Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
1Д М И Т Р И Й Н О В И Ц К И Й
• математические методы компьютерного
анализа генома, транскриптома, протеома
(омикс- б...
Strand Sequence
First shotgun sequence
• Обнаружение внутривидового
и межвидового полиморфизма.
• Таксономия
• Молекулярные ча...
• Represent each word with a low-dimensional
• Word similarity = vector similarity
• ...
• 2 basic neural network models:
• Continuous Bag of Word (CBOW): use a window of...
• E.g. “The cat sat on floor”
• Window size = 2
Input layer
Hidden layer
Output layer
Input layer
Hidden layer
Output layer
Input layer
Hidden layer
Output layer
Input layer
Hidden layer
Output layer
Input layer
Hidden layer
Output layer
Input layer
Hidden layer
Output layer
Input layer
Hidden layer
Output layer
• Continuous Distributed Representation of
Biological Sequences for Deep Proteomics
and Genomics
• Ehsaned...
Upcoming SlideShare
Loading in …5

DataScienceLab2017_BioVec: Word2Vec в задачах анализа геномных данных и биоинформатики


Published on

DataScience Lab, 13 мая 2017
BioVec: Word2Vec в задачах анализа геномных данных и биоинформатики
Дмитрий Новицкий (Старший научный сотрудник в ИПММС НАНУ)
Этот доклад посвящен bioVec: применению технологии word2vec в задачах биоинфоматики. Сначала мы напомним как работает Word2vec и аналогичные ему методы Word Embedding. Затем расскажем об особенностях Word2vec в применении к геномным последовательностям-- основному виду данных в биоинформатике. Как обучать bioVec, и применять эту технологию к задачам классификации белков, предсказания их функции и др. В заключении мы продемонстрируем примеры кода для обучения и использования bioVec.
Все материалы доступны по ссылке:

Published in: Technology
  • Be the first to comment

DataScienceLab2017_BioVec: Word2Vec в задачах анализа геномных данных и биоинформатики

