d ccess g pe o a ce computing services and grids (CGIAR, EU, USA, etc .) Vaccines and diagnostics Research Institutes Universities  Integrated response system for emerging infectious diseases in East Africa  East Coast fever (ECF) recombinant vaccine development  Contagious bovine pleuropneumonia (CBPP) diagnostic and European Molecular Biology Network Web interface vaccine development EMBRACE Network of Excellence Direct access  Development of new diagnostic assays and epidemiological e-Infrastructure (EELA, GEANT, EGEE) Advanced Research Institutes (EU, USA) Broadband surveillance of viral pathogens of livestock in Africa Internet Broadband Internet Bioinformatics capacity building  Training workshops Direct access  MSc and PhD student projects Web services  Online training courses and training materials Broadband Internet CGIAR – HPC Grid BecA-ILRI – Kenya (64 CPUs) BecA Hub/ILRI IRRI – Philippines (16 CPUs) Bioinformatics ICRISAT – India (8 CPUs) Platform CIP – Peru (8 CPUs) For further information contact: Dr. Etienne de Villiers (Bioinformatics Group Leader) e.villiers@cgiar.org ILRI INTERNATIONAL LIVESTOCK RESEARCH INSTITUTE
Advertisement