buku soal olimpiade biologi tingkat nasional edisi-?

20,737 views

Published on

olimpiade biologi

Published in: Education
1 Comment
24 Likes
Statistics
Notes
No Downloads
Views
Total views
20,737
On SlideShare
0
From Embeds
0
Number of Embeds
5
Actions
Shares
0
Downloads
2,318
Comments
1
Likes
24
Embeds 0
No embeds

No notes for slide

buku soal olimpiade biologi tingkat nasional edisi-?

  1. 1. International Biology Olympiad Soal dan Pembahasan Buku ini diterbitkan oleh Tim Olimpiade Biologi Indonesia ISBN 979-3585-02-6 UNDANG-UNDANG REPUBLIK INDONESIA NOMOR 19 TAHUN 2002 TENTANG HAK CIPTA PASAL 72 KETENTUAN PIDANA SANKSI PELANGGARAN 1. Barangsiapa dengan sengaja dan tanpa hak mengumumkan atau memperbanyak suatu Ciptaan atau memberikan izin untuk itu, dipidana dengan pidana penjara paling singkat 1 (satu) bulan dan / atau denda paling sedikit Rp. 1.000.000,00,-. (satu juta rupiah) atau pidana penjara paling lama 7 (tujuh) tahun dan / atau dendan paling banyak Rp. 5.000.000.000,00 (lima miliar rupiah) 2. Barangsiapa dengan sengaja menyerahkan, menyiarkan, memamerkan, mengedarkan, atau menjual kepada umum suatu Ciptaan atau barang hasil pelanggaran Hak Cipta atau Hak Terkait sebagaimana dimaksud pada ayat (1), dipidana dengan penjara paling lama lima (5) tahun dan/atau denda paling banyak Rp. 500.000.000,00,-. (lima ratus juta rupiah) Repro oleh ........................... Dicetak oleh ............................ C HAK CIPTA DILINDUNGI OLEH UNDANG-UNDANG TIM OLIMPIADE BIOLOGI INDONESIA Agus D. Permana, A. Faizal, C. Yanto, I.B.Md. Artadana
  2. 2. Daftar Isi KATA PENGANTAR i PROBLEM SET I Biologi Sel Molekuler, Mikrobiologi & Bioteknologi Morfologi, Anatomi dan Fisiologi Tumbuhan 5 Morfologi, Anatomi dan Fisiologi Hewan 9 Etologi 14 Genetika dan Evolusi 15 Ekologi 17 Biosistematik 19 LEMBAR JAWABAN 21 KUNCI DAN PEMBAHASAN Biologi Sel Molekuler, Mikrobiologi & Bioteknologi Morfologi, Anatomi dan Fisiologi Tumbuhan 28 Morfologi, Anatomi dan Fisiologi Hewan 30 Etologi 33 Genetika dan Evolusi 33 Ekologi 35 Biosistematik 36 PROBLEM SET II Biologi Sel Molekuler, Mikrobiologi & Bioteknologi Morfologi, Anatomi dan Fisiologi Tumbuhan 42 Morfologi, Anatomi dan Fisiologi Hewan 44 Etologi 49 Genetika dan Evolusi 51 Ekologi 53 Biosistematik 56 LEMBAR JAWABAN 59 KUNCI DAN PEMBAHASAN Biologi Sel Molekuler, Mikrobiologi & Bioteknologi Morfologi, Anatomi dan Fisiologi Tumbuhan 65 Morfologi, Anatomi dan Fisiologi Hewan 67 Etologi 70 Genetika dan Evolusi 71 Ekologi 72 Biosistematik 74 1 24 38 63
  3. 3. PROBLEM SET I BIOLOGI SEL MOLEKULER, MIKROBIOLOGI & BIOTEKNOLOGI 1. Seorang ilmuwan melakukan percobaan untuk memisahkan membran dalam mitokondria dari mitokondria. Setelah membran dalam terpisah, membran dalam tersebut kemudian diberikan perlakuan tertentu sehingga F1 dari ATP sintetasenya rusak. Dari semua proses berikut: 1. Oksidasi NADH 2. Produksi H2O dari O2 3. Terbentuknya gradien proton 4. Fosforilasi ADP Manakah yang tidak akan terjadi akibat perlakuan tersebut? A. 1,2,3,4 B. 2, 4 C. 1,3, 2 D. 4 saja E. 3 saja 2. Sel di dalam tubuh yang tidak dapat memanfaatkan senyawa keton sebagai sumber energinya adalah...... A. sel darah putih B. sel-sel penyusun hati C. sel-sel di otak D. sel darah merah E. sel penyusun otot. 3. Polisistronik adalah suatu istilah yang dipergunakan untuk menyatakan hasil dari satu proses trankripsi yang hasil transkripsinya terdiri atas beberapa gen. Sebagian besar transkripsi yang bersifat polisistronik ini terdapat pada prokariot, namun beberapa prokariot memiliki hasil transkripsi yang bersifat polisistronik. Berikut yang merupakan hasil trankripsi yang bersifat polisistronik pada eukariot adalah........ A. Hasil transkripsi dari gen-gen yang mengkode protein ribosom B. Hasil transkripsi dari gen-gen yang mengkode protein histon C. Hasil transkripsi dari gen-gen yang mengkode rRNA D. Hasil transkripsi dari gen-gen yang mengkode protein integral E. Hasil transkripsi dari gen-gen yang mengkode haemoglobin 4. Suatu kultur bakteri diawali dengan 4 sel bakteri per ml pada medium pengaya dengan fase lag 1 jam dan waktu generasi 20 menit. Berapa banyaknya sel yang ada pada 1 liter kultur ini: a. setelah 1 jam? b. setelah 2 jam? c. setelah 2 jam bila 0.25% sel awal mati? 1
  4. 4. 4. Anda mengambil suatu kultur mikroba dan memfraksinasinya menjadi beberapa komponen. Salah satu komponen mengandung molekul berikut ini: asam asetilmuramat, asetilglukosamin, berbagai L dan D asam amino, dan asam teichoat maupun asam lipoteichoat. Komponen ini merupakan : A. Dinding sel suatu bakteri gram positif B. Glikogen C. Dinding sel suatu bakteri gram negatif D. Membran sitoplasma E. Dinding sel suatu ragi 6. Atenuasi merupakan salah satu proses pengaturan pada Trp operon dari bakteri. Sistem ini diatur pada Trp E dari Trp operon. Trp E merupakan gen paling awal (upstream) dari Trp operon. Trp E ini ditanskripsi baik ketika ada triptofan maupun tidak. Ketika ada triptofan maka Trp E yang telah ditranskripsi selanjutnya akan ditranslasi oleh ribosom, akibatnya akan terbentuk terminasi trankripsi sehingga gen-gen lain dari Trp operon tidak di transkripsi. Tapi apabila tidak terdapat triptofan, maka ribosom akan berhenti pada kodon yang mengkode triptofan. Akibatnya translasi dari Trp E akan terhenti dan proses trankripsi dapat dilanjutkan sampai akhir (semua gen pada Trp operon di transkripsi). Berdasarkan keterangan tersebut, maka pernyataan manakah yang salah mengenai sistem atenuasi dan Trp Operon? A. Proses atenuasi terjadi di dalam sitoplasma B. Karena ribosom terhenti pada Trp E maka gen-gen lain dari Trp operon baru akan di translasi apabila terdapat triptofan didalam sitoplasma. C. Hasil transkripsi dari Trp operon bersifat polisistronik. D. Atenuasi berfungsi untuk mencegah diproduksinya enzim yang mensintesis triptofan ketika kadar triptofan didalam sel sangat banyak E. Semua jawaban diatas adalah benar. 7. Untuk membuktikan bahwa proses pembelahan sel dipengaruhi oleh siklus keberadaan protein didalam sel maka dua orang ilmuwan melakukan fusi 2 sel dari fase yang berbeda. Isilah B untuk eksperiment yang menurut anda hasilnya benar dan S untuk eksperimen yang hasilnya salah. 8. Suatu instalasi pengolahan limbah membersihkan air limbah menggunakan tiga tingkatan perlakuan untuk mendaur ulang air secara sempurna. Selama penentuan BOD, pengukuran kandungan oksigen diperoleh sebagai berikut: o Asumsikan bahwa pada suhu 20 C, kandungan oksigen dari air murni yang jenuh dengan oksigen adalah 10 mg/L. Berapa persen penurunan pada BOD relative terhadap sampel tanpa perlakuan setelah: a. Perlakuan primer? b. Perlakuan sekunder? c. Suatu tes coliform dilakukan pada perlakuan tersier. Mengapa? (Tulis jawaban anda dengan singkat dan jelas) 2
  5. 5. 9. Seorang teman sekelas Anda memberikan suatu plasmid untuk ekspresi gen yang mengkode monooksigenase pada E. coli. Gen tersebut diklon pada bagian hilir promoter PR lamda. Plasmid yang sama juga membawa gen yang mengkode o repressor lamda peka temperatur (repressor aktif pada suhu 30 C, inaktif pada o 42 C) yang terletak di sebelah hilir suatu promoter konstitutif. Asumsikan bahwa pertumbuhan E. coli diperlambat oleh ekspresi metana monooksigenase. Jawablah pertanyaan dibawah ini dengan jawaban yang singkat dan tepat a. Bagaimanakah ekspresi metana monooksigenase dapat dicegah selama pertumbuhan sel? b. Bagaimanakah ekspresi gen yang mengkode metana monooksigenase dapat diinduksi? c. Aktivitas enzimatik dari metana monooksigenase dapat secara langsung diukur. Dua substrat apakah yang terdapat pada reaksi tersebut? d. Produk apakah yang mengandung karbon? e. Bagaimanakah radioisotop dapat dimanfaatkan untuk mengukur aktivitas metana monooksigenase? (Jawaban tidak lebih dari satu kalimat) f. Tipe organisme heterotrofik apakah yang diharapkan memiliki sumber gen asal yang mengkode methane monooksigenase? Tentukan secara spesifik! 10. Suatu cara yang mudah untuk mengisolasi spesies Bacillus dan Clostridium secara spesifik dari tanah adalah dengan: A. Menumbuhkannya secara aerobik pada medium yang mengandung glukosa B. Menumbuhkannya pada suhu tinggi C. Memanaskan tanah untuk membunuh semua sel vegetatif dan kemudian memungkinkan semua spora dari organisme ini untuk “berkecambah” dan tumbuh D. Menumbuhkannya pada suhu sangat rendah E. Menumbuhkannya secara anaerobik pada medium yang mengandung glukosa Pertanyaan 11 - 17 Virus flu burung merupakan virus RNA (bukan retrovirus) yang dapat menyerang burung dan mamalia. Genom virus ini terdiri dari 8 molekul RNA, dimana masing-masing mengandung gen yang berbeda. Perbanyakan virus tersebut dapat dilihat di gambar di bawah ini: Pada permukaan virus terdapat tonjolan protein neuraminidase (N) dan hemaglutinin (H). Ada 9 tipe N dan 15 tipe H. Virus flu burung yang menyebar dari Asia ke Eropa pada tahun 2005 termasuk tipe H5N1. Manusia umumnya terserang virus flu H1N1 dan H3N2. H berperan dalam pengikatan virus ke permukaan sel. Di bawah ini ditunjukkan gambar permukaan virus flu burung: 3
  6. 6. 12. Pada gambar permukaan virus flu burung terlihat A. Struktur primer suatu protein B. Struktur sekunder suatu protein C. Struktur tersier saja dari suatu protein D. Struktur tersier dan kwaterner dari suatu protein 13.Perbedaan antara virus flu burung H5N1 hasil replikasi pada anak yang kurus dengan H5N1 hasil replikasi pada ayam di peternakan terletak di: A. Komposisi lipid virus B. Macam-macam molekul RNA C. Komposisi protein kapsid D. tipe hemaglutinin 14. Orang sakit flu diberi antibiotik untuk: A. menghambat perkembangbiakan virus flu B. menghambat infeksi sekunder oleh bakteri C. meningkatkan fungsi sistem imun pasien D. menghambat pertumbuhan sel yang diserang virus 15. Bahan di bawah ini dapat dijadikan vaksin terhadap flu, KECUALI: A. virus yang dimatikan B. protein hemaglutinin C. Peptida yang merupakan bagian dari neuroaminidase. D. RNA virus 16. Virus flu menyerang sel-sel saluran pernafasan atas dan tidak menyerang sel-sel yang lain karena: A. sel lain tidak mempunyai reseptor untuk virus flu B. virus lebih mudah untuk masuk ke dalam tubuh melalui saluran pernaasan C. hanya saluran pernafasan yang mempunyai komponen-komponen yang diperlukan untuk replikasi virus D. virus lebih mudah untuk keluar tubuh lewat saluran pernafasan 4
  7. 7. 17. Bila seseorang yang sakit flu akibat virus tipe H3N2 terserang flu burung H5N1, maka virus tipe di bawah ini dapat muncul, KECUALI: A. H3N1 B. H2N3 C. H5N2 D. H5N1 18. Berikut ini yang merupakan komponen yang tidak diperlukan dalam proses replikasi DNA secara in vivo adalah.... A. DNA polimerase B. dAMP, dTMP, dCMP, dGMP C. RNA polimerase (primase) D. DNA templat E. Protein yang mencegah bergabungnya dua rantai induk pada saat replikasi. 19. Diketahui bahwa suatu mRNA memiliki urutan basa sebagai berikut 5'AACGGUUUUAUGGAUAAACAA...(45 basa)...GGGAUGCGGAGAUAAGAAUUU3' Dari keterangan di atas, hasil translasi dari mRNA tersebut adalah...... A. Rantai polipeptida dengan 29 asam amino B. Rantai polipeptida dengan 28 ikatan peptida C. Rantai polipeptida dengan 23 asam amino D. Rantai polipeptida dengan 23 ikatan peptida E. Oligopeptida dengan 3 asam amino. 20. Semua fenomena sel di bawah ini melibatkan aktivitas dari filamen aktin, kecuali ... A. Pergerakan amuba B. Aliran sitoplasma C. Sitokinesis D. Kontraksi otot E. Pergerakan flagel pada bakteri MORFOLOGI, ANATOMI DAN FISIOLOGI TUMBUHAN Perhatikan bagan berikut untuk menjawab pertanyaan nomor 1-2 5
  8. 8. 1. Jalur metabolisme yang digambarkan pada bagan di atas adalah ... A. Siklus asam trikarboksilat B. Siklus asam sitrat C. Siklus Krebs D. Siklus Calvin E. Siklus PEP karboksilase 2. Energi dalam bentuk ATP digunakan pada tahap ... A. 1 dan 2 B. 2 dan 3 C. 2 dan 4 D. 3 dan 4 E. 1, 2, dan 3 3. Unsur/nutrien yang berperan penting dalam pengikatan dengan cincin porfirin pada klorofil a adalah ... A. Besi (Fe) D. Tembaga (Cu) B. Kalium (K) E. Seng (Zn) C. Magnesium (Mg) 4. Hormon tumbuhan yang berperan dalam proses dormansi biji adalah... A. Auksin D. Sitokinin B. Giberelin E. Etilen C. Sitokinin 5. Vitamin yang larut dalam air, berperan sebagai koenzim dalam metabolisme asam nukleat serta ditemukan pada sayur-sayuran dan biji-bijian adalah... A. Vitamin B6 B. Niasin C. Asam folat D. Vitamin A E. Asam askorbat 6. Pernyataan yang manakah yang tidak benar dalam menggambarkan fotosintesis yang terjadi pada tanaman C4 ? A. Hasil pertama dari fiksasi CO2 adalah senyawa dengan 4 atom karbon B. Fotosintesis untuk tanaman C4 teradaptasi untuk tumbuh pada tempat yang panas dan iklim yang kering C. CO2 difiksasi di sel mesofil, akan tetapi siklus Calvin terjadi pada seludang pembuluh D. ATP yang digunakan untuk sintesis gula lebih sedikit dibandingkan dengan tanaman C3 E. Fotorespirasi pada tanaman C4 lebih sedikit dibandingkan dengan tanaman C3 7. Fungsi dari lentisel dan pneumatofor pada tanaman adalah ... A. Absorpsi nutrisi terutama dalam bentuik senyawa nitrat dan fosfat B. Menancapkan tanaman ke tanah (pengokoh) C. Untuk pertukaran gas, seringkali pada tanaman dengan akar yang terendam air D. Berperan dalam menjaga tekanan hidrostatik akar untuk menciptakan kondisi yang tepat untuk konduksi gula dalam floem E. Berperan dalam membentuk asosiasi mikoriza dengan bakteri dan jamur 6
