Thesis complete final edit gm dt480.4 p

289 views

Published on

  • Be the first to comment

Thesis complete final edit gm dt480.4 p

  1. 1. Pharmaceutical Relevant Proteins; Studies of RBP4 and Kvβ2. Gavin Mooney School of Food Science and Environmental Health 2011 Thesis Submitted in Partial Fulfilment of Examination Requirements Leading to the Award B.Sc. Pharmaceutical Technology Dublin Institute of Technology Supervisor: Dr. Barry Ryan Asst. Supervisor: Ms. Alka Singh, M.Sc.
  2. 2. DeclarationI Certify that this thesis which I now submit for examination for the award B.Sc.Pharmaceutical Technology is entirely my own work and has not been taken fromthe work of others, save and to the extent that such work has been cited andacknowledged within the text of my work.This thesis was prepared according to the regulations provided by the School ofFood Science and Environmental Health, Dublin Institute of Technology and hasnot been submitted in whole or in part for another award in any Institute orUniversity.The Institute has permission to keep, lend or copy this thesis in whole or in part,on condition that any such use of material of this thesis is duly acknowledged. Signed: __________________________ Gavin Mooney Date: __________________________ ii
  3. 3. Acknowledgements iii
  4. 4. Abstract iv
  5. 5. Abbreviations Usedµg = Microgramµg = Microgramsµl = Micro litreµM = Micro molar1o = Primary o2 = Secondary3’ = Three Prime end of single strand of DNA4-N-B-alc = 4-nitrobenzylalcohol4-N-B-ald = 4-nitrobenzaldehyde5’ = Five Prime end of single strand of DNAACN = AcetonitrileAKR1D1 = Aldo-keto reductase 5β-reductaseApprox. = ApproximateBLAST = Basic Local Alignment ToolBMI = Body Mass IndexBp = Base PairBSA = Bovine Serum AlbumenC3G = Cyanidin 3-glucosidesC.A.S. = Chemical Abstracts ServicecDNA = Copy Deoxyribonucleic AcidConc. = ConcentratedCNS = Central Nervous SystemCVD = Cardiovascular Diseased.H2O = Deionised waterDM2 = Diabetes Mellitus Type 2DMSO = Dimethyl SulfoxideDNA = Deoxyribonucleic AciddNTP = Deoxyribonucleic TriphosphateEDTA = Ethylenediaminetetraacetic AcideGFR = Estimated Glomerular FunctionEtBr = Ethidium Bromide v
  6. 6. g = GramGLUT-4 = Glucose Transporter 4HCl = Hydrochloric AcidHPLC = High Performance Liquid ChromatographyhRBP4 = Human Retinol Binding Protein-4hrs = HoursIGT = Impaired Glucose ToleranceIPTG = Isopropyl β-D-thiogalactosideIR = Insulin ResistancekPa = Kilo PascalLBA = Luria Bertani AgarLBB = Luria Bertani BrothM = MolarMCS = Multiple Cloning Sitemg = Milligrammin = Minutesml = Millilitremm = MillimetresmM = MillimolarNaCl = Sodium ChlorideNADPH = Nictinamide adenine dinucleotide phosphate (Reduced form)NADP = Nictinamide adenine dinucleotide phosphateNCBI = National Centre for Biotechnology Informationnm = NanometersoC = Degrees CelsiusPCR = Polymerase Chain ReactionPPAR-γ = Peroxisome Proliferator-Activated Receptor-gamapsi = Pounds per square inchQA = Quality Assurance(h)RBP4 = (human) Retinol Binding Protein-4rpm = Revolutions per minuteSC = SubcutaneuosSDR = Short-chain Dehydrogenase ReductasesSDW = Sterile Deionised Water vi
  7. 7. TAE = Tris-Acetate-EDTATM = Melting TemperatureTZD = Thiazolidinedione oTC = Temperature in Degrees CelsiusUN = United NationsUV = Ultra VioletUVB = Ultraviolet-BV = Voltsv/v = Volume per volumew/v = Weight per volume vii
  8. 8. Table of ContentsDeclaration ...............................................................................................................iiAcknowledgements................................................................................................ iiiAbstract ...................................................................................................................ivAbbreviations Used..................................................................................................vTable of Contents ................................................................................................. viiiList of Figures: .........................................................................................................xList of Tables: ........................................................................................................xii1.0 Introduction........................................................................................................21.1 Retinol Binding Protein 4 ..................................................................................21.2 Kvβ2: The Subunit of Kv1 Potassium Channels ...............................................61.3 The Phenols: Rutin, Resveratrol and Quercitin .................................................9 1.3.1 Quercitin and Rutin...................................................................................9 1.3.2 Resveratrol..............................................................................................101.4 Aldo-Keto Reductases .....................................................................................112.0 Materials and Methods.....................................................................................15 2.1 Materials ....................................................................................................15 2.1.1 Instruments..............................................................................................16 2.1.2 E.coli strain.............................................................................................17 2.1.3 Plasmids..................................................................................................172.2 Cloning Primer Design ....................................................................................182.3 Agar and Broth Preparation .............................................................................202.4 Sterilization ......................................................................................................202.5 Isolation of Plasmid Vector from E.Coli .........................................................202.6 DNA and Primer Preparation...........................................................................212.7 Agarose Gel Preparation ..................................................................................212.8 Polymerase Chain Reaction (PCR)..................................................................22 2.8.1-1 PCR Reaction Mixture 1......................................................................23 2.8.1-2 PCR Condition Set 1............................................................................24 2.8.2-1 PCR Reaction Mixture 2......................................................................24 2.8.2-2 PCR Condition Set 2............................................................................25 2.8.3-1 PCR Reaction Mixture 3......................................................................25 2.8.3-2 PCR Condition Set 3............................................................................26 viii
