METU-Plant Mol Biol & Gen
Middle East Technical University
Mahinur S. Akkaya
akkayams@metu.edu.tr
METU-Plant Mol Biol & Gen
Effector-triggered immunity
Catanzariti et al. 2007
2nd
International Stripe Rust Symposium Izmi...
Predicted secreted effectors of cDNA library of Pst haustoria (Yin et al., 2009)
METU-Plant Mol Biol & Gen
2nd
Internation...
Pstha2a5 gene motif region
MEME Suite GLAM2 of putative and predicted effector candidates
METU-Plant Mol Biol & Gen
2nd
In...
Pstha2a5 gene synthesis and pJL48-TRBO cloning
PCR
METU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir...
METU-Plant Mol Biol & Gen
Interacting host proteins
Tagged protein co-immunoprecipitation
METU-Plant Mol Biol & Gen
PstHa2a5 interacts with Ta-Glox
METU-Plant Mol Biol & Gen
PstHa2a5 facilitates ETS
Pieterse et al. 2009
METU-Plant Mol Biol & Gen
METU-Plant Mol Biol & Gen
Subcellular localization
PCR
Flag-Tag Linker
CACCATGGACTACAAGGACGACGATGACAAAGTCAAGCTTCTCGAGAATTC...
METU-Plant Mol Biol & Gen
Gateway cloning
METU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir, 28 Apri...
METU-Plant Mol Biol & Gen
GFP & RFP expression
GFP and FLAG-RFP expression in Nicotiana benthamiana, 3-day post infiltrati...
Subcellular localizations
Subcellular localization studies can assist in determining the classification of a particular pr...
Predicted secreted effectors of cDNA library of Pst haustoria (Yin et al., 2009)
METU-Plant Mol Biol & Gen
2nd
Internation...
METU-Plant Mol Biol & Gen
Subcellular localization of PstHa12h2
for their growth and optimization of these conditions is v...
METU-Plant Mol Biol & Gen
pEDV6: Effector detector vector
pEDV6 (Effector Detector Vector) is a Gateway
destination vector...
METU-Plant Mol Biol & Gen
Avr?
Figure 3.15 Photos of HR symptoms on infiltrated wheat line, Siete Cerros T66. (a)
Infiltra...
METU-Plant Mol Biol & Gen
Pst-78:Determination of candidate effector proteins
• PST-78 (gene, protein and transcript) sequ...
METU-Plant Mol Biol & Gen
22 are identified as a specific type of effectors
METU-Plant Mol Biol & Gen
2nd
International St...
Function
METU-Plant Mol Biol & GenMETU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May ...
• Bayantes Dagvadorj
• Ahmet Çağlar Özketen
• Ayşe Andaç
• Kübra Narcı
• Burak Demıralay
• Osman Tolga BOZKURT (former PhD...
Upcoming SlideShare
Loading in …5
×