  9. 9. 8. Pada batang tumbuhan dikotil, jaringan yang berbatasan langsung dengan korteks adalah ... A. Floem primer B. Xilem primer C. Floem sekunder D. Xilem sekunder E. Kambium pembuluh 9. Jaringan yang mempunyai karakteristik berupa sel mati pada keadaan dewasa serta memiliki dinding sekuder yang kaku adalah ... A. parenkim B. kolenkim C. sklerenkim D. parenkim dan kolenkim E. skelerenkim dan kolenkim 10. Pernyataan tentang vakoula yang benar di bawah ini adalah i. Hanya ditemukan pada sel tumbuhan, dan tidak pada sel hewan ii. Pada sel tumbuhan, vakuola dikelilingi oleh membran yang disebut tonoplas iii. Merupakan tempat penyimpanan asam amino, terutama untuk sel yang sedang tumbuh iv. Air masuk ke vakuola berdasarkan gradien potensial air untuk membantu mempertahankan turgiditas v. Pada sel tanaman, vakuola mempunyai proporsi dan ukuran yang konstan di dalam sel A. i & iii B. ii & v C. iii & iv D. i & iv E. ii & iv 11. Pada lapisan manakah serangga dari famili Aphididae mendapat makanan dari batang pohon tanaman muda? A. Kambium B. Lapisan sebelah luar dari kambium C. Lapisan sebelah dalam dari kambium D. Lapisan berbeda yang tergantung dari umur tanamannya E. Lapisan berbeda tergantung umur dan tahap perkembangan serangga 12. Sel hidup dari tanaman yang tidak dapat ditumbuhkan di medium kultur jaringan adalah ... A. Sel pengantar D. Polen B. Parenkim E. Sel sklereid C. Pembuluh tapis 13. Generasi yang dominan dalam siklus hidup lumut, paku, Gymnospermae dan Angiospermae adalah: A. Gametofit, gametofit, sporofit, sporofit B. Gametofit, sporofit, sporofit, sporofit C. Gametofit, gametofit, gametofit, sporofit D. Gametofit merupakan generasi yang dominan untuk semuanya E. Sporofit merupakan generasi yang dominan untuk semuanya 7
  10. 10. 14. Perhatikan gambar berikut ini Pernyataan yang paling tepat untuk menggambarkan jaringan tersebut adalah A. Sel-selnya hidup dengan dinding sel yang tipis B. Sel-selnya hidup, dinding sel mengalami penebalan primer C. Sel-selnya mati, dinding sel mengalami penebalan primer D. Sel-selnya mati dinding sel mengalami penebalan sekunder E. Semua jawaban salah 15. Perhatikan struktur organ berikut! Semua pernyataan berikut ini menggambarkan organ tersebut, kecuali ... A. B. C. D. E. Berasal dari tumbuhan Gymnospermae Mempunyai struktur sekresi yang terbentuk secara schizogen Teradaptasi pada lingkungan yang xerofit Mempunyai suatu struktur yang juga dapat ditemukan pada akar Mempunyai struktur sekresi yang terbentuk secara lisigen 8
  11. 11. MORFOLOGI, ANATOMI DAN FISIOLOGI HEWAN Untuk soal no.1, 2 dan no. 3 : Sel otot rangka dapat dibagi menjadi berapa jenis antara lain: A. Serabut otot tonik: kontraksinya perlahan, tidak memproduksi AP, beberapa serabut otot mendapat multisinaps dari satu neuron motoris, turn over miosin ATP-asenya rendah. B. Serabut fasik lambat: kontraksi lambat, kelelahan (fatique) lambat, memproduksi AP, memiliki banyak mitokondria dan turn over miosin ATP-asenya rendah. C. Serabut fasik cepat glikolitik: Kontraksi cepat, kelelahan cepat, turn over ATP-ase tinggi, Jumlah mitokondria didalam sel rendah. D. Serabut fasik cepat oksidasi: kontraksi cepat, kelelahan lambat, jumlah mitokondria banyak. 1. Berdasarkan keterangan diatas cocokkanlah pernyataan dibawah ini dengan jenis otot yang ada pada keterangan diatas. a. Otot yang berperan dalam menjaga postur tubuh ...... b. Otot yang dominan pada seorang pelari maraton ...... c. Serabut otot yang paling cepat memproduksi asam laktat ........ 2. Dari keterangan diatas, kesimpulan berikut dapat diambil, kecuali........ A. Kecepatan kontraksi otot ditentukan oleh turn over dari miosin ATPasenya. B. Cepat-tidaknya suatu otot mengalami kelelahan ditentukan oleh jumlah mitokondria di dalam serabut otot. C. Pada saat kontraksi yang berulang, terjadi. Serabut tipe C dan D mengkonsumsi oksigen dalam jumlah yang sama. D. Serabut A kemungkinan besar berperan dalam menjaga postur tubuh E. Serabut B kemungkinan besar berperan dalam menjaga postur tubuh. 3. Apabila pada satu kali kontraksi, hanya 2/3 dari energi yang dipergunakan oleh otot tipe C diproduksi oleh mitokondria. Tentukanlah jumlah asam laktat yang terbentuk pada 10 kontraksi berturut-turut, jika energi yang diperlukan untuk sekali kontraksi adalah 798 kcl. (hidrolisis ATP menjadi ADP melepaskan 7 kcl)! 4. Testosteron merupakan hormon yang dibentuk dari kolesterol. Karena kolesterol merupakan senyawa yang tidak larut dalam air maka hormon testosteron juga tidak larut dalam air. Meskipun tidak larut dalam air, akan tetapi testosteron sangat larut di dalam lemak. Berdasarkan sifat tersebut, manakah pernyataan yang tepat mengenai testosteron? A. Karena testosteron larut dalam lemak, maka testosteron dapat dengan mudah masuk ke dalam sel sehingga dalam proses kerjanya tidak memerlukan second messenger. B. Karena tidak larut dalam air, maka hormon testosteron tidak dapat diangkut di dalam darah. C. Karena membran sel adalah lemak dan testosteron larut dalam lemak, maka reseptor steroid ada di dalam membran sel D. Karena tidak larut dalam air, maka agar dapat diedarkan di dalam darah hormon ini harus berikatan dengan protein yang berada di dalam darah. E. Jawaban A dan D benar. 9
  12. 12. 5. Inulin merupakan senyawa karbohidrat dengan rantai yang pendek. Senyawa ini dapat difiltrasi oleh ginjal dan tidak direabsorbsi di tubulus ginjal. Untuk mengetahui laju pembuangan suatu senyawa dari plasma darah dipergunakan rumus: VU/CP=1, sedangkan untuk mengukur laju filtrasi suatu senyawa yang tidak direabsorbsi dipergunakan rumus VU/(GFR)P = 1 dengan: V = volume urin/menit U = konsentrasi senyawa x dalam urin P = konsentrasi substansi x dalam plasma (GFR) = laju viltrasi dari plasma C = jumlah senyawa x yang dikeluarkan dari plasma darah per menit. Jika laju filtrasi plasma darah adalah 150 ml per menit dan konsentrasi inulin dalam plasma darah adalah 0,2 mg/ 10 ml darah. Tentukanlah jumlah inulin yang dikeluarkan dari plasma darah setiap menitnya? 6. Jika laju filtrasi darah adalah 150 ml per menit, dengan konsetrasi glukosa adalah 100mg/100ml darah, dan jumlah glukosa dalam urin adalah 20 mg/menit. Tentukanlah : a. Jumlah glukosa yang dikeluarkan dari plasma darah tiap menit! b. Jumlah glukosa yang direabsorbsi tiap menit! 7. Stroke volume merupakan jumlah darah yang dikeluarkan oleh salah satu bilik jantung pada satu kali siklus kontraksi. Besarnya stroke volume ditentukan oleh 2 faktor yaitu volume ventrikel sesaat sebelum kontraksi dan volume ventrikel sesaat setelah kontraksi. Berdasarkan informasi tersebut maka pernyataan berikut yang tepat adalah...... A. Orang yang memiliki detak jantung yang lebih cepat memiliki stroke volume yang lebih tinggi dari orang dengan detak jantung yang lambat. B. Dengan kekuatan kontraksi yang sama maka orang dengan diameter aorta yang lebih kecil memiliki stroke volume yang sama dengan orang dengan diameter aorta yang lebih besar. C. Orang dengan kontraksi atrium yang lebih kuat memiliki stroke volume yang lebih besar daripada orang normal D. A dan B benar E. semua jawaban salah 8. Pada sistem kardiovaskular vertebrata, umumnya pembuluh darah arteri akan bercabang membentuk kapiler dan selanjutnya kapiler akan bersatu membentuk vena. Namun pada beberapa organ, kapiler akan berkumpul dan membentuk arteri dan buka vena. Organ berikut yang memiliki struktur seperti yang disebutkan diatas (kapiler bermuara pada arteri) adalah........ A. Ginjal mamalia dan paru-paru mamalia B. Insang ikan dan hati C. Ginjal mamalia dan insang ikan D. Insang ikan dan paru-paru mamalia E. Hati dan paru-paru mamlia 10
  13. 13. Untuk soal 9-11. Berdasarkan cara memperoleh makanannya mamalia digolongkan menjadi herbivor, karnivor dan omnivor. Hewan karnivor adalah hewan yang memperoleh sebagian besar makanannya dari daging. Daging mengandung banyak glikogen dan protein. Hewan herbivor adalah hewan yang memperoleh energinya dari tanaman yang dimakan. Tanaman mengandung banyak serat dan sedikit polisakarida pada sitoplasma selnya. Untuk mengetahui pengaruh kedua tipe makanan tersebut terhadap kadar glukosa darah dari masing-masing kelompok hewan, Dr. Riganata van Puyeng melakukan pangukuran kadar glukosa darah pada vena porta hepatika dan vena hepatika. Hasilnya dapat dilihat sebagai berikut: 9. Pernyataan yang tepat berdasarkan hasil pengamatan diatas adalah...kecuali A. Ketika makan, kadar glukosa darah pada vena porta dari karnivor dan herbivor meningkat. B. Pada karnivor dan herbivor, glukosa diserap di hati ketika hewan tersebut makan, dan peristiwa sebaliknya terjadi ketika hewan tersebut puasa. C. Pada herbivor, pelepasan glukosa dari hati terjadi pada saat makan dan puasa. D. Ketika makan, sumber glukosa dari metabolisme sel hewan karnivora berasal dari glukosa yang diserap di usus. E. Ketika makan, sumber glukosa dari metabolime sel herbivora berasal dari glukosa yang diserap di usus dan glukosa yang dilepaskan dihati. 10. Apabila kadar glukosa darah normal dari hewan karnivore adalah 90mg/dL dan kadar glukosa darah dari hewan herbivore 50 mg/dL tentukanlah: a. Kadar glukosa darah pada vena porta hepatika dari hewan karnivor ketika makan! b. Kadar glukosa darah yang dilepaskan dari hati ke darah oleh hewan karnivor ketika puasa! c. Kadar gukosa yang direabsorbsi oleh hewan herbivor ketika makan! 11. Hasil percobaan lanjutan pada hewan herbivore menunjukan dari 100 persen glukosa yang terkandung dalam tanaman yang dimakannya (sebagian besar dalam bentuk selulosa), 33% dirubah menjadi asam lemak dan hanya 18% yang diserap dalam bentuk glukosa di usus. Berdasarkan keterangan tambahan tersebut manakah pernyataan berikut yang tidak benar? A. Hewan herbivora selalu memiliki kadar glukosa yang lebih rendah pada vena porta hepatika jika dibandingkan dengan kadar glukosa pada vena hepatika. B. Sumber glukosa darah pada hewan herbivora pada saat kelaparan adalah hasil dari glukoneogenesis di hati dengan bahan baku asam lemak. C. Sumber glukosa darah pada hewan herbivor pada saat kelaparan adalah hidrolisis glikogen di hati. 11
  14. 14. 12. Berikut merupakan peranan antibodi dalam mengeliminasi partikel atau sel asing yang masuk kedalam tubuh, kecuali..... A. Menempel pada sisi aktif dari partikel atau sel yang masuk ke dalam tubuh. B. Mempermudah makrofag dalam memfagositosis partikel atau sel asing yang masuk kedalam tubuh. C. Mengendapkan partikel asing yang terlarut di dalam cairan tubuh. D. Menginisiasi kerja dari sistem komplemen. E. Mengeliminasi bakteri yang tumbuh pada endosom dari makrofag 13. Pasteur merupakan orang yang pertama kali melakukan pengamatan mengenai sistem kekebalan adaptif. Pasteur mengamati bahwa pemerah susu yang memerah susu dari sapi yang terkena cow fox akan terhindar dari penyakit sejenis yang mematikan yaitu small fox. Setelah dilakukan pengamatan ternyata dua penyakit ini disebabkan oleh 2 organisme yang berbeda. Di masa sekarang diketahui sesuatu yang menyebabkan kekebalan pada pemerah susu tersebut adalah antibodi. Berdasarkan keterangan di atas, pernyataan berikut yang benar adalah...... A. Dua organisme yang menyebabkan small fox dan cow fox, memiliki antigen yang sama. B. Dua organisme yang menyebabkan small fox dan cow fox, memiliki epitop yang sama. C. Dua organisme tersebut adalah bakteri D. Antibodi yang menyerang cow fox dan smal fox diproduksi oleh dua klon sel B yang berbeda E. Jawaban Ad an B benar. 14. Berikut merupakan pernyataan yang tepat mengenai peredaran darah pada vertebrata, kecuali…… A. Darah selalu mengalir dalam pembuluh darah B. Ketika darah dipompa dari jantung maka volume total darah yang mengalir ke arteri, kapiler dan vena tidak berubah. C. Selama darah beredar di dalam pembuluh maka untuk sementara waktu sebagaian dari cairan darah akan keluar dari pembuluh darah. D. Selama darah beredar pada pembuluh darah maka tekanan darah akan terus menurun dari arteri ke kapiler dan kemudian ke vena. E. Hematokrit darah pada venula lebih besar dari pada arterial. 15. Pernyataan yang benar mengenai gambar di bawah ini adalah...... + A. Cahaya lampu merangsang membukanya gerbang ion Na pada sel A sehingga dikeluarkan neurotransmiter yang mengaktivasi sel B sehingga rangsangan dapat dialirkan oleh sel D ke saraf pusat. + B. Cahaya lampu merangsang membukanya gerbang ion Na pada sel D sehingga dikeluarkan neurotransmiter yang mengaktivasi sel B sehingga rangsangan dapat dialirkan oleh sel D ke saraf pusat. + C. Cahaya lampu merangsang terbukanya ion K pada sel A sehingga dikeluarkan neurotransmiter yang mengaktivasi sel B sehingga rangsangan dapat dialirkan oleh sel D ke saraf pusat. + D. Cahaya lampu merangsang menutupnya ion Na pada sel A sehingga dikeluarkan neurotrnsmiter yang mengaktivasi sel B sehingga rangsangan dapat dialirkan oleh sel D ke saraf pusat. 12