  9. 9. 2.8.4-1 PCR Reaction Mixture 4......................................................................26 2.8.4-2 PCR Condition Set 4............................................................................27 2.8.5-1 PCR Reaction Mixture 5......................................................................27 2.8.5-2 PCR Condition Set 5.1.........................................................................28 2.8.5-2 PCR Condition Set 5.2.........................................................................282.9 Preparation of TAE Buffer...............................................................................292.10 Purification and Expression of Kvβ2.............................................................292.11 Dialysis of Kvβ2 ............................................................................................30 2.11.1 Preparation of Dialysis Tubing ............................................................30 2.11.2 Dialysis of Kvβ2...................................................................................302.12 HPLC assay to measure the inhibition of Kvβ2 mediated reduction of 4-nitrobenzaldehyde ..................................................................................................302.12.1 Method for Gradient HPLC Assay (Rutin & Resveratrol) .........................312.13 Bradford Method for Protein Concentration Determination..........................322.14 Flouresence Measurement of inhibitor - Kvβ2 binding..................................323.0 Results..............................................................................................................343.1 PCR Results .....................................................................................................343.2 Expression and Purification of Kvβ2...............................................................373.3 HPLC Chromtatograms for the Inhibition of Kvβ2 Mediated Reduction of 4-nitrobenzaldehyde ..................................................................................................38 3.3.1 Chromatogram Results for Rutin Experiment.........................................38 3.3.2 Chromatogram Results for Quercitin Experiment..................................40 3.3.3 Chromatogram Results for Resveratrol Experiment...............................423.4 Percentage Inhibition Results for Rutin, Quercitin and Resveratrol................443.5 Flouresence Spectra .........................................................................................453.5 Bradford Method Standard Curve....................................................................47 ix
  10. 10. List of Figures:Fig.1.1 3-D Protein representation of the RBP4 structure.Fig.1.2 Schematic of aldehyde-dismutation in Kvβ2Fig.1.3 Structural features of KvβFig.1.4 Chemical structure of RutinFig.1.5 Chemical structure of ResveratrolFig.1.6 Chemical structure of QuercitinFig.2.1 Gradient elution method employed for the HPLC Analysis of Resveratrol and RutinFig.3.1 PCR UV Photograph of PCR #1Fig.3.2 PCR UV Photograph of PCR #2Fig.3.3 PCR UV Photograph of PCR #3Fig.3.4 PCR UV Photograph of PCR #4Fig.3.5 PCR UV Photograph of PCR #5Fig.3.6 Elution profile of purified Kvβ2Fig.3.7 Chromatogram showing a control reaction for Rutin experimentFig.3.8 Chromatogram showing a control reaction for Rutin experimentFig.3.9 Concentration dependant inhibition of Kvβ2 by RutinFig.3.10 Chromatogram showing a control reaction for Quercitin experimentFig.3.11 Chromatogram showing a control reaction for Quercitin experimentFig.3.12 Concentration dependant inhibition of Kvβ2 by QuercitinFig.3.13 Chromatogram showing a control reaction for Resveratrol experimentFig.3.14 Chromatogram showing a control reaction for Resveratrol experimentFig.3.15 Concentration dependant inhibition of Kvβ2 by ResveratrolFig.3.16 Concentration dependant percentage inhibition of Kvβ2 by Rutin x
  11. 11. Fig.3.17 Concentration dependant percentage inhibition of Kvβ2 by QuercitinFig.3.18 Concentration dependant percentage inhibition of Kvβ2 by ResveratrolFig.3.19 Flourometric data showing the binding of Rutin to Kvβ2Fig.3.20 Flourometric data showing the binding of Quercitin to Kvβ2Fig.3.21 Flourometric data showing the binding of Resveratrol to Kvβ2Fig.3.22 BSA standard curve xi
  12. 12. List of Tables:Table 1. Description of PlasmidsTable 2. Details of Primers UsedTable 3. Comparison of Agarose Volumes UsedTable 4. Details of Primer concentration and cDNA volumes used in PCR 1Table 5. Temperature gradient and tube layout for PCR 2.Table 6. Temperature gradient and tube layout for PCR 5.1. (Machine 1)Table 7. Temperature gradient and tube layout for PCR 5.2. (Machine 2)Table 8. Outline of reaction mixtures for Bradford Method xii
  13. 13. Chapter 1:Introduction 1