2nd stripe rust izmir

668 views

Published on

Published in: Business, Technology, Education
  • Be the first to comment

  • Be the first to like this

2nd stripe rust izmir

  1. 1. METU-Plant Mol Biol & Gen Middle East Technical University Mahinur S. Akkaya akkayams@metu.edu.tr
  2. 2. METU-Plant Mol Biol & Gen Effector-triggered immunity Catanzariti et al. 2007 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014
  3. 3. Predicted secreted effectors of cDNA library of Pst haustoria (Yin et al., 2009) METU-Plant Mol Biol & Gen 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014
  4. 4. Pstha2a5 gene motif region MEME Suite GLAM2 of putative and predicted effector candidates METU-Plant Mol Biol & Gen 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014
  5. 5. Pstha2a5 gene synthesis and pJL48-TRBO cloning PCR METU-Plant Mol Biol & Gen 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014
  6. 6. METU-Plant Mol Biol & Gen Interacting host proteins Tagged protein co-immunoprecipitation METU-Plant Mol Biol & Gen
  7. 7. PstHa2a5 interacts with Ta-Glox METU-Plant Mol Biol & Gen
  8. 8. PstHa2a5 facilitates ETS Pieterse et al. 2009 METU-Plant Mol Biol & Gen
  9. 9. METU-Plant Mol Biol & Gen Subcellular localization PCR Flag-Tag Linker CACCATGGACTACAAGGACGACGATGACAAAGTCAAGCTTCTCGAGAATTCCttcaagtgtcccggtttgcatggaacgccaagcc aaacacatggttattgcaccagatcaatcaccgatgaagaacgaaaggcaaaaaagattggcaaggagttcaccatgtggaaggaa gaaatcaagacagtcgacgggaaattctcgtgtgataaagtggacttgaatgggtcggttgccacagatagcttctgttgtgacgt tgcaggtagaattggtgaagttgagaaaagtaaacaagctatgtggacaaacaactgctccaaagcatcttag METU-Plant Mol Biol & Gen 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014
  10. 10. METU-Plant Mol Biol & Gen Gateway cloning METU-Plant Mol Biol & Gen 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014
  11. 11. METU-Plant Mol Biol & Gen GFP & RFP expression GFP and FLAG-RFP expression in Nicotiana benthamiana, 3-day post infiltration. In picture A and B, leaves infiltrated with Agrobacterium containing pJL48-TRBO-GFP were shot under GFP fluorescence filter at 40X and 10X magnifications, respectively. Pictures D and E were taken using RFP fluorescence filter, and leaf infiltrated with Agrobacterium with pJL48-TRBO-FLAG-RFP was shot under 40X and 10X magnifications, respectively. In controls, non-infiltrated (normal) leaf was shot in picture C and F under GFP and RFP fluorescence filter, respectively, at 40 X magnifications. METU-Plant Mol Biol & Gen
  12. 12. Subcellular localizations Subcellular localization studies can assist in determining the classification of a particular protein and it can give more information about its possible function. 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014
  13. 13. Predicted secreted effectors of cDNA library of Pst haustoria (Yin et al., 2009) METU-Plant Mol Biol & Gen 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014
  14. 14. METU-Plant Mol Biol & Gen Subcellular localization of PstHa12h2 for their growth and optimization of these conditions is very hard. For visualizaton, two days post inoculation leaves were cut from infiltration sites and they were analyzed with light microscope and confocal microscope which is shown in Figure 3.6. Figure 3.6 Imaging of Pstha12h2 effector protein subcellular localization in Nicotiana benthamiana. In this part, imaging was performed with 2 dpi leaves samples magnification. Subcellular localization was detected by GFP tagged transiently protein expression encoded by PstHa12h2. A) and B) Observation was conducted by light microscope (Leica, DFC 280) with GFP filter in 40X magnification. C) 40 X magnification with GFP filter of confocal microscope (Zeiss, LSM 500) was used for imaging. D) Non-infiltrated leaf was analyzed at 40 X magnification of light microscope with GFP filter. B D A C METU-Plant Mol Biol & Gen 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014
  15. 15. METU-Plant Mol Biol & Gen pEDV6: Effector detector vector pEDV6 (Effector Detector Vector) is a Gateway destination vector which is designed for delivering bacterial effectors to the wheat by using TTSS of Pseudomonas to activate plant defense system. METU-Plant Mol Biol & Gen 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014
  16. 16. METU-Plant Mol Biol & Gen Avr? Figure 3.15 Photos of HR symptoms on infiltrated wheat line, Siete Cerros T66. (a) Infiltrated primary leaf sample (b) Secondary leaf of the same leaf sample (c) Control (MgCl2 infiltration) 3.4. Cloning into pK7FWG2 expression vector (a) (b) (c) PstHa15N21 / Siete Cerros METU-Plant Mol Biol & Gen 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014
  17. 17. METU-Plant Mol Biol & Gen Pst-78:Determination of candidate effector proteins • PST-78 (gene, protein and transcript) sequences downloaded from Broad Institute • 20482 protein and 19542 gene in total are investigated • Filtration of big proteins ( >150 a.a) • SignalP analysis to select secreted proteins • Cysteine count to first-rate Cyc rich proteins • Multiple motif search • The proteins are proved not to share any sequence similarity to known proteins through BLAST • Besides the motifs, high sequence similarity between the proteins are found METU-Plant Mol Biol & Gen 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014
  18. 18. METU-Plant Mol Biol & Gen 22 are identified as a specific type of effectors METU-Plant Mol Biol & Gen 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014
  19. 19. Function METU-Plant Mol Biol & GenMETU-Plant Mol Biol & Gen 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014
  20. 20. • Bayantes Dagvadorj • Ahmet Çağlar Özketen • Ayşe Andaç • Kübra Narcı • Burak Demıralay • Osman Tolga BOZKURT (former PhD student) Sainsbury Lab • Hasan Ogul Baskent University, Computer Science • Tolga Can METU, Computer Science • Dr. Xianming CHEN • Lesley BOYD • Mogens Hovmoller METU-Plant Mol Biol & Gen ACKNOWLEDGEMENT Supported by •DPT •ICGEB •TUBITAK 2nd International Stripe Rust Symposium Izmir, 28 April-1 May 2014

×