  15. 15. 16. Apabila cahaya jatuh pada daerah C maka seseorang tidak dapat melihat bendabenda di sekitarnya. Penjelasan yang dapat menjelaskan peristiwa tersebut adalah.... A. Pada C tidak terdapat sel saraf sehingga rangsang cahaya tidak dapat diterima. B. Masuknya cahaya pada daerah C dapat mengakibatkan kerusakan pada fotoreseptor sehingga respon cahaya tidak dapat disalurkan ke sistem saraf pusat. C. Pada daerah C tidak terdapat sel batang maupun konus sehingga respon cahaya tidak dapat dihantarkan ke otak. D. Neuron pada daerah C berfungsi menghambat kerja dari sistem saraf mata. 17. Manakah pernyataan yang tidak benar dari sistem sensoris? A. Aliran rangsang pada sistem sensoris melibatkan perubahan stimulus kimia atau fisik ke dalam bentuk potensial aksi B. Secara umum, rangsangan mengakibatkan terjadinya perubahan aliran ion yang menembus membran plasma sel sensoris. C. Sensori adaptasi berperan penting dalam kemampuan organisma untuk mebedakan antara stimulus yang penting dan tidak penting D. Semakin besar rangsang, maka potensial aksi pada reseptor akan meningkat. 18. Berikut ini yang merupakan pernyataan yang benar mengenai sistem saraf adalah... A. Membran mielin dari sel saraf tepi dan pusat dibuat oleh sel Schwann B. Semua sel saraf memiliki membran mielin C. Pada sel saraf yang bermielin, depolarisasi membran sel hanya terjadi pada nodus Ranvier. D. Sel saraf berukuran kecil mampu menghantarkan rangsang lebih cepat daripada sel saraf berukuran besar E. Beda potensial sel saraf ketika sel saraf tidak menghantarkan atau menerima + rangsang ditentukan oleh permeabilitas membran sel terhadap ion K . 19. Baygon merupakan racun jenis organofosfat. Racun ini dapat menghambat kerja dari enzim asetilkolinesterase yaitu enzim yang memecah neurotransmiter asetilkolin. Salah satu sinaps yang menggunakan neurotransmiter asetilkolin adalah sinaps yang menghubungkan neuron motorik dengan otot rangka. Apakah yang akan terjadi pada seseorang yang memakan baygon? A. Kejang otot karena membran sel otot terdepolarisasi terus-menerus B. Kejang otot karena membran sel otot mengalami hiperpolarisasi secara terusmenerus. C. Otot mengalami paralisis karena sel otot tidak mendapat rangsangan dari sel saraf. D. Otot mengalami atropi karena tidak mendapat rangsang dari sel saraf E. Otot tetap berkontraksi secara normal. 13
  16. 16. 20. Sistem saraf difus dapat ditemukan pada hewan dari filum...... A. Coelonterata B. Arthropoda dan Anelida C. Echinodermata dan Coelenterata D. Echinodermata E. Anelida dan Echinodermata ETOLOGI 1. Pembuatan jaring oleh laba-laba merupakan contoh dari…. A. insting B. 'conditioned reflex' C. tindakan yang diperoleh, otomatis D. kebiasaan E. cara belajar 'trial and error' 2. Seekor hamster melalui labirin untuk pertama kalinya dengan.... A. insting B. 'trial and error' C. kebiasaan D. 'reasoning' E. 'conditioned reflex' 3. Memainkan piano adalah contoh dari.... A. kebiasaan B. 'inborn activity' C. insting D. 'conditioned reflex' E. refleks 4. Mengerjakan persoalan matematika adalah contoh dari.... A. 'involuntary act' B. 'voluntary act' C. insting D. tropisme E. refleks 5. Sebutkan dua keuntungan melakukan ritual kawin (courtship rituals)! a...................................................................................................... B...................................................................................................... 14
  17. 17. GENETIKA DAN EVOLUSI 1. Pada pohon silsilah suatu keluarga, warna mata coklat adalah dominan, dan biru adalah resesif. Joan dan Jane kembar. Dari diagram di bawah, dapat ditentukan bahwa.... A. Thomas dan Mary homozigot untuk mata coklat. B. Joan dan Jane adalah kembar identik. C. Jane heterozigot untuk mata biru. D. Jane homozigot untuk mata biru. E. Joan dan Samuel homozigot untuk mata coklat. 2. Seorang petani memperoleh 252 bunga merah, 235 bunga putih, dan 503 bunga merah muda ketika ia menyilangkan bunga merah muda. Kesimpulan manakah yang dapat ditarik dari informasi di atas? A. Fenotip hibrid sama dengan genotipnya. B. Fenotip tipe murni berbeda dengan genotipnya. C. Fenotip hibrid berbeda dengan genotipnya. D. Keturunannya menunjukkan fenotip dari gen dominan. E. Semua pernyataan di atas salah. 3. Pada tahun 1889, biologiwan August Weissmann mencoba untuk mengetahui apakah ia dapat menghasilkan galur mencit tanpa ekor. Ia mengoperasi mencit untuk menghilangkan ekornya, lalu membiarkan mencit tersebut bereproduksi. Hasilnya, semua anak mencit memiliki ekor panjang. Ia mengulangi prosedur yang sama selama 22 generasi, dan selalu mendapatkan hasil yang sama. Hasil penelitiannya membantu menolak teori.... A. 'natural selection' B. 'survival of the fittest' C. 'struggle for existence' D. 'inheritance of acquired characteristics' E. 'continuity of germplasm' 4. Pria buta warna menikan dengan wanita normal yang heterozigot untuk pandangan warna. Bagaimanakah kemungkinan dua anak laki-laki mereka untuk buta warna? A. 0% D. 75% B. 25% E. 100% C. 50% 5. Jumlah kombinasi gen yang berbeda, yang mungkin dari gamet tumbuhan trihibrid TtYySs adalah.... A. 2 B. 4 C. 6 D. 8 E. 10 15
  18. 18. 6. Jika sepasang marmot hitam hibrid dikawinkan, dan ada empat keturunan, kemungkinan fenotipnya adalah.... A. semua hitam B. tiga hitam, satu putih C. dua hitam, dua putih D. satu hitam, tiga putih E. semua mungkin 7. Semua pernyataan berikut ini mengenai evolusi adalah benar, kecuali.... A. makhluk hidup mengalami perubahan. B. makhluk hidup modern berkembang dari organisme yang lebih sederhana. C. evolusi telah berlangsung selama jutaan tahun. D. evolusi masih terus berlangsung. E. evolusi telah berhenti. 8. Adanya celah insang pada embrio kelinci mengindikasikan bahwa.... A. kelinci bernapas dengan insang pada tahap gastrula. B. kelinci adalah turunan dari amfibi. C. vertebrata memiliki nenek moyang yang sama. D. sifat-sifat yang diperoleh dapat diturunkan. E. teori regenerasi mungkin benar. 9. Uji presipitin membantu memperkokoh bukti evolusi dalam bidang.... A. anatomi B. biokimia komparatif C. embriologi D. 'breeding' hewan dan tumbuhan E. distribusi geografis 10. Menurut Lamarck, evolusi terjadi sebagai hasil dari…. A. seleksi alam B. teori rekapitulasi C. overproduksi D. 'blending inheritance' E. 'inheritance of acquired characteristics' 11. Menurut Weismann, perubahan pada.... A. somatoplasma diturunkan. B. plasma nutfah diturunkan. C. somatoplasma dan plasma nutfah diturunkan. D. sel-sel tubuh diturunkan. E. sel-sel tubuh dan plasma nutfah diturunkan. 12. Supaya populasi ikan cod tetap konstan, jumlah telur yang diproduksi oleh satu ikan cod yang harus sintas adalah.... A. 1 B. 2 C. 4 D. 1 juta E. 10 juta 16
  19. 19. 13. Dalam perjuangan untuk bertahan hidup, hewan-hewan yang sintas adalah yang.... A. paling besar B. paling kuat C. paling cepat D. paling berat E. paling fit 14. Ilmuwan yang mengajukan revisi terhadap teori Darwin adalah.... A. Redi B. Banting C. Mendel D. De Vries E. Ehrlich 15. Berdasarkan prinsip Hardy-Weinberg, 'gene pool' dapat tetap stabil jika terdapat.... A. perkawinan acak B. banyak mutasi C. migrasi yang sering D. perkawinan yang tidak acak E. mutasi acak EKOLOGI Grafik pada Gambar 1. merupakan grafik pertumbuhan dari populasi kutu daun, kepik, dan burung kutilang. Adapun rantai makanan dari ketiga spesies tersebut adalah sebagai berikut : daun mawar kutu daun kepik kutilang. 1. Berdasarkan grafik pada Gambar 1 manakah garis yang menunjukkan pertumbuhan populasi : a. Kutu daun : garis ........... b. Kepik : garis ………. c. Kutilang : garis ……….. 17
  20. 20. 2. Isilah : Kotak-kotak kosong yang ada pada di atas. dengan faktor-faktor yang mempengaruhi ukuran populasi suatu spesies! Berdasarkan faktor-faktor tersebut hal apakah yang dapat menyebabkan : a. Populasi tetap konstan ? b. Populasi meningkat ? c. Populasi menurun ? 3. Dalam suatu usaha untuk memperkirakan jumlah populasi ikan mas di suatu danau, telah ditangkap sebanyak 625 ikan mas yang kemudian ditandai lalu dilepas kembali. Seminggu kemudian berhasil ditangkap ikan mas sebanyak 873 ekor yang mana 129 ekor diantaranya memiliki tanda. Berapakah estimasi dari ukuran populasi ikan mas di danau tersebut ? Sebutkan 4 asumsi yang harus diambil untuk melakukan estimasi ukuran populasi dengan metode 3M (menangkap, menandai dan melepas kembali) ! 4. Berdasarkan kurva kelulushidupan pada gambar di atas, populasi manakah, (a) atau (b) yang membutuhkan laju reproduksi yang lebih tinggi untuk tetap mempertahankan populasinya tetap stabil ? Jelaskan jawaban anda ! 18
  21. 21. 5. Fenomena menempelnya teritip/kerang-kerang kecil pada tubuh paus di laut dapat menggambarkan bentuk interaksi: A. komensalisme B. kompetisi C. mutualisme D. A dan B benar E. A, B dan C benar 6. Berkaitan dengan fenomena gangguan (disturbance) pada ekosistem, pernyataan yang tidak benar adalah bahwa gangguan …… A. dapat merusak komunitas biologi B. dapat membantu pencapaian equilibrium C. dapat menghilangkan organisme dari komunitas D. dapat mengubah ketersediaan sumber daya E. dapat menurunkan keanekaragaman 7. Hubungan antara dua spesies di alam seringkali sulit diklasifikasikan ke dalam salah satu bentuk interaksi sederhana yang dilihat berdasarkan manfaat & kerugian (mis. predasi, mutualisme dsb.). Contoh fenomena yang dapat menggambarkan lebih dari satu bentuk interaksi adalah ………. A. Tumbuhan Ficus (strangler fig) yang menjadi epifit pada pohon B. alelopati oleh tumbuhan C. penaungan tumbuhan herba oleh pohon yang lebih tinggi D. tidak ada yang benar E. semua benar BIOSISTEMATIK 1. Zooplankton di laut terutama terdiri dari kelompok : ………………. dan ………………….. 2. Halter merupakan sayap belakang yang mengalami reduksi/modifikasi pada kelompok serangga: …………………….. 3. Tabel di bawah ini berisi daftar beberapa karakter-karakter yang mendasar dari fila (filum-filum) hewan. Buatlah perbandingan antara filum-filum yang ada dalam tabel dengan membuat tanda plus ( + ) = ada; nol ( 0 ) = tidak ada; ps = pseudocoel; v=simetri bervariasi/tak bersimetri, r=radial; b=bilateral, c=komplit atau lengkap dan I=tak komplit/tidak lengkap. 19
  22. 22. 4. Tuliskan karakter apa yang harus dimiliki oleh suatu organisme agar dapat dimasukkan ke dalam kingdom Plantae. 5. Tuliskan 3 persamaan & 3 perbedaan antara Bryophyta & Pteridophyta. 6. Tuliskan pengertian spora, biji, dan gamet. **** 20