  14. 14. 1.0 Introduction The aim of this project is to study the hRBP4 protein through cloning,expressing and purifying of the protein in order to perform a selection of tests onthe protein for stability and characteristics. As will be seen throughout this report,the optimisation process for the PCR of hRBP4 was recurrently unsuccessful andas a result, it was decided to focus on the standardization of an experiment beingcarried out by a PhD student on a new protein, Kvβ2. This protein, a subunit of theKv1 protein, is involved in the regulation of the Shaker potassium channels of thebody. In this study, three compounds; Rutin, Quercitin and Resveratrol have beenidentified as inhibitors of the kinetic mechanism for aldehyde dismutation that hasbeen proposed for Kvβ2. For this study, the Kvβ2 was expressed and purified forHPLC analysis of the inhibitory studies.1.1 Retinol Binding Protein 4 It has been reported that protein human Retinol Binding Protein-4 (hRBP4) islinked with insulin resistance when serums levels are elevated (Graham, Yang,Blüher, et al., 2006). As such, this protein has a casual function in DiabetesMellitus Type 2 (DM2). The RBP4 protein is secreted from hepatocytes andadipocytes. Studies have been conducted on RBP4 regarding its role in thereduced expression of the glucose transporter-4; GLUT4, an adipocyte which isresponsible for the post-digestive function of glucose uptake through the insulin-mediated conscription of the GLUT4 transporter to the cell (Graham, et al., 2006).RBP4, in serum, is now recognised as an adipokine linked with diminishinghepatic and peripheral insulin sensitivity and therefore increased hepaticgluconeogenesis (Craig, Chu and Elbein, 2006). It has been identified that theRBP4 gene is located close to a region linked with type 2 diabetes (DM2) and assuch may be the reason for increased susceptibility to DM2 and the reduction ininsulin sensitivity (Craig, et al., 2006). An in vivo study by Craig, et al. (2006)aimed at knocking out the adipose-specific GLUT4 in which mice acquiredmuscle and hepatic insulin resistance and as such also showed an elevated serumconcentration of RBP4. Elevated RBP4 levels were noted in a population study ofsubjects with impaired glucose tolerance and these serum levels dropped inindividuals with exercise-mediated improved insulin sensitivity, as well as the 2
  15. 15. serum levels showing an inverse relationship to insulin sensitivity in individualswith a family history of DM2 (Graham, et al. 2006). The elevated serumconcentration of RBP4 was also reported by Craig et al. (2006) in individuals withdiabetes relative to euglycemic therapy. While insulin resistance is a vitalaccomplice to DM, it can also provide a risk of cardiovascular disease (CVD) andartherosclerosis indirectly via a pathophysiologic link and thus elevated serumRBP4 is associated with CVD risk factors and metabolic syndrome; giving thepotential for RBP4 to be used as a predictor to DM2 (Suh, Kim, Cho, Choi, Hanand Geun, 2009). Reports have shown that RBP4 serum concentrations correlatedwith diastolic blood pressure, fasting glucose levels and age; all factors associatedwith DM (Suh, et al. 2009). Suh, et al. also reported the implications this mayhave for lipid metabolism and insulin action. In this same study, it was reportedthat serum RBP4 levels may correlate to age-induced insulin resistance (IR) aswell as independently being associated with fasting glucose levels. Women over50 years of age consistently possessed higher serum RBP4 levels in the study bySuh, et al; attributed to the reduced levels of Oestrogen during menopause whichleads to changes in the fat amounts in the body and visceral fat increases, thuscausing lipid metabolism changes and increasing RBP4 serum concentrations. Thelink between RBP4 levels and fasting glucose concentrations can possibly beexplained through the mechanism which causes the induced expression of thegluconeogenic enzymephosphoenolpyruvate carboxykinase by RBP4 via the liver which leads to RBP4-induced IR in the liver (Suh, et al. 2009). Fig.1.1: 3D representation of Retinol Binding Protein-4. 3
  16. 16. Serum RBP4 is reported as being preferentially being expressed in visceral fatas opposed to expression in subcutaneous fat (Klöting, Graham, Berndt, et al.2007). RBP4’s correlation with Transthyretin, which stabilizes circulating RBP4and prevents it from being removed from plasma by glomerular filtration, wasused as an indicator to show the increase in visceral RBP4 in obese subjects, withDM2 and impaired glucose tolerance (IGT), and was reported to be 35% over thenormal serum concentrations and therefore linking visceral adiposity and visceralfat to RBP4 concentrations in the serum (Klöting, et al. 2007). Studies haveshown that RBP4 can be a clinical biomarker of IR in patients who present with arange of clinical presentations, however it has also been reported that no evidencehas been found to back up this correlation and as such Chen, Wu, Chang and Tsai,et al reported in 2009 the correlation between renal function rather than DM2.Their study concluded that there was an expected inverse correlation betweenRBP4 and uric acid, excreted by the kidneys due to the proven link between RBP4levels and estimated glomerular function (eGFR), hence the relationship betweenRBP4 and renal function in patients with DM2 (Chen, et al 2009). This may be anindirect biomarker of IR and DM2 for RBP4 levels. However, using a large study cohort, Lewis, Shand, Elder and Scott reportedin 2008 that RBP4 in the plasma may not be a functional biomarker of IR. In theirstudy of 285 fasting patients, some of whom had diabetes and some with nodiabetes but with varying levels of IR, the data observed did not provide anyrelationship between RBP4 levels and IR and even body mass index (BMI),percentage body fat and waist circumference as RBP4 levels were notsignificantly higher in individuals with DM compared to those without. Thus alsoputting into question; the correlation between lipid metabolism and plasma RBP4levels. As already stated glomerular dysfunction can increase the levels ofcirculating RBP4 and it has been noted that RBP4 levels in DM2 patients havebeen affected by early nephropathy (Lewis, et al. 2008). RBP4 in this instancemay still be used as a biochemical marker of IR and there is still no evidence onthe contrary that GLUT4 levels reduce with a positive inverse in RBP4 expressionand secretion into serum. As such this is an analytical approach that may be usedto identify IR through RBP4 plasma concentration. 4
