ICIC 2013 New Product Introductions GenomeQuest

935 views

Published on

Published in: Technology
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
935
On SlideShare
0
From Embeds
0
Number of Embeds
331
Actions
Shares
0
Downloads
10
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

ICIC 2013 New Product Introductions GenomeQuest

  1. 1. Henk Heus, Ph.D. IP SEQUENCE SEARCH
  2. 2. THE QUESTION AND THE ANSWER CCCCGATCCTGGGGCAGAGGCGGCCTCTGGATCAT ACATATG 5 granted patents with a sequence mentioned in the claims with over 70% identity to the query
  3. 3. HOW IT WAS DONE
  4. 4. HOW IT WAS DONE
  5. 5. PRODUCT OVERVIEW  GQ-Pat database coverage / / / / ST.25 listings and sequences in text, tables, and figures 217 million sequences 437 thousand documents in 182 thousand INPADOC families 25 authorities US, CN, WO, EP, KR, JP, IN, CA, etc.  Easy to use web interface Multiple sequence search algorithms (genePAST) Result filtering capabilities Word and Excel exports Automated search alerts Result sharing within your team  Used by almost all big pharma and ag companies worldwide     

×