  23. 23. KUNCI DAN PEMBAHASAN PROBLEM SET I BIOLOGI SEL MOLEKULER & MIKROBIOLOGI 1. Jawaban: D ATP sintetase merupakan enzim yang berperan dalam mengubah energi yang timbul akibat timbulnya gradien proton yang merupakan hasil dari trasfer elektron. Enzim ini terdiri atas dua komponen utama yaitu F0, merupakan komponen enzim yang terbenan di membran dalam mitokondria, F1 merupakan komponen yang terdapat pada permukaan dalam dari membran dalam mitokondria. FO merupakan tempat masuknya proton dari ruang antar membran ke matriks mitokondria, pergerakan proton mengakibatkan perubahan konformasi F1 sehingga terjadi sintesis ATP. Kerusakan F1 mengakibatkan tidak terjadinya fosforilasi ADP menjadi ATP. Proses 1,2,3 merupakan proses yang terjadi pada transfer elektron jadi tidak akan dipengaruhi. 2. Jawaban: D Metabolime senyawa keton di dalam sel memerlukan keberadaan mitokondria. Sel darah merah tidak memiliki mitokondria sehingga sel darah merah tidak dapat memanfaatkan senyawa keton sebagai sumber energi. 3. Jawaban: C RNA yang bersifat polisistronik di dalam sel eukariot adalah rRNA. rRNA 28s, 5.8s dan 18s ditranskripsi dalam satu pre-mRNA dan kemudian dipisah menjadi rRNA yang terpisah. 4. a. Kerapatan bakteri adalah 4/ml jadi jumlah bekteri dalam 1 liter medium adalah 4000. Karena fase lag (fase dimana sel masih beradaptasi dan belum membelah) adalah 1 jam maka jumlah sel setelah satu jam adalah tetap (4000)) b. Waktu duplikasi bakteri adalah 20 menit maka setelah dua jam bakteri akan 3 mengalami duplikasi sebanyak 3 kali sehingga jumlahnya menjadi (4000) x 2 = 32000 c. pada fase lag 25 persen mati berarti yang tersisa adalah 3000 sel, sehingga setelah 2 3 jam jumlah sel menjadi 3000 x 2 = 24000 5. Jawaban: A Sudah Jelas 6. Jawaban: B Sistem atenuasi merupakan salah satu sistem pengaturan pada trp operon. Sistem ini terdapat pada terdapat pada trpE dari sistem operon, pada sistem ini terdapat 4 segmen DNA yang diberi nomor 1,2,3,4 dari ujung 5' ke 3'. Pada segmen 1 terdapat dua buah kodon yang terletak bersebelahan yang mengkode triptofan. Apabila tidak terdapat triptofan di dalam sel maka ribosom akan berhenti melakukan translasi pada segmen ini, sehingga terjadi penempelan antara segmen 2 dan 3. penempelan segmen 2 dan 3 tidak membentuk terminasi transkripsi sehingga proses translasi akan dilanjutkan, meskipun terdapat ribosom yang berhenti pada trpE ini bukan berarti mengakibatkan gen yang lain tidak ditranslasi. Hal ini disebabkan karena tiap gen memiliki start dan stop kodonnya sendiri. Apabila terdapat triptofan yang melimpah di dalam sel, maka segmen satu dari trpE akan selesai di traslasi, ini mengakibatkan terbentuknya pasangan antara segmen 1 dan 2, dan segmen 3 dan 4. Segmen 3 dan 4 ini membentuk terminasi traskripsi sehingga apabila triptofan banyak didalam sel proses transkripsi akan terhenti di trpE. 24
  24. 24. 7. Jawaban: a. S b. S c. B Pada sistem siklus sel terdapat check point-check point yang timbul akibat keberadaan protein tertentu didalam sel. Siklus sel berjalan secara berurutan dari G1, S, G2, dan M. Sel pada tahap lanjut, misalnya G2 dapat menginduksi sel pada tahap sebelumnya untuk masuk ke fase berikutnya. Misalkan sel pada fase S dapat menginduksi sel pada fase G1 untuk segera masuk ke fase S. Proses sebaliknya tidak terjadi. 8. Jawaban: a. Kandungan oksigen di dalam air dikenal dengan istilah DO sedangkan jumlah oksigen yang dikonsumsi oleh organisme air dikenal dengan istilah BOD. DO air murni adalah 10 mg/ml, sedangkan sampel 2 mg/ml dan sampel yang diberi perlakuan primer 6 mg/ml, ini berarti BOD sampel adalah 10-2 = 8 mg/ml dan sampel yang mendapat perlakukan primer adalah 10-6 = 4 mg/ml. Dari data tersebut dapat diketahui bahwa penurunan BOD akibat perlakuan primer adalah sebanyak 50% b. BOD air setelah perlakuan skunder adalah 10-9,2 = 0,8 mg/ml sehingga penurunan BODnya adalah 90% c. untuk mengukur pathogen, karena coliform merupakan organisme indikator bagi adanya patogen faecal 9. Jawaban: a. Represor yang merupakan protein penghambat dari ekspresi gen monoksidase 0 akan aktif jika sel ditumbuhkan pada suhu 30 C, oleh sebab itu maka untuk mencegah ekspresi metana monooksigenase kita harus menumbuhkan bakteri 0 pada suhu 30 C. b. Ekspresi metanaoksigenase akan terhenti apabila represor aktif oleh sebab itu agar metanaoksigenase diekspresikan kita harus menunbuhkan bakteri pada suhu 0 45 C. c. Metana dan oksigen d. 2CH4 + 02 ----2 CH3OH (metanol) 14 e. Dengan menggunakan metana dengan label C dan mengukur penurunan pada metana yang diberi label radioaktif atau dari produksi metanol yang berlabel radioaktif F. Methanotroph 10. Jawaban: C Bacillus dan Clostrodium merupakan dua kelompok bakteri yang menghasilkan endospora. Endospora merupakan struktur perkembangbiakan yang dibentuk ketika kondisi lingkungan tidak meguntungkan untuk pertumbuhan, struktur ini juga tahan terhadap panas. Oleh sebab itu untuk mengisolasi bakteri ini dari bakteri lain salah satunya adalah dengan jalan pemanasan. 11.1 11.2 11.3 11.4 11.5 11.6 11.7 11.8 Jawaban: Jawaban: Jawaban: Jawaban: Jawaban: Jawaban: Jawaban: Jawaban: I C E M G J N F 25
  25. 25. 11.9 Jawaban: O 11.10 Jawaban: D Pembahasan No.11 Gambar 1 Gambar 2 Virus flu merupakan salah satu jenis virus yang memiliki membran pembungkus disamping kapsid yang membungkus DNA. Membran pembungkus ini berasal dari membran plasma sel inang yang terbuat dari fosfolipid. Membran pembungkus diperoleh oleh virus ketika dia keluar dari inang secara budding, pada membran tersebut terdapat protein hemeaglutinin (Gambar 2) yang berperan dalam pengenalan terhadap sel inang. Apabila hemeaglutinin menempel pada reseptornya maka virus ini akan diendositosis masuk ke dalam sel inang (Gambar 1). Pada saat endositosis, lapisan lipid bilayer (membran pembungkus) dari virus akan fusi dengan membran vesikula dan mengakibatkan terlepasnya RNA virus ke sitoplasma. RNA selanjutnya masuk ke dalam inti untuk direplikasi. Karena genom virus ini adalah RNA dan bukan retrovirus maka proses replikasi dilakukan oleh RNA Polimerase. Replikasi menggunakan RNA inang sebagai pencetak (pengkode). 12. Jawaban: D Protein memiliki empat statafikasi struktur: 1.) Struktur primer: struktur primer merupakan susunan asam amino spesifik dari suatu protein, Contoh: glisin-fenilalanin-metionin-glisin dan seterusnya. 2.) Struktur sekunder: merupakan bentuk yang muncul akibat dari terbentuknya ikatan hidrogen antar asam amino yang menyusun rantai protein. Terdapat dua bentuk struktur skunder yaitu lembaran beta dan alfa heliks. 3.) Struktur tersier: merupakan struktur tiga dimensional dari keseluruhan protein. Bentuk tersier dapat bulat lonjong tak beraturan dan sebagainya, struktur ini terbentuk akibat adanya ikatan disulfida, garam, dan interaksi hidrofobik dari rantai samping asam amino yang menyusun protein tersebut. 4.) Struktur kuartener: merupakan struktur yang dibentuk dari gabungan beberapa polipeptida/protein. Pada gambar, hemeaglutinin terbentuk dari empat protein yang berbentuk lonjong sehinga dari hemaglutinin tersebut kita dapat melihat struktur tersier dan kuartener dari protein. 13. Jawaban: A Virus yang menyerang manusia dan burung tersebut adalah jenis yang sama sehingga RNA, kapsid dan hemaglutininnya yang merupakan komponen utama virus pastilah sama. Karena membran pembungkus berasal dari sel inang, sementara sel burung dan manusia memiliki komponen yang berbeda maka membran pembungkus dari virus yang hidup pada burung dan manusia akan berbeda. 26
  26. 26. 14. Jawaban: B Antibiotik merupakan suatu substansi yang mampu menghambat pertumbuhan suatu makhluk hidup, terutama bakteri. Karena virus bukan mahluk hidup maka flu tidak dapat disembuhkan dengan antibiotik. Antibiotik disini berperan dalam mencegah infeksi sekunder oleh bakteri. Orang yang menderita flu sistem kekebalan tubuhnya menurun sehingga akan mudah terserang bakteri. 15. Jawaban: D Vaksinasi pada umumnya merangsang produksi antibodi. Antibodi ini hanya dapat mengenal molekul permukaan dari suatu organisme yang berada diluar sel. Disini RNA terdapat di bagian dalam membran sehingga antibodi tidak dapat mengenalinya. Oleh sebab itu RNA virus tidak dapat digunakan sebagai vaksin. 16. Jawaban: A Pengenalan virus terhadap sel inangnya sangatlah spesifik sama seperti kunci dan anak kuncinya. Apabila suatu sel tidak memiliki reseptor hemaglutinin dari virus influensa maka sel tersebut tidak dapat dikenali. 17. Jawaban: B Sudah jelas. 18.Jawaban: B Agar proses replikasi DNA dapat terjadi secara invivo maka diperlukan komponen sebagai berikut: DNA templat; yang menjadi DNA templat adalah kedua rantai induk. RNA polimerase (Promase), berperan menambahkan primer (berupa RNA) pada DNA template, sebelum proses pemanjangan rantai DNA anak dilakukan. DNA polimerase, berperan dalam membentuk rantai anakan setelah terjadinya penempelan primer. SSB (single strain binding protein), berperan mencegah bergabungnya rantai induk pada saat proses replikasi. dATP, dTTP, dCTP, dGTP merupakan bahan baku penyusun dari rantai DNA. 19. Jawaban: C 5'AACGGUUUUAUGGAUAAACAA...(45 basa)... GGGAUGCGGAGAUAAGAAUUU3' Perhatikan urutan basa di atas, untuk mengetahui panjang rantai polipeptida kita harus mencari letak stop kodon dan start kodon. Dari gambar jumlah basa RNA dari start kodon sampai sebelum stop kodon adalah 69 basa, karena satu asam amino dikode oleh tiga basa maka panjang polipeptidanya adalah 69/3 = 23 asam amino. Jumlah ikatan peptida pada polipeptida dengan 23 asam amino adalah 23-1 = 22. 20. Jawaban E. Flagel bakteri dibentuk oleh protein yang disebut dengan flagelin. Pergerakan flagel bakteri disebabkan oleh terjadinya aliran proton menembus membran sel dari arah luar ke dalam dan merupakan aktivitas dari mikrotubul bukan filamen aktin. 27
  27. 27. MORFOLOGI, ANATOMI DAN FISIOLOGI TUMBUHAN 1. Jawaban: D Jalur metabolisme berupa siklus yang menghasilkan senyawa intermediet berupa gliserat-3-fosfat dan ribulosa bifosfat adalah siklus Calvin. Pada siklus ini digunakan CO2 yang difiksasi oleh ribolusa-1,5 bifosfat (RuBP) dengan bantuan enzim rubisco. 2. Jawaban: B Sebanyak 6 ATP digunakan pada saat reaksi 3-fosfogliserat menjadi 1,3-bifosfogliserat. Sedangkan pada reaksi yang menghasilkan ribulosa bifosfat membutuhkan 3 ATP, sehingga total ATP yang digunakan pada siklus Calvin sebanyak 9 ATP 3. Jawaban: C Porfirin adalah senyawa dengan struktur heterosiklik yang biasanya ditemukan pada berbagai pigmen biologi, mempunyai empat cincin yang bersatu dan atom nitrogen. Pada klorofil a terdapat unsur Magnesium (Mg) yang berperan penting dalam pengikatan dengan cincin porfirinnya, sehingga tanaman yang kekurangan Mg akan mengalami klorosis. 4. Jawaban: D Hormon yang sangat berperan dalam dormansi biji adalah ABA (asam absisat). Hormon ini berperan dalam proses pematangan biji dan penghambatan perkecambahan dini dengan cara mengendalikan transkripsi beberapa gen tertentu sehingga terjadi penghambatan aktivitas hidrolase pada biji. 5. Jawaban: C Asam folat dibutuhkan dalam biosintesis asam nukleat. Vitamin ini ditemukan pada sayur-sayuran dan biji-bijian yang berperan dalam berbagai reaksi metabolik melibatkan asam amino. Vitamin B6 ditemukan pada daging dan sayur-sayuran dan dibutuhkan pada metabolisme asam amino. Niasin merupakan koenzim untuk NAD+ dan NADP+. Vitamin A penting untuk kesehatan mata. Asam askorbat (vitamin C) digunakan untuk sintesis kolagen dan sebagai antioksidan yang menghambat kerja oksigen radikal yang terbentuk pada berbagi reaksi dalam sel. 6. Jawaban: D Fotosintesis tumbuhan C4 teradapatasi pada lingkungan yang kering dan panas. Tumbuhan ini memfiksasi CO2 di mesofil menghasilkan senyawa dengan 4 karbon yang kemudian akan melepaskan CO2 ke seludang pembuluh. Karena jalur dan lokasi fotosintesis yang digunakan berbeda, maka perlu ATP yang lebih banyak dibandingkan pada fotosintesis pada tumbuhan C3. Selain digunakan dalam siklus Calvin, ATP juga digunakan untuk merubah asam piruvat menjadi fosfoenol piruvat yang kemudian akan digunakan untuk memfiksasi CO2 di mesofil. 7. Jawaban: C Lentisel adalah struktur yang umum ditemukan pada tumbuhan yang mengalami pertumbuhan sekunder, merupakan tempat pertukaran gas untuk jaringan yang aktif pada kulit kayu. Kambium pembuluh dan kambium gabus sangat aktif selama pertumbuhan, sehingga oksigen sangat dibutuhkan. Pneumatofor dikenal sebagai akar nafas, misalnya yang terdapat pada mangrove dimana akar ini digunakan untuk pertukaran gas di atas air karena sebagian akar dari mangrove terendam air. 28