  17. 17. The standard treatment, according to the British National Formulary 2010, inDM2 to reduce peripheral IR is the administration of Pioglitazone orRosiglitazone; both of which are Thiazolidinedione (TZD)-classed medications.These drugs are typically prescribed in combination with Metformin or aSulphonylurea in order to reduce IR, as stated, by targeting the regulation ofadipocyte function from which RBP4 levels can be managed. TZD act on theadipocyte function through adipocyte differentiation and adipocyte gene activationas they are a synthetic peroxisome proliferator-activated receptor-gama (PPAR-γ)ligands (Sasaki, Nishimura and Hoshino, et al 2007). TZDs are broadly used toreduce hyperglycaemia and have been reported to increase serum adiponectinsignificantly better than Sulphonylureas (Lin, et al. 2008). Due to the minimalselectivity of the PPAR-γ modulator, these TZD drugs can provide a undesiredside effects such as gastrointestinal disruption, obesity and oedema and there formore attention has been focused on food based compounds such as Anthocyaninslike Cyanidin 3-glucosides (C3G) for a more effective management of DM2 andmetabolic syndrome through their efficacy in the modulation of the GLUT4 –RBP4 system as well as inflammatory adipocytokines which result in theimprovement of hyperglycaemia and insulin sensitivity of patients with DM2(Sasaki, et al 2007). Anthocyanins are water-soluble, plant based chemicals as dueto their abundance in the plant kingdom it is suggested that high amounts ofAnthocyanins are ingested through plant-based diets, hence the ingestion ofC3G’s which Sasaki et al has reported to be a suppressor of RBP4 expression inwhite adipose tissue with a reported 47% reduction in serum RBP4 of the study’sgroup compared to the control group of diabetic mice. The treatment of thesediabetic mice with C3G also showed an increase in the expression of GLUT4transporters, likely to be due to the reduced expression of RBP4, leading to betterinsulin sensitivity. Dietary C3G treatment also proved to increase insulinsensitivity but with no significant affect on the expression of adiponectin and itsreceptors; leading to observations that polyphenols may inhibit α-glucosidaseactivity although the amelioration of IR by C3G is not due to inhibition of α-glucosidase activity (Sasaki et al 2007). This suggests a new class of drug anddietary treatment for DM2 and metabolic syndrome in respect of the managementof IR. 5
  18. 18. 1.2 Kvβ2: The Subunit of Kv1 Potassium Channels Kvβ2 is a cytosolic protein; a subunit of Kv1 potassium (K+) channels whichare belong to the voltage-dependant ‘Shaker family’ of potassium channels.Potassium channels are known to be widely dispersed ion channels within thebody, particularly in the Central Nervous System (CNS) and these are present in alarge number of living species (Kelly, 2010). The high abundance of Kvβ in thenervous system may attribute to channel regulation in the myocardial cell andimpact on the action potential of same. The channels also provide a vital functionof establishing resting membrane potential and regulation of frequency duringaction potential (Hille, et al. 1991). Such electrical activity is vital for thefunctioning of process in excitable cells such as neurons and muscle (Long, et al.2005). The Kvα subunit, Kvβ associates with the cytoplasmic aspect of the Kvαprotein and these do not contribute to ion conductivity however they do regulatechannel activity; the Kv channels have been shown to be responsible for theregulation of K+ flow through cell membranes upon changes in the potential of themembrane (Weng, et al 2006). These channels form transmembrane pores whichcan be found in a variety of cell types in which they regulate the electricalfunction and signalling processes among other physiological processes (DiCostanzo, et al. 2009). Fig.1.2: A mechanism for aldehyde dismutation in Kvβ2 as proposed by Alka, et al. 2010. RCHO is an aldehyde, RCH(OH)2 is its corresponding hydrate, RCOOH and RCH2OH are the corresponding alcohol and carboxylic acid respectively. The dismutation of aldehyde substrate consists of two coupled half reactions. In the first half (the upper pathway), hydrated aldehyde is oxidised irreversibly to the corresponding carboxylic acid forming ENADPH. In the second half reaction (lower pathway), another molecule free aldehyde binds to the ENADPH complex and is reduced reversibly to corresponding alcohol. Hence, aldehyde is dismutated into equimolar concentration of corresponding alcohol and carboxylic acid in a redox silent reaction with no observable change in A340. Ψ denotes the cofactor exchange step. The steps denoted by Ψ are insignificant during dismutation as cofactor remains enzyme bound throughout alternate oxidation and reduction (Alka, et al. 2010). 6
  19. 19. The Shaker family of Kv potassium channels has an modifications that havenot been reported to exist in Kv channels of prokaryotes and these adaptationsallow the Kv channel to perform functions that are unique to eukaryotic cells(Long, et al. 2005). Long, et al. (2005) also reported that the β subunit had largeportals on the side of the structure, between the pore and cytoplasm, withelectrophysical properties which have a consistent result in similar studies onelectrophysiological inactivation gating and research postulates the potential of K+channel regulation by the β subunit (Long, et al. 2005). Upon structural study ofthe Kvβ2, it was reported that the subunit contains a similar sequence homology tothat of an aldo-keto reductase (AKR). This AKR fold allows the β subunit tocatalyse a redox reduction. The structural analysis also found that Kvβ2 has atightly bound nicotinamide cofactor; NAPDH. This bond is non covalent and theregion also contains an aldehyde binding site (Alka, K. et al. 2010; Weng, et al.2006). Crystal structure analysis of the ternary complex Kvβ2-NADPH-cortisone alsoidentified a binding site for cortisone on the proteins surface; supplementing thebinding site at the enzyme active site (Di Costanzo, et al. 2009). The AKR foldpreviously mentioned, catalyses a redox reduction in this instance by reducing analdehyde to an alcohol via oxidation of the NADPH cofactor (Weng et al 2006).Fig 1.2 shows the reaction as proposed by Alka, K., et al in 2010. A similarscheme proposed by Weng, et al. (2006) also shows an AKR and enzyme bindingin sequence to an NADPH to form an Enzyme-NADPH-aldehyde complex. Theenzyme in this complex transfers a hydride from the NADPH cofactor to thealdehyde thus producing an alcohol product which is followed suit by NADP+.This is facilitated by AKRs having a higher affinity for NADPH over NADH(Weng et al. 2006). The process in Fig.1.2 is reversible which allows the alcoholto be oxidised to form an aldehyde and NADP+ to be converted to NADPH asreported by Weng, et al in 2006. The rate of cofactor exchange in the aboveprocess is however, slow thus indicating Kvβ is a slow enzyme. Weng, et al. alsoshows in the 2006 publication that even though NADPH was oxidised over a two-week period, there was still a presence of NADP+ in Kvβ; showing a tightassociation which is to an extent due to a flexible loop which stretches overNADPH and it’s binding site. It is this loop that possibly decelerates thedissociation of the cofactor to a more prolonged period as reported. The reduction 7