  2. 2. ВВЕДЕНИЕ: ЧТО ТАКОЕ БИОИНФОРМАТИКА • математические методы компьютерного анализа генома, транскриптома, протеома (омикс- биоинформатика). • разработка алгоритмов и программ для предсказания пространственной структуры биополимеров– РНК и белок - структурная биоинформатика ~ ФОЛДНИНГ • ]моделирование белковых каскадов,предсказание функции белка, регуляторных контуров и т. 2
  3. 3. SHOTGUN & NEXT GEN. SEQUENCING 3 Strand Sequence Original AGCATGCTGCAGTCATGCTTAGG CTA First shotgun sequence AGCATGCTGCAGTCATGCT------- -------------------TAGGCTA Second shotgun sequence AGCATG-------------------- ------CTGCAGTCATGCTTAGGCTA Reconstruction AGCATGCTGCAGTCATGCTTAGG CTA
  5. 5. ВЫРАВНИВАНИЕ ПОСЛЕДОВАТЕЛЬНОСТЕЙ 5 • Обнаружение внутривидового и межвидового полиморфизма. • Таксономия • Молекулярные часы
  6. 6. WORD2VEC : КРАТКОЕ СОДЕРЖАНИЕ • Represent each word with a low-dimensional vector • Word similarity = vector similarity • Key idea: Predict surrounding words of every word • Faster and can easily incorporate a new sentence/document or add a word to the vocabulary 6
  7. 7. REPRESENT THE MEANING OF WORD – WORD2VEC • 2 basic neural network models: • Continuous Bag of Word (CBOW): use a window of word to predict the middle word • Skip-gram (SG): use a word to predict the surrounding ones in window. 7
  8. 8. WORD2VEC – CONTINUOUS BAG OF WORD • E.g. “The cat sat on floor” • Window size = 2 8 the cat on floor sat
  9. 9. 9 0 1 0 0 0 0 0 0 … 0 0 0 0 1 0 0 0 0 … 0 cat on 0 0 0 0 0 0 0 1 … 0 Input layer Hidden layer sat Output layer one-hot vector one-hot vector Index of cat in vocabulary
  10. 10. 10 0 1 0 0 0 0 0 0 … 0 0 0 0 1 0 0 0 0 … 0 cat on 0 0 0 0 0 0 0 1 … 0 Input layer Hidden layer sat Output layer 𝑊"×$ 𝑊"×$ V-dim V-dim N-dim 𝑊′$×" V-dim N will be the size of word vector We must learn W and W’
  11. 11. 11 0 1 0 0 0 0 0 0 … 0 0 0 0 1 0 0 0 0 … 0 xcat xon 0 0 0 0 0 0 0 1 … 0 Input layer Hidden layer sat Output layer V-dim V-dim N-dim V-dim + 𝑣' = 𝑣)*+ + 𝑣-. 2 0.1 2.4 1.6 1.8 0.5 0.9 … … … 3.2 0.5 2.6 1.4 2.9 1.5 3.6 … … … 6.1 … … … … … … … … … … … … … … … … … … … … 0.6 1.8 2.7 1.9 2.4 2.0 … … … 1.2 × 0 1 0 0 0 0 0 0 … 0 𝑊"×$ 0 ×𝑥)*+ = 𝑣)*+ 2.4 2.6 … … 1.8 =
  12. 12. 12 0 1 0 0 0 0 0 0 … 0 0 0 0 1 0 0 0 0 … 0 xcat xon 0 0 0 0 0 0 0 1 … 0 Input layer Hidden layer sat Output layer V-dim V-dim N-dim V-dim + 𝑣' = 𝑣)*+ + 𝑣-. 2 0.1 2.4 1.6 1.8 0.5 0.9 … … … 3.2 0.5 2.6 1.4 2.9 1.5 3.6 … … … 6.1 … … … … … … … … … … … … … … … … … … … … 0.6 1.8 2.7 1.9 2.4 2.0 … … … 1.2 × 0 0 0 1 0 0 0 0 … 0 𝑊"×$ 0 ×𝑥-. = 𝑣-. 1.8 2.9 … … 1.9 =
  13. 13. 13 0 1 0 0 0 0 0 0 … 0 0 0 0 1 0 0 0 0 … 0 cat on 0 0 0 0 0 0 0 1 … 0 Input layer Hidden layer 𝑦'456 Output layer 𝑊"×$ 𝑊"×$ V-dim V-dim N-dim 𝑊"×$ 7 ×𝑣' = 𝑧 V-dim N will be the size of word vector 𝑣' 𝑦' = 𝑠𝑜𝑓𝑡𝑚𝑎𝑥(𝑧)
  14. 14. 14 0 1 0 0 0 0 0 0 … 0 0 0 0 1 0 0 0 0 … 0 cat on 0 0 0 0 0 0 0 1 … 0 Input layer Hidden layer 𝑦'456 Output layer 𝑊"×$ 𝑊"×$ V-dim V-dim N-dim 𝑊"×$ 7 ×𝑣' = 𝑧 𝑦' = 𝑠𝑜𝑓𝑡𝑚𝑎𝑥(𝑧) V-dim N will be the size of word vector 𝑣' 0.01 0.02 0.00 0.02 0.01 0.02 0.01 0.7 … 0.00 𝑦' We would prefer 𝑦' close to 𝑦'A*+
  15. 15. 15 0 1 0 0 0 0 0 0 … 0 0 0 0 1 0 0 0 0 … 0 xcat xon 0 0 0 0 0 0 0 1 … 0 Input layer Hidden layer sat Output layer V-dim V-dim N-dim V-dim 𝑊"×$ 𝑊"×$ 0.1 2.4 1.6 1.8 0.5 0.9 … … … 3.2 0.5 2.6 1.4 2.9 1.5 3.6 … … … 6.1 … … … … … … … … … … … … … … … … … … … … 0.6 1.8 2.7 1.9 2.4 2.0 … … … 1.2 𝑊"×$ 0 Contain word’s vectors 𝑊"×$ 7 We can consider either W or W’ as the word’s representation. Or even take the average.
  17. 17. WORD ANALOGIES 17
  18. 18. ОСНОВНАЯ СТАТЬЯ • Continuous Distributed Representation of Biological Sequences for Deep Proteomics and Genomics • Ehsaneddin Asgari, • Mohammad R. K. Mofrad • PLOS ONE November 10, 2015 • 18
  24. 24. РЕАЛИЗАЦИЯ • 24