  28. 28. 8. Jawaban: A Pertumbuhan primer pada batang tumbuhan dikotil akan menghasilkan floem dan xilem primer dari prokambium. Aktivitas pertumbuhan sekunder oleh kambium pembuluh akan menghasilkan xilem sekunder ke arah dalam batang dan floem skunder ke arah luar batang, sehingga jaringan floem primer akan berbatasan langsung dengan korteks. Dari dalam ke luar batang tumbuhan dikotil berturut-turut adalah empulur-xilem primer-xilem sekunder-kambium pembuluh-floem sekunderfloem primer-korteks-periderm. 9. Jawaban: C Sklerenkim mempunyai krakteristik berupa sel mati pada keadaan dewasa serta memiliki dinding sekunder yang kaku oleh lignin, sedangkan parenkim dan kolenkim merupakan sel yang hidup pada keadaan dewasa. Contoh sklerenkim adalah serat dan sklereid (sel batu). 10. Jawaban: E Vakuola tidak hanya ditemukan pada sel tumbuhan, tetapi juga pada hewan contohnya pada Euglena. Pada sel tumbuhan, vakuola dikelilingi oleh suatu membran yang disebut tonoplas dan air masuk ke vakuola berdasarkan pada gradien potensial air untuk membantu mempertahankan turgiditas sel. Bentuk dan proporsi vakuola juga dapat berubah-ubah tergantung lingkungan tempat sel berada. 11. Jawaban: B Serangga dari famili Aphididae mendapat makanan dari batang tanaman muda pada jaringan floem. Jaringan floem merupakan lapisan yang terdapat pada sebelah luar kambium. 12. Jawaban: C Setiap sel tumbuhan mempunyai sifat totipotensi yaitu kemampuan untuk membentuk suatu individu baru yang sama dengan induknya. Fenomena ini dapat diamati dengan menumbuhkan sel pada medium kultur jaringan. Syarat sel dapat ditumbuhkan dalam medium kultur jaringan adalah sel hidup. Sel hidup dari tanaman yang tidak dapat ditumbuhkan di medium kultur jaringan adalah pembuluh tapis, karena pada keadaan dewasa, sel ini tidak memiliki inti sel sehingga regulasinya menjadi terbatas dan tidak dapat tumbuh pada medium kultur jaringan. Sel pengantar, parenkim, maupun polen semuanya dapat ditumbuhkan pada medium kultur jaringan, sedangkan sel sklereid tidak dapat ditumbuhkan pada medium kultur jaringan tumbuhan karena sel ini adalah sel mati 13. Jawaban: B Tumbuhan tingkat rendah seperti lumut mempunyai generasi gametofit yang dominan, sedangkan pada tumbuhan tingkat tinggi, generasi yang dominan adalah generasi sporofit, sedangkan generasi gametofit semakin tereduksi dan berumur jauh lebih pendek. 14. Jawaban: B Sel-sel yang ditunjukkan adalah sel-sel kolenkim. Kolenkim merupakan sel yang hidup pada keadaan dewasa. Sel-sel pada jaringan kolenkim memiliki penebalan pada dinding selnya, akan tetapi dinding sel yang tebal ini tidak mengandung lignin. Penebalan pada dinding sel kolenkim adalah penebalan primer oleh selulosa yang tidak merata. Berdasarkan lokasi penebalan dinding selnya, kolenkim dibagi menjadi kolenkim sudut dimana penebalan dinding selnya hanya terjadi pada sudut-sudut sel dan kolenkim papan dimana penebalan terjadi pada bagian dinding tangensial. 29
  29. 29. 15. Jawaban: E Struktur organ tersebut adalah daun tumbuhan Gymnospermae yang teradaptasi pada lingkungan xerofit, ditandai dengan adanya lapisan kutikula dan stomata yang terbenam. Mempuyai struktur endodermis seperti halnya yang ditemukan pada akar. Selain itu, terdapat suatu struktur sekresi (saluran resin) yang terbentuk secara schizogen. Struktur ini terbentuk karena pemisahan sel-sel sehingga dihasilkan suatu rongga dan sel-sel pembatas dinamakan sel-sel epitel yang berbeda dengan sel-sel sekitarnya. Sel-sel epitel ini kemudian mengeluarkan sekret ke dalam rongga tersebut. MORFOLOGI, ANATOMI DAN FISIOLOGI HEWAN 1. Jawaban: a. A dan B Otot yang berperan dalam menjaga postur tubuh tidak boleh berkontraksi terlalu cepat dan harus memiliki daya tahan yang lama (tidak cepat lelah). Dengan turnover Miosin ATPase yang rendah maka laju metabolime dari otot ini akan lambat dan mengakibatkan laju produksi asam laktat sangat lambat. b. D Sudah jelas c. C Sudah jelas 2. Jawaban: C Sudah Jelas 3. Energi yang diperlukan untuk sekali kontrkasi adalah 798 kcl. Ini setara dengan 798/7 ATP = 114 ATP. Jumlah ATP yang diproduksi dari respirasi an aerob pada sekali kontraksi adalah (1/3)x114 = 38 mol ATP. Sekali respirasi anaerob memproduksi 2 mol ATP dan 2 mol Asam Laktat, sehingga jumlah molekul asam laktat yang diproduksi pada satu kali kontraksi adalah 38 mol ATP. Untuk sepuluh kali kontraksi berturut-turut, jumlah ATP yang diperlukan adalah 380 molekul. 4. Jawaban: E Sudah Jelas 5. Senyawa inulin merupakan senyawa yang tidak direabsorbsi sehingga untuk mengetahui jumlah inulin yang dibuang dari plasma darah kita mempergunakan rumus VU/(GFR)P = 1. VU merupakan jumlah inulin yang dibuang dari plasma darah melalui urin. VU = (GFR)P; VU= 150 x (0,2/10) = 3 mg. 6. Jawaban: a. Jumlah glukosa yang dikeluarkan oleh plasma darah tiap menit sama dengan jumlah glukosa yang terdapat pada urin yaitu 20 mg/menit. b. Jumlah glukosa darah yang difiltrasi adalah sama dengan laju filtrasi ginjal dikalikan dengan konsentrasi glukosa dalam plasma darah = 150 ml x 1mg/ml = 150 mg. jumlah yang direabsorbsi = jumlah yang difiltasi-jumlah yang dikeluarkan melalui urin = 150-20 = 130 mg. 7. Jawaban: C Sudah jelas. 30
  30. 30. 8. Jawaban: C Sudah jelas 9. Jawaban B Glukosa yang diserap di usus akan dibawa ke hati melalui vena porta hepatika. Di hati akan dilakukan penyesuaian kadar glukosa darah, kadar glukosa darah yang telah sesuai keluar dari hati melalui vena hepatika. Dari keterangan tersebut maka apabila kadar glukosa darah di vena hepatika dikurangi kadar glukosa darah di vena porta, bernilai positif maka terjadi proses sekresi glukosa dari hati, apabila nilainya negatif berarti terjadi reabsorbsi glukosa di hati. 10. Jawaban: a. Kadar glukosa darah adalah sama dengan kadar glukosa darah yang terdapat pada vena hepatika. Kadar glukosa darah vena hepatika-vena porta ketika hewan makan = 50 mg/dl; 90 mg/ml-kadar glukosa darah vena porta = -50; kadar glukosa darah vena porta = 140 mg/dl. b. 15 mg/dl c. karena nilai kadar glukosa darah di vena hepatika-vena porta bernilai positif ini menunjukan tidak terjadi reabsorbsi glukosa oleh hati ketika herbivora makan. Atau dengan kata lain reabsorbsi = 0 11. Jawaban: C Hati hewan herbivora tidak menyerap glukosa ketika hewan tersebut makan dan malah sebaliknya (mengeluarkan glukosa). Hal ini disebabkan rendahnya jumlah glukosa yang diserap di dalam usus halus. Tidak ada glukosa yang diserap menandakan tidak adanya sumber glukosa yang dikonversi menjadi glikogen. Untuk mempertahankan kadar glukosa darah pada saat kelaparan hewan herbivora membuat senyawa glukosa dari asam lemak melalui proses yang dikenal dengan glukoneogenesis, proses ini terjadi di sel-sel hati. 12. Jawaban: E Antibodi merupakan suatu protein plasma yang diproduksi oleh sel limfosit B. Antibodi ini berperan dalam mengeleminasi partikel yang berada diluar sel dan tidak di dalam sel. 13. Jawaban: E. Sel B di dalam tubuh yang membawa jenis antibodi tertentu akan berploriferasi dan berdiferensiasi menjadi sel plasma akibat adanya antigen dengan epitop tertentu. Semua antibodi yang mengenal epitop yang sama berasal dari klon yang sama. 14. Volume total darah yang dipompa dari jantung tidak akan berubah ketika mengalir pada pembuluh arteri hal ini disebabkan karena pada arteri, namun ketika darah mengalir di kapiler sebagain dari plasma darah akan keluar ke jaringan. Hal tersebut disebabkan oleh kondisi sebagai berikut: Pada kapiler darah terjadi dua peristiwa yaitu filtrasi dan reabsorbsi: Filtrasi mengakibatkan keluarnya komponen plasma darah ke jaringan sedangkan reabsorbsi mengakibatkan masuknya cairan jaringan ke dalam darah. Besarnya nilai reabsorbsi dan filtrasi ini ditentukan oleh dua komponen tekanan, yaitu tekanan hidrostatik yang cenderung mendorong terjadinya filtrasi dan tekanan osmotik yang cenderung mendorong terjadinya reabsorbsi. Pada bagian kapiler yang dekat dengan arteri delta tekanan hidrostatik dikurangi tekanan osmotik darah = 10 mmhg maka pada daerah ini akan terjadi proses filtrasi. Pada bagian kapiler yang dekat dengan vena delta tekanan hidrostatik dikurangi tekanan osmotik darah = -7 mmhg maka pada daerah ini terjadi 31
  31. 31. proses reabsorbsi. Dari nilai tersebut terlihat bahwa tekanan yang mendorong terjadinya filtrasi lebih tinggi dari tekanan yang mendorong terjadinya reabsorbsi, sehingga jumlah plasma darah yang difiltasi dikapiler lebih tinggi dari yang direabsorbsi. Akibatnya sejumlah plasma darah akan tertinggal di jaringan dan mengakibatkan terjadi penurunan volume darah yang mengalir dari ke vena. Cairan yang yang tertinggal di jaringan ini akan diangkut melalui sistem limfa dan dikembalikan ke pembuluh darah pada daerah vena cava sehingga volume darah yang masuk dan keluar jantung menjadi tetap. 15. Jawaban: D Aliran rangsang pada sistem sensoris saraf mata adalah sel kerucut/batang (A/E) ke sel bipolar (B) dan dilanjukan ke saraf optik D. Sinaps yang terbentuk antara sel kerucut/ batang dengan sel bipolar bersifat inhibitorik yang artinya apabila sel kerucut atau batang mengeluarkan neurotrasmiternya maka sel bipolar tidak mampu menghantarkan rangsang. Ketika sel kerucut/ batang menerima rangsang maka ion chanel pada sel kerucut dan batang akan tertutup sehingga kedua sel ini tidak mengalami depolarisasi, akibatnya tidak terjadi pelepasan neurotransmiter. Tidan terdapat neurotransmiter mengakibatkan sel bipolar mengalami depolarisasi dan mampo menghantarkan rangsang ke saraf optik untuk dilanjutkan ke sistem saraf pusat. 16. Jawaban: C Daerah C dikenal juga dengan nama bintik buta. Daerah ini merupakan tempat pembelokan darsi saraf optik dan pada daerah ini tidak terdapat sel batang maupun kerucut, akibatnya cahaya yang jatuh pada daerh ini tidak dapat di deteksi. 17. Jawaban: D Pada sistem sensori, secara umum rangsangan fisik dan kimia akan mengakibatkan masuknya ion natrium kedalam sel sehingga sel mengalami depolarisasi. Depolarisasi yang cukup akan memicu terjadinya potensial pada daerah akson. Potesial pada satu titik akan memicu timbulnya potensial pada titik berikutnya (serupa dengan efek domino) dengan sistem inilah rangsang dihantarkan sepanjang akson. Rangsangan yang semakin kuat tidak akan meningkatkan besarnya potensial aksi akan tetapi meningkatkan frekuensi timbulnya potensial aksi. Pada sistem saraf dikenal adanya istilah adaptasi, yaitu apabila sel saraf dirangsang dengan besar rangsang yang sama secara terus menerus maka akan terjadi pengabaian rangsang. 18. Jawaban: E Sel saraf di dalam tubuh manusia terdiri atas sel saraf yang bermielin dan sel saraf yang tidak bermielin. Lapisan mielin pada sel saraf dibuat oleh dua jenis sel yaitu oligodendrosit pada sistem saraf pusat dan sel scwan pada sistem saraf tepi. Pada keadaan istirahat (tidak menghantarkan rangsang) membran sel saraf memiliki beda potensial yang disebut dengan potensial istirahat. Besarnya nilai beda potensial ini diatur oleh permeabilitas membran terhadap ion kalium. Apabila sel saraf menerima rangsang maka akan terjadi depolarisasi yang apabila nilainya cukup besar akan memicu terjadinya potensial akson di sepanjang akson untuk sel yang tidak bermielin dan pada daerah nodus renvier pada saraf bermielin (membran mielin impermeabel terhadap ion). Kecepatan hantar dari suatu sel saraf dipengaruhi oleh resistensi membran selnya (resistensi transversal) dan resistensi sitoplasmanya terhadap ion natrium. Penghantaran rangsang akan cepat apabila resistensi trasfersanya kecil sedangkan resistensi longitudinalnya kecil. 32
  32. 32. 19. Jawaban: A Rusaknya enzim asetilkolinesterase akan mengakibatkan asetil kolin tidak terlepas dari reseptornya di permukaan membran sel otot. Hal ini mengakibatkan sel otot mengalami depolarisasi secara terus menerus yang mengakibatkan terjadinya kejang otot (tetanus). 20. Jawaban: A Sudah jelas ETOLOGI 1. Jawaban : A Pembuatan jaring oleh laba-laba merupakan contoh dari perilaku bawaan atau “innate behavior” yang di dasari oleh insting dan bukan merupakan hasil dari proses belajar artinya kemampuan untuk membuat jaring sudah diperoleh laba-laba sejak dilahirkan. 2. Jawaban: B Proses “trial dan error” atau mencoba-coba termasuk perilaku yang diperoleh dari hasil belajar dimana setelah mencoba beberapa kali melalui labirin tersebut maka hamster itu akan menemukan jalur yang paling cepat untuk mencapai ujung labirin. 3. Jawaban: A Kebiasaan merupakan perilaku yang dihasilkan dari proses latihan yang dilakukan berulang-ulang. 4. Jawaban: B “Voluntary act” adalah tindakan yang dilakukan atas dasar kesadaran penuh kebalikannya dari “involuntary act” 5. Jawaban: a. Memastikan bahwa jantan itu adalah spesies yang sama. b. Memungkinkan si betina untuk mengevaluasi kualitas si pejantan. GENETIKA DAN EVOLUSI 1. Jawaban: D Apabila John dan Jane merupakan kembar identik maka mereka seharusnya memiliki warna mata yang sama, hal ini disebabkan karena kembar identik berasal dari zigot yang sama sehingga genotipnya juga sama. Jika warna biru pada Jane heterozigot maka gen warna biru seharusnya dominan, apabila kedua gen in dominan maka kedua atau salah satu dari orang tua Joan and Jane memiliki mata biru. 33
  33. 33. 2. Jawaban: A Sudah jelas 3. Jawaban: D Sudah jelas 4. Tidak ada jawaban c c Genotip Bapak: X Y gamet: X dan Y c c Genotip Ibu : XX gamet : X dan X c c c c Kemungkinan keturunan X X (wanita buta warna), XX (heterozigot normal), X Y (lakilaki buta warna), XY(normal). Probabilitas laki-laki buta warna adalah ¼. Probabilitas 2 2 laki-laki butawarna adalah (1/4) = 1/16 5. Jawaban: D Dua pangkat heterozigot 6. Jawaban: E Sudah jelas 7. Jawaban: E Sudah jelas 8. Jawaban C Sudah jelas 9. Jawaban B Sudah jelas 10. Jawaban: E Lanmarck menyatakan bahwa leher panjang pada jerapah diperoleh akibat latihan dan sifat yang diperoleh dari latihan tersebut diturunkan. 11. Jawaban: B Sudah jelas 12. Jawaban: B Sudah jelas 13. Jawaban: E Sudah jelas 14. Jawaban: D 15. Jawaban: A Perkawinan acak akan menjamin tidak terjadinya perubahan pada frekuensi gen. 34