  20. 20. of substrates such as 4-nitrobenzaldehyde (4-N-B-ald) is known to be catalysed byKvβ2 and the slow aldehyde-substrate dismutation has been shown through aHPLC assay (Alka,, et al. 2010).Fig.1.3: Structural features of Kvβ: A, structure of Kv1.2 (blue) in complex with Kvβ2 (red)in ribbon representation (Protein Data Bank code 2A79 (3)). The cell membrane is indicated by thestraight lines.B, ribbon representation of Kvβ2 showing its structural fold (Protein Data Bank code1QRQ (10)). The bound cofactor (cyan) and the conserved active site residues, Asp85, Tyr90, Lys118,and Asn158, are shown in stick representation. Residues Asp85 and Lys118 are labelled. A flexibleloop that straddles the cofactor binding site is shown in yellow (Gulbis et al., 1999).A potassium channel modulation function was reported as the bound cofactor,NADPH, is oxidised. The regulation of channel activity, however questionable asthe adequate production of relative aldehydes may not be sufficient enough for thechannel regulation due to both enzymatic and non-enzymatic processes leading tooxidative stress (Alka, et al. 2010). However, as noted above, this can be a slowprocess but it is suspected that this redox reaction of the cofactor may be faster inthe presence of more specific physiological substrate which is yet to be elucidated(Alka, et al. 2010). The rate of aldehyde reduction is linearly dependant on theconcentration of Kvβ2 and can be observed as a decrease in the peak area at the450nm fluorescence peak (Alka, et al. 2010). Reports have shown that cortisonepromotes dissociation of the Kvβ2 from the K+ channel as it binds in two sites; atthe bound cofactor and the boundary of the Kvβ subunits and is known to not be asubstrate of the Kvβ2 protein, thus presenting the possibility of it being an 8
  21. 21. inhibitor (Alka, et al. 2010). This study looks at the inhibitory effect three pre-identified potential inhibitors; Rutin, Quercitin and Resveratrol have on thedismutation of aldehyde to form an alcohol product; 4-nitrobenzylalcohol (4-N-B-alc). Cortisone is a steroid hormone and the three compounds mentionedpreviously have been shown to have anti-inflammatory effects similar to those ofcortisone.1.3 The Phenols: Rutin, Resveratrol and Quercitin Rutin, Resveratrol and Quercitin are the three potential inhibitory compoundsof interest in this study. Fig.1.4 – 1.6 shows the phenolic structures of eachcompound.1.3.1 Quercitin and Rutin Rutin is a primary flavanoid which can be found in a number of plants such asBuckwheat. It is for this reason that there is high dietary consumption of Rutin asbuckwheat is used in the manufacture of noodles and rice (Koda, et al. 2008).Rutin is a glycoside form of Quercitin of whose glycosides have free radicalscavenging activities (Andlauer, et al. 2001). As can be seen in Fig.1.4 andFig.1.6, Quercitin and Rutin are very similar in structure, therefore they havesimilar mechanisms of action and biological affects. Rutin is a larger moleculeand has been shown to be less potent than Quercitin. This is possibly due to theglycosylation adding a sterically-hindering group for inhibitory binding whichmay impact, in the context of this study, at the interface binding site of the βsubunit in the Kvβ2-NADPH complex. Rutin is known to have an antioxidanteffect among various other biological effects which have a positive impact onhuman health such as anti-inflammatory and a gastro protective effect due to itsaugmentation of the antioxidant activity on the activity of glutathione peroxidase;a selenoprotein that is recently being studied to link changes or abnormalities inthe protein with the etiology of some cancers, CVD, autoimmune disease anddiabetes (Lei, et al. 2007). The 2008 study by Koda, et al. investigated thetherapeutic effect of Rutin in reducing brain damage if administered per-orally inrats. Koda, et al. showed that dietary supplementation of Rutin over a prolongedperiod reversed the induced spatial memory impairment by trimethyltin. Otherhealth benefits such as chemopreventive activity was proposed by Andlauer, et al. 9
  22. 22. with a requirement that intestinal absorptive-uptake must be carried out for thislink to be true contravening studies suggesting that Quercitin glycosides wereexcreted rather than absorbed in human intestinal (Caco-2) cells (Andlauer, et al.2001).1.3.2 Resveratrol Resveratrol is a phytoalexin that can be derived from the skin of fruits and I inparticular, red grapes among 70 other plant species. This attributes to highconcentrations of Resveratrol in red wine; approximately 50-100µg per gram ofgrape skin (Athar, et al 2007). Like Rutin, Resveratrol is reported to haveantioxidant effects, potent anti-inflammatory and inhibition of the growth ofvarious cancer cells. Resveratrol is a compound that has helped spark an interestin naturally occurring compounds being used as chemopreventives in humancancers as it has been shown to have an effect on the tumour initiation, promotionand progression stages of carcinogenisis (Athar, et al. 2007). Athar has alsoreported that it is thought that Resveratrol can induce apoptosis of cells andmodulate cell growth pathways through its antioxidant activity. Resveratrol, like other polyphenols can undergo glycosylation which has aprotective effect on Resveratrol by preventing it being degraded by oxidation thusmaking it more stable and soluble and