Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

140127 rtg vcfeval vcf comparison tool


Published on

Published in: Technology

140127 rtg vcfeval vcf comparison tool

  1. 1. Comparing Variant Calls GENOME- IN- A- BOTTLE W ORKSHOP Francisco M. De La Vega, D.Sc. Visiting Scholar, Department of Genetics Stanford University School of Medicine In collaboration with Real Time Genomics, Inc.
  2. 2. rtgTools v1.0 A toolkit to compare and analyze VCFs • • • • • • • vcfeval – comparison of VCFs for ROC curves rocplot – draw ROC curves from vcfeval output medelian – counts of Mendelian inheritance errors in pedigrees vcfstats – basic statistics of VCF files vcffilter – filtering of VCFs by scores, etc. vcfannotate – annotation of VCF files vcfmerge – merge VCF files Java compiled code freely available at GiaB repository:
  3. 3. 3 Issues in representation of complex calls Indel in homopolymer MNPs Reference CAAAAAAG Reference Baseline Called C..AAAAG CAAAA..G After replay: Baseline Called CAAAAG CAAAAG Baseline Called CAACGTAAG CAATGTCAG CAATGTCAG
  5. 5. Comparison of variant call set with baseline set Basic rules • Match the baseline and called sequences so as to maximize true positives and minimize false positives and false negatives. • True positives + false negatives = total calls in the baseline • Heterozygous calls match: Both heterozygous and alleles must agree Best path Link mutations ROC Path creation • A path is a selection of subset of calls • Best path: paths that maximize true positives and minimize errors • In theory, exponential number of paths; in practice this can be solved by dynamic programing
  6. 6. Path creation - simple homozygous case Reference Baseline a Called b c d e f g h
  7. 7. Path creation - simple homozygous case Reference Baseline a b c d e f g h e f g h Called Best Path Baseline False negative (excluded) a b c Called False positive (excluded) d
  8. 8. Path creation - simple heterozygous case (non-phased) Reference Baseline a Called b c d e f
  9. 9. Path creation - simple heterozygous case (non-phased) Reference Baseline a b c d e f e f Called Best Path False negative (excluded) Baseline a b c d Called False positive (excluded)
  10. 10. Why weighting is needed? TP + FN = Totalbaseline Reference CAACAACTATCCTC....ATCT....GC Baseline CAACAACTATCCTCATCTATCTATCTGC Called CAACAACTATCCTCATCTATCTATCTGC
  11. 11. Sync points Reference Baseline Called ACAGTCACGG ACGGTCACTG ACGGTTACGG Reference Baseline Called AC AC AC AGT GGT GGT CAC CAC TAC GG TG GG
  12. 12. Weighting where B is the number of baseline variants between the current (Sn) and previous sync points (Sn-1) and C is the number of called variants between the current and previous sync points.
  13. 13. Simple homozygous weighting False negative (excluded) 1 Sync points Baseline Weights a1 b1 c1 d1 e1 f1 Called False positive (excluded) 1 Type TP Sync point Weighted total 6 FP 1 FN 1
  14. 14. Simple heterozygous case (non-phased) weighting False negative (excluded) 2 Baseline a 1 b 1 c 1 d1 e f Called False positive (excluded) 1 Type Sync point Weighted total TP 4 FP 1 FN 2
  15. 15. Complex weighting Baseline a 1 b 1 c 1 d1 e 0.5 f 0.5 Called Type TP 5 FP Sync point Weighted total 0 FN 0
  16. 16. ROC Plot
  17. 17.
  18. 18. Acknowledgements RTG, Hamilton, New Zealand  John Cleary  Len Trigg  Mehul Rathoud Data and tools to compare with phased standard released publicly at NIST Genome-in-a-Bottle repository (s3://giab) This work was done while the presenter was employed by Real Time Genomics Inc., San Bruno, CA. © 2014 Real Time Genomics, Inc. All rights reserved.