  34. 34. EKOLOGI 1. Jawaban : (a) Garis B (b) Garis A (c) Garis C Berdasarkan prinsip piramida makanan (piramida jumlah) maka jumlah populasi tertinggi setelah produsen adalah spesies pada tingkatan trofik II dalam hal ini kutu daun setelah itu spesies pada tingkatan trofik III (kepik) dan yang paling sedikit pada spesies tingkatan trofik IV (kutilang). Untuk mengetahui hal ini pada grafik dapat dilihat puncak teritinggi dari masing-masing garis yang ada di dalam grafik. 2. 1. Jawab : natalitas 2. Jawab : emigrasi 3. Jawab : mortilitas 4. Jawab : imigrasi a. Jawab : natalitas + imigrasi = mortilitas + emigrasi b. Jawab : (Natalitas + Imigrasi ) > (Mortalitas + Emigrasi) c. Jawab : (Natalitas + Imigrasi ) < (Mortalitas + Emigrasi) Faktor-faktor yang menyebabkan meningkatnya populasi suatu organisme adalah natalitas dan imigrasi sedangkan faktor-faktor yang menyebabkan menurunnya populasi suatu organisme adalah mortalitas dan emigrasi. Untuk soal 2.a 2.c, cukup jelas. 3. Jawaban : 4230 ekor Rumus yang digunakan untuk metode 3M adalah : Nestimasi = (Jumlah hewan yang bertanda x Total tangkapan kedua) (Jumlah hewan bertanda pada penangkapan kedua) Asumsi yang harus diambil untuk melakukan estimasi ukuran populasi dengan metode 3M : 1. Organisasi bercampur secara acak di dalam populasi. 2. Waktu antara penangkan pertama dan penangkan kembali harus cukup untuk dapat memastikan bahwa anggota populasi telah bercampur secara acak. 3. Metode ini hanya dapat diaplikasikan pada populasi yang pergerakannya dibatasi secara geografik / habitat tertutup. 4. Organisme tersebar secara merata di dalam area geografi dimana populasi itu berada. 5. Perubahan ukuran populasi sebagai akibat dari imigrasi, emigrasi, kelahiran dan kematian dapat diabaikan 6. Penandaan tidak menyebabkan terganggunya pergerakan dari organisme yang ditandai dan membuat organisme tersebut menjadi lebih mudah dimangsa oleh predatornya. 4. Jawaban : Populasi (b) karena persentase laju kematian individu pada populasi (b) yang tinggi sebelum usia reproduktif tercapai. Untuk mengimbangi laju kematian yang tinggi agar populasi (b) tetap stabil maka organisme pada populasi (b) harus memiliki laju reproduksi yang tinggi juga. Contoh organisme populasi (a) adalah manusia, (b) adalah burung, (c) adalah ikan. 35
  35. 35. 5. Jawaban : E Komensalisme terjadi antara teritip dan paus dimana teritip mendapat tempat untuk hidup sedangkan paus tidak dirugikan dengan menempelnya teritip di badannya. Kompetisi terjadi antar teritip dalam memperoleh tempat untuk menempel dan untk mendapat makanan. Mutualisme terjadi antara burung camar dan paus dimana pada suatu waktu paus akan berenang di permukaan air dan burung camar akan hinggap di badan paus untuk memakan teritip-teritip yang menempel di badan paus, paus memperoleh keuntungan dengan hilangnya teritip dari badannya akan mengurangi gesekan pada badan paus ketika berenang. 6. Jawaban : B Gangguan pada ekosistem bukannya membantu pencapaian equilibrium melainkan menurunkannya. Tetapi bukan berarti gangguan pada ekosistem selalu bersifat negatif, pada ekosistem tertentu gangguan seperti kebakaran di hutan dapat bermanfaat dalam perputaran siklus nutrisi di tanah dan juga dapat membantu dalam regenerasi tumbuhan hutan dengan cara memberikan ruang bagi benih-benih tumbuhan yang baru untuk tumbuh. 7. Jawaban : E Pada interaksi antara tumbuhan Ficus (strangler fig) dan pohon awalnya bersifat komensalisme dimana Ficus menempel pada pohon hanya untuk mendapat cahaya matahari, tetapi lama-kelamaan Ficus akan semakin besar dan membelitkan cabangcabang batangnya pada pohon yang ditempelinya sampai pohon yang ditempelinya mati. Alelopati pada tumbuhan adalah suatu tindakan defensif yang dilakukan oleh suatu tumbuhan untuk mengurangi kompetitor dalam memanfaatkan sumber daya di sekitarnya, umumnya tindakan defensif ini dilakukan dengan mengeluarkan suatu senyawa (sering disebut senyawa alelopati) yang bersifat toksik bagi organisme lain yang ada disekitar tumbuhan tersebut. Contoh pohon pinus akan mengeluarkan suatu senyawa alelopati pada tanah disekitarnya sehingga tumbuhan lain tidak bisa hidup di sekelilingnya. Terdapat dua tipe tumbuhan herba pada daerah hutan tropis yaitu “shade tolerant” dan “shade intolerant”. Herba “shade tolerant” adalah herba yang dapat tumbuh dengan baik dalam keadaan yang kurang mendapat cahaya karena lebatnya kanopi pohonpohon di hutan tropis sedangkan herba “shade intolerant” adalah kebalikan dari herba “shade tolerant”. Herba “shade intolerant” baru dapat tumbuh dengan baik apabila terjadi “gap” atau lubang besar pada daerah hutan akibat tumbangnya pohon-pohon besar sehingga sinar matahari dapat masuk ke dasar hutan dengan sempurna tapi akibatnya herba “shade tolerat” akan mati atau tidak dapat tumbuh. BIOSISTEMATIK 1. Protozoa -- Crustacea 2. Diptera 36
  36. 36. 3. 4. Organisme multiseluler, eukariotik dan dapat berfotosintesis 5. Persamaan bryophyte & pteridophyta : spora, metagenesis, dapat berfotosintesis ; Perbedaan bryophyte & pteridophyta : dominasi sporofit/gametofit, sistem pembuluh, sistem akar 6. Spora adalah alat reproduksi vegetatif, bersifat haploid dan dapat tumbuhan/berkembang menjadi individu; Biji adalah alat reproduksi generatif, bersifat diploid, berisi zigot dan cadangan makanan dan dapat tumbuh/berkembang menjadi individu; Gamet adalah alat reproduksi hasil pembelahan reduksi/meiosis, kromosom haploid dan dapat menjadi individu setelah mengalami peleburan (perkawinan), kecuali dalam kasus partenogensis. **** 37
  37. 37. PROBLEM SET II BIOLOGI SEL MOLEKULER & MIKROBIOLOGI 4. Pernyataan mana yang tidak selalu benar tentang virus dengan genom DNA? Replikasi virus melibatkan proses translasi pada ribosom sel A. Nukleokapsid virus dibungkus oleh membran lipid B. Genom virus dibungkus oleh protein C. Gen-gen virus ditranskripsi sebelum terjadi replikasi DNA virus 5. Bila DNA dengan urutan 5'- ATTGATCCTGA 3' dijadikan templat untuk transkripsi, maka akan dihasilkan asam nukleat dengan urutan: 5'- ......................................................................................... 3’ 6. Beri tanda (+) bila makromolekul pada tabel di bawah ini dapat mempunyai aktivitas katalitik dan tanda (-) bila tidak. (+) = sisi pemotongan enzim (-) = bukan sisi pemotongan enzim 38
  38. 38. 8. Bila n adalah jumlah DNA yang terdapat dalam gamet dari organisme diploid, tentukan jumlah DNA pada tahap siklus sel di bawah ini: 9. Waktu lahir, mata seorang anak berwarna biru, tetapi sekarang warna matanya coklat. Pernyataan mana di bawah ini yang dapat menjelaskan fenomena tersebut: A. Anak tersebut tidak mempunyai gen untuk pigmen mata coklat waktu lahir. B. Warna mata waktu lahir dipengaruhi oleh gen ibu. C. Aktivator gen penghasil pigmen coklat belum aktif waktu lahir. D. Represor gen penghasil pigmen coklat belum aktif waktu lahir. 10. Anda telah mengidentifikasi suatu gen untuk sintesis pigmen pada suatu mikroorganisme patogen. Ketika anda melakukan 'plating' pada mikroba ini untuk memperoleh koloni tunggal, diperoleh 50% koloni berpigmen dan sisanya tidak berpigmen. Jika salah satu dari koloni-koloni yang tidak berpigmen tersebut ditumbuhkan dan dilakukan 'plating' sama seperti sebelumnya, 50% koloni yang dihasilkan berpigmen. Jika salah satu dari koloni berpigmen yang dihasilkan tersebut diisolasi, ditumbuhkan pada kultur dan dilakukan 'plating' agar diperoleh satu koloni, sebanyak 50% koloni yang dihasilkan tidak berpigmen. Pemeriksaan gen pigmen itu sendiri pada genom koloni berpigmen dan tidak berpigmen menunjukkan tidak adanya perbedaan struktural pada gen tersebut, tetapi urutan yang bersebelahan dengan gen tersebut berbeda pada setiap tipe pigmen. Berikut ini manakah yang merupakan penjelasan terbaik dari pengamatan di atas? A. Gen-gen pigmen diselingi dengan suatu transposon B. Gen-gen pigmen diregulasi melalui suatu urutan DNA invertible C. Gen-gen pigmen berada pada suatu plasmid D. Gen-gen pigmen berada pada suatu bakteriofag yang terintegrasi 11. Selama tahap infeksi lanjut, Listeria monocytogenes memiliki resistensi yang tinggi terhadap perlakuan dengan antibiotik gentamisin, sedangkan pada tahap infeksi awal mikroba tersebut cukup rentan. Pernyataan manakah yang paling tepat menggambarkan mekanisme kolonisasi sesuai pengamatan tersebut? A. Flagella pada Listeria monocytogenes membantunya berasosiasi dengan jaringan B. Listeria monocytogenes bermutasi dengan sempurna sehingga resisten sepenuhnya terhadap gentamisin C. Sekali saja inang terinfeksi, bakteri tersebut kehilangan kerentanannya pada semua antibiotik D. Gentamisin tidak masuk ke dalam sel-sel eukariotik 12. Anda menemukan bahwa suatu mikroorganisme baru yang tumbuh pada minuman ringan (Diet Coke) yang menggunakan aspartam (pemanis buatan) dalam keadaan tanpa oksigen melalui fermentasi dan menghasilkan asam butirat. Hal ini memberitahukan apa kepada Anda tentang metabolisme aspartam? A. Merupakan sumber yang rendah energi B. Aspartam dapat diproses menjadi senyawa antara/intermediet kaya energi C. Penggunaannya bergantung pada rantai transport elektron D. Merupakan suatu prekursor asam amino 39
  39. 39. 13. Proses denitrifikasi menggunakan nitrogen dalam bentuk teroksidasi sebagai ……… dan secara bertahap dapat menghasilkan gas N2. A. Akseptor elektron terminal B. Sumber energi C. Substrat fermentasi D. Pembawa elektron 14. Proses transport elektron berbalik (reverse) pada mikroba fotosintetik dan mikroba kemolitotrofik digunakan saat kondisi manakah? A. Kondisi anaerob B. Kekurangan energi cahaya C. Level ATP seluler yang tinggi D. Level yang rendah dari pembawa elektron (contoh: NADH, NAD(P)H, FADH2) 15. Di bawah ini merupakan peta dari daerah DNA yang ingin anda petakan dengan analisis Restriction Fragment Length Polymorfism (RFLP). Garis vertikal dengan huruf dibawahnya menunjukan daerah pemotongan dari enzym Pst I. Daerah 3 dan 4 adalah polimorfik dan yang lain tidak. Jarak pemotongan antara Pst I diberikan pada gambar di atas. Panjang probe yang digunakan untuk mendeteksi RLFP di tunjukan oleh garing lurus di atas peta pemotongan. Anda memotong DNA dari individu yang berbeda dengan Pst I, mengelektroforesisnya, mem-blot mereka ke dalam membran, dan hibridisasi dengan probe yang diberi label radioaktif. Gambarlah larik-larik pita DNA yang muncul apabila DNA berasal dari individu yang homozigot dengan haplotipe sebagai berikut: 16. Anda memetakan gen yang bertanggung jawab terhadap penyakit genetis pada manusia. Anda tahu bahwa gen tersebut dapat dihibridisasi dengan probe b-101 pada metode RFLP. Berdasarkan pengetahuan tersebut, anda menghibridisasi DNA yang berasal dari hibrid sel tikus dan manusia. Tabel berikut menunjukan keberadaan jenis kromosom manusia pada tiap sel hibrid, dan juga hasil hibridisasinya dengan probe. Kromosom manakah yang membawa penyakit menurun tersebut? 40
  40. 40. 17. Suatu polipeptida panjangnya sepuluh asam amino dan hanya terdiri atas tiga jenis asam amino saja; leusin (L), serin (S) dan sistein (C). Polipeptida tersebut diberi perlakuan enzim yang memotong ikatan peptida tertentu. Potongan-potongan molekul berikut ini diperoleh dari campuran reaksi. Urutan sepuluh asam amino pada polipeptida di atas adalah…. A. LSCLSCLSCL B. LSLSCSLCCC C. CCCLSLSCSL D. SLCCCLSLSC 18. Bakteri penyebab tetanus hanya dapat dibunuh dengan pemanasan yang lama di atas titik didih. Hal ini mengindikasikan bahwa bakteri tetanus…. A. memiliki dinding sel yang mengandung peptidoglikan B. melindungi diri sendiri dengan menyekresikan antibiotik C. mensekresikan endotoksin D. autotrof E. menghasilkan endospora 19. Suatu galur E. coli yang tidak memiliki DNA polymerase I akan mengalami defisiensi dalam …..... DNA A. perbaikan B. metilasi C. penggabungan D. degradasi E. transkripsi 20. Penyelesaian fase S dari siklus sel suatu sel mammalia ditandai dengan berikut ini kecuali.............. A. Kandungan histon per sel dua kali lipat dibanding ketika sel berada pada G1 B. Pada DNA yang mengalami replikasi, basa-basa nitrogen yang baru terbentuk berpasangan dengan basa-basa parental C. Setiap kromosom yang mengalami replikasi memiliki empat telomer D. Sister chromatids berpisah dari satu sama lain E. Nukleus mengandung jumlah DNA yang ekivalen dengan suatu sel tetraploid yang berada pada G1 41