more soluble which is advantageous in thegastrointestinal tract. It is this attribute that makes Resveratrol absorb moreefficiently than other polyphenols like Quercitin (Athar, et al. 2007). A review byAthar, et al. in 2007 has shown that various administration routes have shownpositive outcomes when Resveratrol has been used in vivo against variousinhibited cancers in mice. Topical Resveratrol was tested in vivo for anti-carcinogenisis activity on subcutaneous (SC) in the respect of non-melanoma skincancer and was proved to significantly reduced the prevalence of ultraviolet-B(UVB)-mediated photo-toxicity at a topical dosage of 25µmol in SKH-1 hairlessmice and Soleas et al. identified in a 2002 a 60% reduction in papillomas whenResveratrol was applied topically (Athar, et al. 2007). Modulation by the proteinsthat regulate cell cycle have been associated to the anti-proliferative affects ofResveratrol in such instances (Regan –Shaw, et al. 2004). A comparison of red wine-consumers against other beverages showed thatthere was a lower incidence of lung cancer among the subjects who consumed red 10
  23. 23. wine; associated with the high concentration of Resveratrol in red wine. Berge etal. (2004) reported that Resveratrol inhibits the production of diol-epoxides;compounds that have the potential to form covalent adducts with DNA and causestructural alterations with mutations (Berge, et al. 2004). Studies on a number ofcancer types have shown Resveratrol to induce apoptosis in the carcinogenic cells,also inhibit cell growth and significantly reduce the incidence of tumours whilealso delaying the onset of tumourigenisis, in multiple targets and in a non-toxicdose (Athar, et al. 2007). However, the dose which Resveratrol presents itself inwith red wine suggests that for health benefit to be observed by its administrationit may require synergistic combinations with compounds such as Quercitin andellagic acid; synergistic combinations which have been shown to induce apoptosisin vitro and in vivo (Athar, et al. 2007). Resveratrol has been reported to have anumber of positive cardiogenic effects such as the reduction in incidences ofCVD. Its cardiogenic effects have been shown in the lowering of hyper / hypo-tension clinical issues. This is thought to be due to Resveratrol inducing theexpression of endothelial nitric oxide synthase which is the enzyme responsiblefor producing the vaso-dilating nitric oxides and decreasing the expression of theendothelin-1; a vasoconstrictor (Das, et al. 2010). The endothelial cell is alsoresponsible for regulating the balance of endothelin-1 and nitric oxide which areboth important vasoconstrictors and vasodilators respectively; a function thatprovides thromboresistance is shown to preclude atherogenesis (Das, et al. 2010).Pharmacological intervention in cardiovascular medicine may be entering a newage due to the range of health affects potentiated by Resveratrol such as cardiacregeneration and the generation of autophagy (Das, et al. 2010).1.4 Aldo-Keto Reductases Aldo-keto reductases (AKR) form a large part of the cytosolic monomericNADPH-dependant carbonyl oxidoreductases along side another type ofoxidoreductase; short-chain dehydrogenase reductases (SDR) (Di Costanzo, et al.2009). The AKR6A subfamily is associated with the Kvβ1-3 proteins which forman (α/β)8-Barrell fold which links it structurally with AKRs, albeit with having alow amino acid sequence similarity with other affiliates of the AKR group (DiCostanzo, et al. 2009). The AKR family are known to reduce aldehydes andketones to their corresponding 1o and 2o alcohols and can be found in both 11
  24. 24. eukaryotes and prokaryotes (Penning and Drury, 2007). AKRs have also beenshown by Penning and Drury (2007) to reduce liophilic substrates such asketosteroids and retinals, thus regulating ligand access to nuclear receptors.Substrate specificity of the AKR1 enzyme has been shown by Tipparaju et al.(2008) to favour aromatic aldehydes, which contain electron withdrawing groupsin the para position of the aromatic ring or compounds that contain carbonylgroups that are polarised by α,β- un-saturation, over cortisone which has shownno activity. AKR also functions as an aldehyde reductase may have activity inglucose metabolism and electron transport (Hyndman, et al. 2003). As mentionedpreviously, cortisone binding sites were identified on the surface of the Kvβ-NADPH-cortisone ternary complex, at which the cortisone binds backwardscompared to its binding profile within the active site of AKR1D1; a 5β-reductase,which gives productive binding of progesterone as well as cortisone (Di Costanzo,et al. 2009). Similar assessment of this structure has uncovered the link betweenthe binding of cortisone, in this fashion, to the surface of the protein and thedissociation of β subunits from the Shaker potassium channel (Pan, et al. 2008). AKRs are known to catalyse a number of reductions. In the bisequentialmechanism, in which reduction occurs in a central complex, binding of thecofactor, NAPDH, supersedes the binding of a carbonyl substrate and is followedby a release of the alcohol product and NADP+ in this respective order (Penningand Drury, 2007). Penning and Drury (2007) also note that the AKRs ratedetermining step can vary due to enzyme variation, i.e. most AKR reaction willdepend on the enzyme and rate of cofactor release. This is poignant in the regardof Kvβ2 which has previously been noted by the author as being a slow reactiveprotein thus having a slow rate of cofactor hydride transfer. A link has been publicized about the implication of AKR in human diseasessuch as diabetes. Catalysis of glucose conversion into sorbitol has been reportedas a role of aldose redcuatse; a prototypic member of the AKR family. Thisconversion is the first step in the polyol pathway; a pathway which can occur inthe presence of chronic hyperglycaemia thus leading to diabetic complicationssuch as cataracts, retinopathy and nephropathy (Chang, et al. 2007). 12
  25. 25. Fig.1.4: Structure of Rutin (2-(3,4-dihydroxyphenyl)-4,5-dihydroxy-3[3,4,5-trihydoxy-6-[(3,4,5-trihydroxy-6methyl-oxan-2-yl)oxymethyl]oxan-2-yl]oxy-chromen-7-one) Fig.1.5: Structure of Resveratrol (trans-3,4’,5-trihydroxystilbene Fig.1.6: Chemical Structure of Quercitin 13