  41. 41. MORFOLOGI, ANATOMI DAN FISIOLOGI TUMBUHAN 1. Pernyataan manakah dibawah ini yang TIDAK berhubungan dengan kolenkim ? A. Merupakan jaringan yang ditemukan pada organ yang sedang tumbuh B. Hanya terbentuk pada akar karena pengaruh cahaya C. Terdapat pada bagian perifer dari petiola D. Terdapat pada bagian perifer dari batang tumbuhan berkayu E. Terdapat pada bagian perifer dari lamina Ke empat kotak pada diagram dibawah ini adalah untuk soal No. 2 s/d 5, tuliskan jawaban anda sesuai dengan nama strukturnya! 6. Tuliskan rumus dari diagram bunga berikut! 7. Beberapa proses fisiologis yang terjadi pada suatu tanaman hanya terjadi setelah adanya pencahayaan dengan spektrum penuh dari warna cahaya putih atau komponen warna cahaya merah; warna cahaya lainnya, monokromatik tidak dapat menyebabkan pengaruh tersebut, proses tersebut disebabkan karena adanya pengaturan melalui .... A. Klorofil B. Auksin dan Giberelin C. Fitokrom D. Pigmen flavonoid E. Informasi diatas tidak cukup untuk menjawab pertanyaan 42
  42. 42. 10. Perhatikan gambar di bawah ini, pigmen fotosintesis apakah yang ditunjuk oleh huruf: A. ……………… B. …………….. C. ……………… Perhatikan gambar di bawah ini dan jawab pertanyaan 11 s/d 15 berdasarkan pada gambar tersebut! 11. Tuliskan bagian-bagian yang ditunjuk pada preparat daun ini tuliskan pula macam penampangnya. penampang: …………………………. 12. Berdasarkan proses fotosintesisnya, tumbuhan yang memiliki struktur daun seperti di atas termasuk ke dalam tumbuhan……………………………………………………. alasan …………………………………………………………………………………………… 13. Pada jaringan apa proses fotosintesis terjadi ? ……………………………………… 14. Stomata berfungsi untuk …………………………………………………………….. 15. Tumbuhan ini termasuk ke dalam tumbuhan kelas ……………………………………. Alasan …………………………………………………………………………………… 43
  43. 43. MORFOLOGI, ANATOMI DAN FISIOLOGI HEWAN Perhatikan baik-baik diagram di atas dan isilah pertanyaan di bawah ini! 1. Bila anda minum susu, maka destinasinya adalah: a. ------------------b. ------------------c. ------------------2. Bila anda makan kentang goreng, maka destinasinya adalah: a. ------------------b. ------------------Pertanyaan No.3-6 berdasarkan gambar di bawah ini. 44
  44. 44. Perhatikan baik-baik grafik dan gambar di atas! Jawablah pernyataan di bawah ini B (benar) atau S (salah) 3. Pemanis buatan menyebabkan munculnya bladder cancer (kanker kantung kemih) 4. Hasil di atas masih berupa hipotesis karena hasil eksperimen 1 tidak sama dengan eksperimen 2 5. Gambaran di atas merupakan penerapan dari metoda ilmiah 6. Hati merupakan target organ dari pemanis buatan Perhatikan gambar di samping! Jika anda makan masakan Padang yang sangat pedas, dan anda minum 3 gelas (tiap gelas volumenya 250 ml), maka: 7. volume chyme ---------------- ml 8. Volume feses ------------------ ml Tetapi jika anda berolah raga dan setelahnya anda minum es the manis 500 ml, maka: 9. volume chyme ----------------- ml 10. volume feses ------------------- ml 11. Seorang anak mengalami urinasi yang tidak normal, yaitu sangat jarang meskipun banyak minum air. Pemeriksaan terhadap parameter darah menunjukan bahwa anak ini memiliki tekanan darah yang tinggi, tekanan osmotik darah yang normal dan hematokrit yang rendah. Dari data tersebut maka kemungkinan kelainan pada anak tersebut terjadi pada........ A. Neurohipofisis B. Pankreas C. Medula adrenal D. Korteks adrenal E. Kelenjar tiroid. 45
  45. 45. 12. Perkembangan sel Limfosit T di Thimus dipengaruhi oleh keberadaan sel-sel epitel khusus yang terdapat di bagian korteks. Apabila sel ini tergangu pertumbuhannya maka sel T tidak dapat berkembang atau mati. Saat ini diketahui terdapat dua mutan mencit yang sama-sama tidak mampu memproduksi sel limfosit T dewasa. Mutan tersebut antara lain: scid dan Nu. Untuk mengetahui tempat terjadinya kerusakan, dilakukan percobaan sebagai berikut: (kedua strain memiliki HLA (MHC) yang sama). 1. Persilangan antara tikus Scid dan Nu yang homozigot menghasilkan F1 yang mampu memproduksi limfosit T normal. 2. Pencangkokan sumsum tulang dari tikus Nu ke Scid mengakibatkan tikus Scid dapat memproduksi sel limfosit T normal, hasil yang sama juga diperoleh apabila tikus Scid dicangkok dengan sumsum tulang yang berasal dari tikus F1 pada percobaan 1. 3. Pencangkokan kelenjar Thimus dari tikus Nu dan F1, ke tikus Scid tidak memberikan perubahan apa pun. 4. Pencangkokan sumsum tulang yang berasal dari F1 dan Scid ke tikus Nu tidak memberikan perubahan apa pun pada tikus Nu. 5. Pencangkokan Thimus yang berasal dari tikus Scid dan F1 ke tikus Nu mengakibatkan tikus Nu dapat memproduksi limfosit T normal. Dari keterangan di atas tentukanlah strain yang mengalami kerusakan pada Thimus dan strain yang mengalami kerusakan pada stem cell limfosit T di sumsum tulang belakang! 13. Apabila kedua jenis tikus memiliki HLA (MHC) yang berbeda, dan apabila dilakukan penyambungan pembuluh darah, maka pernyataan berikut yang benar adalah...... A. Tikus Nu akan mati atau sakit karena diserang oleh sel limfosit T yang mengalami pendewasaan pada tikus Scid B. Tikus Scid akan mati atau sakit karena diserang oleh sel limfosit T yang mengalami pendewasaan pada tikus Nu C. Tikus Nu akan mati atau sakit karena sel-selnya diserang oleh sel limfosit T yang berasal dari sumsum tulangnya sendiri. D. Kedua tikus akan tetap hidup secara normal dan dapat menerima limfosit T yang diproduksi dari hasil penggambungan pembuluh darah tersebut. E. Jawaban A dan C benar 14. Apabila tikus Scid yang mampu memproduksi limfosit T normal pada percobaan no. 2 diberi perlakuan cangkok kulit dengan resepien pada tabel, dan andaikan tikus Nu dan Scid memiliki HLA yang berbeda, tentukanlah apakah kulit tersebut diterima atau ditolak! 15. Seorang anak mengalami masalah dengan keseimbangan tubuhnya. Secara teoretis kerusakan tersebut dapat dipengaruhi oleh rusaknya pusat keseimbangan di otak, di saluran setengah lingkaran, atau di sakulus dan utrikulus. Pusat keseimbangan di otak mendapat informasi dari saluran setengah lingkaran, utrikulus dan sakulus, dan mata. Untuk mengetahui tempat terjadinya kerusakan, dokter melakukan pengujian sebagai berikut: Pasien diminta berdiri dengan tangan mengarah ke depan. Pada keadaan ini pasien dapat berdiri dengan tegak tanpa goyah. Selanjutnya dokter meminta pasien untuk menutup matanya dengan posisi tubuh yang tidak berubah. Hasilnya, pasien tersebut perlahan-lahan goyah dan kehilangan keseimbangan. 46
  46. 46. Setelah selesai pengujian, dokter bertanya apakah pasien mengetahui arah pergerakan tubuhnya ketika goyah. Pasien menjawab bahwa ia mengetahuinya. Dari hasil percobaan tersebut, area manakah dari ketiga area keseimbangan tersebut yang mengalami kerusakan.? 16. Perhatikan diagram dibawah ini! a. Apabila anda melakukan inseminasi buatan maka sebaiknya dilakukan pada periode........(pilih A, B, C atau D) b. Apabila anda akan melakukan transfer embrio, embrio dalam keadaan blastokista, maka sebaiknya dilakukan pada saat....... c. Apabila tidak terjadi pembuahan maka dinding endometrium akan meluruh, proses ini dapat dicegah dengan penyuntikan hormon......... 17. Kembar identik merupakan kembar yang berasal dari satu sel telur yang dibuahi oleh satu sperma. Akibat hal tertentu maka hasil pembelahan dari zigot kemudia akan memisah dan membentuk embrio sendiri-sendiri. Apabila pemisahan terjadi pada saat blastokista maka pernyataan yang tepat adalah..... A. Masing-masing bayi akan memiliki plasenta dan kantung amnion sendiri. B. Bayi akan memiliki plasenta yang sama, namun tiap bayi akan memiliki amnion sendiri C. Kedua bayi akan memiliki plasenta dan amnion yang sama D. Masing-masing bayi akan memiliki umbilikalnya sendiri tetapi berada pada kantung amnion yang sama E. Jawaban C dan D benar 47
  47. 47. 18. Doris mengalami penyempitan pada bronkus primer dari paru-paru kanannya. Berdasarkan keterangan tersebut buatlah gambar perbandingan kurva kejenuhan oksigen dari hemoglobin pada paru-paru kanan dan kiri! 19. Telah dilakukan pengukuran sebagai berikut terhadap dua orang yang berbeda. Hasilnya adalah sebagai berikut: orang 1: detak jantung, 75 bpm; stroke volume, 60 ml orang 2: detak jantung, 90 bpm; stroke volume, 95ml Manakah orang yang memiliki jumlah pengembalian darah dari vena ('venous return') paling tinggi? Dan orang yang mana memiliki waktu pengisian ventrikel paling lama? 20. Dua buah saraf yang melakukan hubungan sinaps diisolasi dalam keadaan utuh (hubungan sinaps tidak berubah), Hubungan antar sel ini bersifat Eksisatori (EPSP). Apabila sel saraf pre sinaps dirangsang dengan rangsang listrik maka neuron presinaps akan mengakibatkan depolarisasi pada membran sel post sinaps. Apabila depolarisasi pada membran post sinaps cukup kuat maka akan menimbulkan timbulnya potensial aksi di bukit akson. Tentukanlah apakah terjadi potensial aksi pada neuron post sinaps atau tidak (diketahui bahwa potensial aksi terjadi apabila saraf pre sinaps diberi rangsang sebesar 5 volt) jika diberikan perlakuan sebagai berikut pada sel pre sinaps: 1. Diberikan perlakuan dengan rangsang 5 volt dan cairan yang rendah kalsium. 2. Diberikan rangsang 5 volt tapi diberikan substansi yang menghambat pembukaan +. protein channel ion Na 3. Diberikan rangsang 5 volt dan larutan yang mampu meningkatkan masuknya ion Ca ke dalam sel. I. Isilah titik-titik berikut ini dengan jawaban yang telah disediakan! 1. serabut otot 2. sarkomer 3. retikulum sarkoplasma 4. neuromuscular junction 5. tetanus 6. motor unit 7. tendonitis 8. insersi 9. defisit oksigen a. b. c. d. e. ……….. unit struktural dan fungsional miofibril, mengandung filamen aktin dan miosin. …………………….. akhiran otot yang menempel pada tulang yang bergerak. …………………….. oksigen yang dibutuhkan untuk memetabolisme asam laktat, substansi yang terakumulasi selama aktivitas olahraga yang tinggi. ……………………… kontraksi otot yang kuat dan berlangsung lama/terus menerus. ............................. Motor neuron dan serabut otot bekerjasama/berasosiasi pada bagian ini. 48
  48. 48. II. Perhatikan gambar di bawah dan jawablah pertanyaan berikut ini! 1. 2. 3. 4. 5. ……………………..periode antara rangsangan dan awal/inisiasi kontraksi ...................................periode dimana otot memendek Untuk mempelajari kontraksi otot maka grafik di atas disebut ....................... ................................keadaan dimana energi cadangan habis ..............................kondisi disaat otot kembali ke ukuran semula ETOLOGI 1. Burung berkicau spesies A diketahui memiliki waktu periode kritis antara 10 hingga 50 hari. Seekor burung spesies A yang baru menetas dipelihara dalam kandang yang terisolasi, tetapi saat burung tersebut berumur 2 s/d 7 minggu, burung tersebut diberi kesempatan untuk mendengarkan burung berkicau spesies B. Setelah berumur 1 tahun: A. burung spesies A tersebut akan memiliki nyanyian sama seperti burung spesies A lainnya B. burung spesies A tersebut akan memiliki nyanyian sama seperti burung spesies B C. burung spesies A tersebut akan memiliki nyanyian yang unik, tidak mirip nyanyian burung spesies maupun spesies B D. burung spesies A tersebut tidak akan bisa bernyanyi. 49
  49. 49. Soal untuk No. 2-4 Sekelompok peneliti melakukan kajian hubungan antara beberapa induk kera dan anak-anaknya menggunakan induk semang buatan yang menyusui anak-anak kera tersebut. Setiap induk semang buatan memiliki ciri-ciri yang sama dengan induk asli kera tersebut, maupun ciri-ciri yang berbeda. Dua (2) induk semang buatan digunakan dalam kajian tersebut; satu (1) ekor dibuat dari kayu yang dicat, memiliki muka yang sangat mirip dengan induk kera asli (induk semang A), satu (1) ekor lagi juga dibuat dari kayu, tidak dicat, tetapi diberi pakaian berbulu yang sangat mirip seperti induk aslinya (induk semang B). Kedua induk buatan (A dan B) dapat diberi botol berisi susu. Kelompok anak kera pertama (I) di tempatkan dengan induk semang A dan B, tetapi hanya induk semang B yang memiliki botol berisi susu. Kelompok anak kera kedua (II) jumlahnya sama dengan kelompok I, di tempatkan dengan induk semang A dan B, tetapi hanya induk semang A yang memiliki botol berisi susu. Kedua kelompok (I dan II) dikondisikan secara seragam (baik secara fisiologis maupun faktor lingkungan yang mempengaruhinya). Grafik dibawah ini menggambarkan umur anak kera (hari) dengan lama setiap kelompok anak kera menghabiskan waktu (jam/hari) bersama induk semang buatan. Garis B1 adalah kelompok I yang diberi susu oleh induk semang B Garis A1 adalah kelompok I yang diberi susu oleh induk semang A Garis B2 adalah kelompok II yang diberi susu oleh induk semang A Garis A2 adalah kelompok II yang diberi susu oleh induk semang B 2. Dari keterangan dan data diatas, dapat diketahui bahwa kondisi fisik induk semang buatan dapat menarik perhatian anak-anak kera, kondisi fisik tersebut adalah : A. Warna dari tubuh induk semang kera B. Muka induk semang kera C. Ukuran tubuh induk semang kera D. Tekstur tubuh induk semang kera E. Dari semua keterangan diatas belum cukup dibuat kesimpulan 50