  26. 26. Chapter 2:Materials & Methods 14
  27. 27. 2.0 Materials and Methods2.1 MaterialsMaterials are listed per company used for their respective acquisition.Promega Corporation Damastown, Mulhuddart, Dublin 15, Ireland100bp DNA Ladder Marker6X Blue / Orange Loading Dye Cat # G190AAgarose, LE Analytical Grade C.A.S. #9012-36-6dNTP Mix Cat # U1511100bp Ladder Cat # G2101Ethidium Bromide Cat # H5041GoTAQ® DNA Polymerase Cat # M3171GoTAQ® Green Master Mix Cat # M7122PureYieldTM Plasmid-Miniprep System A1221Sigma – Aldrich, Airton Road, Tallaght, Dublin 24, Ireland4-Nitrobenzaldehyde 98% C.A.S. # 555-16-84-Nitrobenzylalcohol 99% C.A.S. # 619-73-8Bradford ReagentDialysis Tubing, High Retention Seamless Cellulose Tubing (23mm x 15mm)Hydrochoric Acid 37% C.A.S. # 7647-01-0ImidazoleIsopropyl β-D-thiogalactoside (IPTG)Primers (detailed further on in Table.2)Quercitin (Anhydrous) C.A.S. # 117-39-5Rutin Hydrate (min 95%) C.A.S. # 207671-50-9Sulphuric Acid (Conc.) C.A.S. # 7664-93-9Triflouroacetic Acid 99%(Spectrophotometric Grade) C.A.S. # 76-05-1β-Nictinamide adenine-dinucleotide phosphate-reduced tetrasodium salt C.A.S. # 2646-71-1Luria Bertani (LB) Broth # L3022-250G 15
  28. 28. Luria Bertani (LB) Agar # L2897-1KGLab Scan Analytical Sciences Stillorgan Industrial Park, Stillorgan, Dublin,IrelandAcetonitrile (HPLC Grade) C.A.S. # 75-05-8VWR Northwest Business Park, Ballycoolin, Dublin 15, IrelandHiPerSolv Chromaormfor HPLC grade Methanol UN1230Fisher Chemical / Fisher Scientific Ireland Blanchardstown Corporate Park 2,Ballycoolin, Dublin 15, IrelandDi-potassium hydrogen-orthophosphate (Anhydrous) C.A.S. # 7758-11-4Methanol (HPLC Grade) C.A.S. # 67-56-1Potassium dihygrogen-orthodphosphate C.A.S. # 7778-77-0Sodium Chloride C.A.S. # 7647-14-5Tris Base C.A.S. # 77-86-1cDNAFrom U937 Human Leukemic Monocyte Lymphoma Cell line. Donated by Dr.Sinead Loughran, Dublin City University.Qiagen Fleming Way, Crawley , West Sussex , RH10 9NQpQE-602.1.1 InstrumentsAGB 1000 Hot Plate & StirrerAlpha Imager Mini SoftwareAlpha Innotech UV CameraBranson 5510 SonicatorConsort E865 Electrophoresis power supplyEmpower HPLC Computer SoftwareGilson Diamond pipette tips (for P2µl to P1000µl pipettes)Gilson Pipetteman P2µl to P1000µl pipettesGrant GD100 & W14 Water BathsG-Storm PCR MachineMetter Toledo AG285 Weighing Scales 16
  29. 29. Millipore Simplicity 185 Water FilterMilton Roy Spectonic 1201 spectrophotometerPerkin Elmer Fluorescence Spectrometer LS50BPrism Data Processing SoftwareRevco Elite Plus FreezerSartoius BP310S Weighing ScalesSigma 2K15 CentrifugeSonics Vibracell Amplifier and SonicatorStartedt SterilinsStuart Orbital Incubator S1500Thermo Scientific Heraeus IncubatorThermo Scientific Orion Star 2 pH meterThermo Scientific Pico-21 CentrifugeTomy SX-5003 High Pressure Steam SteriliserUnicam UV2 UV/Vis SpectrophotometerWaters 2998 Photodiode Array DetectorWaters e2695 HPLC with Empower Operation softwareZanussi Fridge and Freezer Unit2.1.2 E.coli strain BL21 F- dcm ompT hsdS(rB- mB-) gal [malB+]K-12(λS) sourced fromNovagen was used in this study.2.1.3 Plasmids Plasmid Information SourcepET-15b Carries an N-Terminus His-tag and Novagen contains a T7 promoter. Also contains a thrombin site and three cloning sites. pQE-60 3.4kb. High copy number Qiagen expression vector. Ampicillin resistant. T5 promotor/lac operon. 6xHis sequence at 3’ end of MCSTable 1: Description of Plasmids used. 17
  30. 30. 2.2 Cloning Primer Design All primers acquired from Sigma-Aldrich. Both primers 1 and 2, as listed inTable 2, were used directly from Thomas, et al. (1993) as published in Gene andare denoted with ‘G’ in front of their respective prime number. Primers designedby the author are numbered 3 and 4. Primers 5 and 6 are the forward and reverseprimers for the Alu gene respectively.No. Name 5’ - 3’ QA Details 1 hRBP4 TTTGAATTCATATGGAGCGCGACTGCCGAGTG TM = G-5’ AG 81.5oC GC% = 50 2 hRBP4 TTTGGATCCCTACAAAAGGTTTCTTTC TM = G-3’ 67.4oC GC% = 37 3 hRBP4 CGGGATCCATGAAGTGGGTGTGGGCGCTCTT TM = 5’ 84.6oC GC%= 61.2 4 hRBP4 CAGATCAGAAAGAAACCTTTTGAGATCTTC TM = 3’ 67.6oC GC% = 36.6 5 Alu 5’ GTAAGAGTTCCGTAACAGGACAGCT TM = 65°C GC% = 48 6 Alu 3’ CCCCACCCTAGGAGAACTTCTCTTT TM = 68°C GC% = 52Table 2: Details of Primers used in this study.Primers were designed using the step-by-step methodology outlined below. Thismethod was used for hRBP4 5’ and hRBP4 3’ as listed in Table 2. 18
  31. 31. Step 1. The gene sequence being sought was acquired by performing a BLAST searchusing the NCBI website, http://blast.ncbi.nlm.nih.gov. RBP4 Sequence plasma(RBP4), mRNA included below is 606bp long.atgaagtggg tgtgggcgct cttgctgttg gcggcgctgg gcagcggccgcgcggagcgc gactgccgag tgagcagctt ccgagtcaag gagaacttcgacaaggctcg cttctctggg acctggtacg ccatggccaa gaaggaccccgagggcctct ttctgcagga caacatcgtc gcggagttct ccgtggacgagaccggccag atgagcgcca cagccaaggg ccgagtccgt cttttgaataactgggacgt gtgcgcagac atggtgggca ccttcacaga caccgaggaccctgccaagt tcaagatgaa gtactggggc gtagcctcct ttctccagaaaggaaatgat gaccactgga tcgtcgacac agactacgac acgtatgccgtgcagtactc ctgccgcctc ctgaacctcg atggcacctg tgctgacagctactccttcg tgttttcccg ggaccccaac ggcctgcccc cagaagcgcagaagattgta aggcagcggc aggaggagct gtgcctggcc aggcagtacaggctgatcgt ccacaacggt tactgcgatg gcagatcaga aagaaacctt ttgtagStep 2. Using the online software, Webcutter 2.0, the gene sequence was entered toanalyze which restriction endonucleases do not cut the RBP4 gene. The list ofendonucleases produced (which do not cut the gene) was scanned for theendonucleases which may be used at the multiple cloning site (MCS) of the pQE-60 vector. BamHI and BglII were identified as the optimum restrictionendonucleases to be used as the endonucleases NcoI cuts at c/catgg and thereforecouldn’t be used.Step 3. The forward primer, hRBP4 5’, was designed by taking the first 23bp of theRBP4 gene and adding the restriction site for BamHI. The reverse primer, hRBP43’, was designed by taking the last 22bp of the sequence and rearranging it to itsreverse complement and adding of the restriction site for BglII. The addition ofthese restriction sites is shown in the primer sequences outlined in Table 2 and are 19