  50. 50. 3. Pernyataan manakah yang benar dan didukung oleh data dari kajian diatas A. Kontak antara induk semang buatan dan beberapa kelompok anak kera saat periode menyusui tidak memberikan keuntungan fisiologis B. Penempatan jenis botol susu pada induk semang dapat menolong anak kera dalam mengenal induknya C. Seluruh anak kera dapat mengenali induk kera, sehingga semua jenis induk semang buatan dapat digunakan sebagai penganti induk asli D. Induk semang buatan yang tidak memberikan susu tidak disukai oleh anak kera E. Kelompok Anak kera meluangkan waktu yang lebih banyak berhubungan dengan induk semang buatan yang sesuai 4. Dari kajian diatas, untuk mengetahui daya pikat induk semang B dengan lebih baik lagi, sebaiknya dilakukan : A. Kajian dengan perlakuan seperti diatas diulang dan ditambahan induk semang asli B. Perlakuan percobaan sudah cukup dan kajian dapat dilanjutkan hingga umur tertentu C. Kajian dilanjutkan, setelah periode waktu tertentu anak-anak kera tersebut di tempatkan kembali dengan induk aslinya. D. Kawinkan kelompok A1, A2, B1 dan B2, kemudian lakukan pengamatan terhadap keturunannya 5. Anjing jantan mengangkat satu kaki belakangnya ketika buang air, sedangkan anjing betina berjongkok. Anak anjing jantan yang disuntik hormon estrogen ketika baru lahir akan menunjukkan perilaku seperti .............................................. Dalam jangka waktu berapa lama? ......................................................... GENETIKA DAN EVOLUSI Pertanyaan 1 & 2 Ada orang yang lilin telinganya kering dan ada yang lengket. Dari pengamatan beberapa keluarga diperoleh hasil: 1. Bagaimana jenis lilin telinga diturunkan? A. Lilin lengket dominan B. Lilin kering dominan C. Ada epistasis D. Tidak mungkin ditentukan berdasarkan data yang diberikan 2. Mengapa tidak ada rasio 1 : 1 atau 3 : 1 pada data Tabel di atas? A. Jumlah anak terlalu sedikit B. Genotipe pasangan orang tua dengan fenotipe yang sama belum tentu sama. C. Tidak ada orang tua yang homozigot resesif D. Tidak ada orang tua yang homozigot dominan 51
  51. 51. Pertanyaan 3-4 Penyakit galaktosemia merupakan penyakit akibat gen resesif dan gejala penyakit dapat dikurangi dengan membatasi jumlah laktosa dan glukosa yang dimakan. Ida dan Adi sama-sama heterozigot untuk gen galaktosemia. 3. Bila Ida melahirkan dua anak kembar fraternal berapa probabilitas kedua anak adalah perempuan yang sakit galaktosemia? 4. Bila Ida dan Adi mempunyai empat anak (tidak ada yang kembar), berapa probabilitas paling sedikit satu anak sakit galaktosemia? 5. Kebotakan pada manusia dianggap sebagai sifat yang dikendalikan oleh suatu alel B, gen autosom. Anggapan yang lebih mendalam yaitu bahwa alel tersebut adalah dominan pada pria dan resesif pada wanita, ” dipengaruhi jenis kelamin”. Jika seorang pria botak dan seorang wanita tidak botak, dalam suatu populasi perkawinan acak yang terdiri dari 51% pria berkepala botak, memiliki satu orang anak, berapa kemungkinan bahwa anak-anaknya menjadi botak? 6. Beberapa lalat Cc Dd disilangkan dengan lalat cc dd. Keturunannya: 903 Cc Dd, 897 cc dd, 98 Cc dd dan 102 cc Dd. Jarak c d : ....................... CM 7. Diagram di bawah menggambarkan alur logika teori evolusi. Isilah kotak kosong pada diagram berikut ini dengan kesimpulan yang tepat. 8. Pilihlah Benar atau Salah untuk pernyataan berikut ini. B-S B-S Seleksi alam menyebabkan perubahan genetik pada individual. Perubahan evolusioner mengarah pada 'yang lebih baik'. 52
  52. 52. 9. Mekanisme isolasi reproduktif EKOLOGI 1. Dalam suatu ekosistem, organisme manakah yang memiliki jumlah terbanyak ? A. Produsen B. Konsumen primer C. Konsumen sekunder D. Konsumen tersier E. Tergantung iklim yang ada pada ekosistem tersebut 2. Fiksasi nitrogen dalam siklus nitrogen dapat dilakukan melalui beberapa cara di bawah ini kecuali: A. Mikroorganisme yang ada di dalam tanah B. Proses industri melalui temperatur dan tekanan yang tinggi C. Mikroorganisme dalam nodul-nodul akar pada tumbuhan leguminose D. Beberapa jenis tumbuhan yang dapat mengabsorbsi langsung gas nitrogen E. Ketika terjadi petir/kilat di langit 3. Manakah diantara pernyataan di bawah ini yang menunjukkan proses nitrifikasi pada siklus nitrogen: A. Konversi dari ion amonium menjadi nitrat B. Konversi dari ion amonium menjadi nitrit C. Konversi dari gas nitrogen menjadi nitrit D. Konversi dari gas nitrogen menjadi nitrat E. Konversi dari nitrit menjadi nitrat 4. Manakah dari pernyataan di bawah ini yang paling tepat dalam mendeskripsikan peran detritivor dalam siklus karbon ? A. Merupakan mikroorganisme yang memisahkan senyawa organik dari materi yang telah mati B. Merupakan jamur yang menggunakan pencernaan ekstra-selular untuk memisahkan senyawa organik dari materi yang telah mati C. Merupakan organisme yang memakan kotoran makhluk hidup D. Merupakan hewan yang memperluas permukaan materi-materi yang sudah mati untuk dekomposer E. Merupakan hewan yang memisahkan senyawa organik dari materi yang telah mati 53
  53. 53. 5. Manakah dari pernyataan di bawah ini yang menunjukkan faktor yang bergantung pada kepadatan populasi (density dependent factor) yang mengendalikan kepadatan suatu populasi : I. Insektisida yang digunakan untuk mengendalikan serangga hama II. Tupai yang bertahan hidup pada periode musim dingin III. Berkurangnya populasi burung karena kurangnya sumber makanan pada musim dingin IV. Meningkatnya hama wereng pada pertengahan musim tanam padi V. Siput dalam jumlah besar yang makan pada beberapa tanaman kubis Pilihlah salah satu jawaban yang benar di bawah ini: A. I dan II B. I, II, dan III C. III dan IV D. III E. III, IV, dan V 6. Dari grafik kelulushidupan di bawah ini pilihlah penyataan mana yang benar : A. B. C. D. E. X = populasi ikan; Y = populasi burung; Z = populasi mamalia X = populasi mamalia; Y = populasi burung; Z = populasi ikan X = populasi burung; Y = populasi ikan; Z = populasi burung X = populasi burung; Y = populasi mamalia; Z = populasi ikan X = populasi mamalia; Y = populasi ikan; Z = populasi burung 54
  54. 54. 7. Berdasarkan grafik pertumbuhan ragi di bawah ini, fase manakah yang menunjukkan “faktor internal“ sedang berperan pada populasi ragi tersebut : Pilihlah salah satu jawaban yang benar : A. I B. II C. I dan II D. III dan IV E. IV 8. Berdasarkan grafik pertumbuhan ragi di atas, disebut fase apakah fase III ? A. Fase Lag B. Fase Log C. Fase Leg D. Fase Stasioner E. Fase Penurunan 9. Tupai merah adalah hewan asli yang ada di kepulauan Inggris. Pada tahun 1876, tupai abu-abu Amerika dimasukkan ke Inggris yang menyebabkan punahnya tupai merah Inggris. Tupai merah Inggris saat ini hanya ditemukan di pulau-pulau yang tidak terdapat tupai abu-abu Amerika di dalamnya. Manakah diantara pernyataan di bawah ini yang paling benar ? A. Tupai merah dan abu-abu berbagi habitat dan relung yang sama B. Tupai merah dan abu-abu berbagi habitat yang sama C. Tupai merah dan abu-abu berbagi relung yang sama D. Tupai abu-abu menyerang tupai merah E. Tupai merah bermigrasi ke daerah yang tidak terdapat tupai abu-abu 55
  55. 55. BIOSISTEMATIK 1. Gambar 1 menggambarkan sebuah pendapat mengenai sejarah evolusi pada kerajaan tumbuhan. Anda diminta melengkapi gambar di atas dengan mengganti angka dengan karakter yang dimiliki oleh organisme di atas. Yaitu berurutan berdasarkan angka: A. Pembuluh, biji, berbunga B. Uniseluler, berspora, berstrobilus C. Metagenesis, rizoid, spora D. Multiseluler, reproduksi vegetatif, reproduksi generatif E. Rizoid, akar serabut, akar tunggang 2. Gambar 2 di atas menggambarkan siklus hidup lumut. Lengkapilah gambar di atas dengan pernyataan di bawah ini, berurutan dari angka 1 ke angka 2! A. Mitosis, meiosis B. Meiosis, meiosis C. Fertilisasi, amfimiksis D. Meiosis, fertilisasi E. Mitosis, gametofit 56
  56. 56. 3. Pada gambar 3 di atas, angka nomor 5 (lima) menunjukkan adanya sebuah proses. Proses tersebut adalah .... A. Meiosis & mitosis B. Mitosis & Meiosis C. Differensiasi & Meiosis D. Differensiasi & Mitosis E. Diferensiasi 4. Gambar 4 di atas merupakan siklus hidup angiospermae. Proses manakah (yang ditunjukkan dengan angka) yang terjadi pada fase gametofit : A. 1,2,3 B. 4,5,6 C. 6,1,2 D. 3,4,5 E. 1,3,6 57
  57. 57. 5. Anggota filum Mollusca yang tidak memiliki radula, terutama dari kelas … A. Gastropoda B. Cephalopoda C. Pelecypoda D. Cephalopoda dan Bivalvia E. Scaphopoda dan Bivalvia 6. Kekhasan dan keunikan pada filum Mollusca yaitu dengan dimilikinya …. A. Radula B. Tentakel C. Cangkang kapur D. Radula dan cangkang kapur E. Nefridia 7. Trochophore merupakan stadium larva pada kelompok takson hewan … A. Bryozoa, Rotifera, Bivalvia dan Polychaeta B. Bryozoa, Cnidaria, Annelida dan Mollusca C. Porifera, Cnidaria, Turbellaria dan Oligochaeta D. Porifera, Annelida, Mollusca dan Echinodermata E. Echinodermata, Crustacea, Annelida dan Mollusca **** 58
  58. 58. KUNCI DAN PEMBAHASAN PROBLEM SET II BIOLOGI SEL MOLEKULER & MIKROBIOLOGI 1. Jawaban: mitokondria Mitokondria merupakan organel di dalam sel yang memiliki membran ganda. Mitokondria mengandung enzim-enzim yang berperan dalam proses penghasilan energi yaitu dalam proses siklus krebs dan transfer electron. Mito kondria juga memiliki ribosom sendiri yang berbeda dengan ribosom sel eukariot dan lebih mirip dengan ribosom prokariot. Selain ribosom mitokondria juga memiliki DNA berbentuk sirkular yang mirip dengan DNA prokariot. 2. Jawaban: 12 % Karena A berpasangan dengan T dan C dengan G maka jumlah Adenin = (100-(38x2))/2 = 12% 3. Jawaban: 1900 cDNA merupakan hasil reverse transkripsi dari mRNA. Satu rantai cDNA sama dengan jumlah basa pada mRNA. Seperti diketahui panjang cDNA 5,7 kb = 5700 basa, satu kodon sama dengan 3 basa. Sehingga jumlah asam aminonya adalah 5700/3 = 1900 4. Jawaban: B Virus-virus yang memiliki membran fosfolipid sebagai pembungkus kapsidnya adalah virus dari golongan korona virus seperti virus influenza. 5. Jawaban: 5' UCAGGAUCAAU -3' Sudah jelas. 6. Jawaban: 7. Jawaban: 63
  59. 59. Perhatikan Gambar a sebelah kiri. Pada gel tersebut, probe yang dipergunakan adalah probe dari rRNA 28S sehingga apabila terdapat DNA yang mengkode rRNA 28S atau fragmennya maka pita DNA akan terwarna. Pada gel tersebut terdapat 2 pita dengan panjang yang berbeda, ini berarti terdapat dua fragmen DNA yang mengkode rRNA. Hasil ini hanya akan terjadi apabila potongan terjadi pada daerah 1 dan 2 yang dikombinasikan dengan 3, 4, dan 5. Untuk mengetahui daerah pemotongan lain (apakah 3, 4, atau 5) kita mengecek ke gel kanan pada gambar a. Pada gel tesebut hanya terdapat satu pita, ini berarti daerah pemotongan 4 tidak terjadi. Pita pada gel kanan dan kiri pada gambar a memiliki ukuran yang sama, ini berarti pemotongan pada daerah 3 tidak terjadi, jika pemotongan pada daerah 3 terjadi seharusnya pita pada gel kanan gambar a terletak di atara kedua pita pada gel kiri gambar a. 8. Jawaban: Masing-masing fase dengan jumlah DNAnya. Profase : 4n Akhir fase S : 2n Fase G1 : 4n Fase G2 : 4n Metafase : 4n Apabila jumlah DNA pada gamet adalah n maka jumlah DNA pada sel tubuhnya adalah 2n, sehingga jumlah DNA pada fase G1 adalah 2n. Ketika memasuki fase S DNA direplikasi sehinga jumlah DNAnya menjadi 4n, pada fase-fase berikutnya (G2, profase, dan metafase) jumlah DNA tetap 4n. jumlah ini kembali ke 2n apabila proses mitosis telah selesai. 9. Jawaban: C (sudah jelas) 10. Jawaban: B 11. Jawaban: D 12. Jawaban B Fermentasi merupakan proses metabolime yang hasil akhirnya berupa senyawa antara. Senyawa antara ini bila dioksidasi (ada oksigen) makan energi yang terkandung didalmmnya dapat di ekstrak lebih lanjut. 13. Jawaban: A 14. Jawaban: D 15. Kalau daerah 3 dan 4 ada maka akan dihasilkan 4 fragmen, 1,5;2;1;4. akan tetapi fragmen dengan panjang 1,5 tidak akan teramati karena probe tidak mengenali fragmen tersebut. Kalau 4 tidak ada, maka akan dihasilkan 3 fragmen yaitu 1,5;2;5. akan tetapi yang teramati hanya 2. Dan seterusnya. 64

×