  32. 32. highlighted in red. The base pair sequence was chosen by also factoring in anoptimum GC content of ~60%. The 23bp sequence selected for the forward primeralready contained the start codon ATG (highlighted blue in Table 2) and thereforedid not require the addition of a start codon. The sequence selected for the reverseprimer did not contain a stop codon, however the restriction site for BglIIcontained the stop codon GAT (the reverse compliment of TAG) and therefore didnot require a stop codon addition.The restriction sites for each of the endonucleases were obtained from the NewEngland Biloabs Inc. website (www.neb.com).Step 4. In order to achieve high efficacy in binding for the primers a restrictionenzyme base pair clamp was added to the primer. The addition of these clamps isshown in the primer sequences outlined in Table 2 and are highlighted in green.2.3 Agar and Broth Preparation LB Agar (LBA) was made to 1 litre stock using 35g of LBA powder andthen sterilized. LB Broth (LBB) was made to 1 litre stock using 20g of LBBpowder and then sterilized. Both LBA and LBB were then supplemented with100µg/ml of Ampicllin once cooled down to room temperature.2.4 Sterilization All sterilization was carried out using the Tomy SX-5003 High PressureSteam Steriliser with the parameters set at 121oC for 15mins at 103kPa (15psi).2.5 Isolation of Plasmid Vector from E.Coli LBA was inoculated with E.coli containing pQE-60 and placed on staticincubation for 24hrs at 37oC in the Thermo Scientific Heraeus Incubator. LBBwas aliquoted into three test tubes and 1 for a positive-growth control, one as anegative-growth control and one for the working sample. One colony from theLBA plates was inoculated into the working sample and positive-control test tubesfor 24hrs incubation at 37oC and 220rpm in the Stuart Orbital Incubator S1500. 20
  33. 33. Protocol, as outlined below were carried out according to the PureYieldTMPlasmid Miniprep System using the provided isolation kit. 100µl of Cell Lysis buffer was added to 1.5ml of the LBB culture in amicrocentrifuge tube and mixed by inversion of the tube. 350µl of Neutralizationbuffer (at 4oC) was added to the mix and thoroughly mixed by inverting the tube.The mixture was then centrifuged at 14,000g in the Thermo Scientific Pico-21Centrifuge. The supernatant was transferred to a minicolumn using a pipette inorder to not disturb the cell debris pellet. The minicolumn was centrifuged at14,000g for 15 seconds. All follow-through from the minicolumn was discardedand the minicolumn was placed into a collection tube and washed by adding 200µlof Endotoxin Removal Wash to the minicolumn. The contents were centrifugedfor 15 seconds at 14,000g before adding 400µl of Column Wash Solution andcentrifuging again at 14,000g for 30 seconds. 30µl of Elution Buffer was finallyadded and let stand at RT for 1 minute. The minicolumn was then centrifuged at14,000g for 15 seconds to elute the plasmid DNA. Following final centrifugationthe eluted plasmid was transferred to a sterile ependorf and stored at -20oC.2.6 DNA and Primer Preparation cDNA was prepared for use from a stock of cDNA from U937 HumanLeukemic Monocyte Lymphoma Cell line donated by Dr. Sinead Loughran,Dublin City University, by diluting to 1:50 by adding 1µl of cDNA stock in 50µlof sterile de-ionized water (SDW). This was also further-diluted to 1:500 in orderto allow for a higher concentration of primers than template cDNA in the PCRmix during the optimization process. Each primer was reconstituted as per themanufacturer’s instructions on the Quality Assurance document. hRBP4 G-5’ was diluted to a final 100µM working concentration using389µl of SDW. hRBP4 G-3’ was diluted to a final 100µM working concentrationusing 389µl of SDW. Both primers where then diluted to several concentrations(102 to 10-5µM).2.7 Agarose Gel Preparation Varying concentrations of Agarose gel were used throughout this research.The method for a 1% Agarose gel is described below. To make a different 21
  34. 34. percentage concentration the amount of Agarose stock power was changedaccordingly as per Table 3 below. % Required g/100ml g/200ml 0.7% 0.7g 1.4g 0.8% 0.8g 1.6g 1% 1g 2gTable 3: Comparison of Agarose volume used in this study. 1g Agarose was added to 200ml TAE buffer and boiled for 2.5 minutesusing a household microwave to ensure the Agarose had fully dissolved. When thesolution had cooled down to approximately 60oC, 8µl (4µl/100ml) of EthidiumBromide (EtBr) was added and manually stirred with a glass rod for 1 minute toensure complete dissolution of the EtBr. 100ml of Agarose gel was poured intothe gel plate for each PCR experiment. All wells in the gel were formed in the gel using a 12-well comb placed intothe grooves of the gel plate. In order to prevent spillage of the molten gel,autoclave tape was firmly placed at either end of the gel plate. The wells wereloaded with 6µl of PCR product and 100bp base pair markers when running thegel. The PCR product was prepared in a 5:1 (product : 6X loading dye) mix asthis would give a 1X loading dye concentration. GoTAQ® Master Mix alreadycontained loading dye and was at a final concentration of 1X when in the PCRreaction mix thus only the 100bp required the addition of 6X loading dye in thefashion mentioned above.2.8 Polymerase Chain Reaction (PCR) A total of 6 PCR conditions were performed using a G-Storm PCR Machinefor each. Pre-prescribed settings, as listed in the GoTAQ® product sheet, wereused for the first run and then adjusting either the annealing or elongation times asnew reactions were carried out. The results are outlined further on in chapter 3.All PCR cycle settings in this study were carried out with a Heated Lid of 110oC.All Annealing temperatures were calculated using the calculation TAnneal = TM – 5oC 22
  35. 35. This was facilitated by calculating the TM using the calculation below. Thiscalculation is based on the content of A, T, G and C bases in each primer. TM = [2(A+T) + 4(G+C)] oC2.8.1-1 PCR Reaction Mixture 1 A total of 4 reaction tubes were prepared using primer concentrations of10µM and 20µM and varied cDNA volumes. Tube contents are detailed in Table4. Each reaction tube contained the mix as outlined below. The PCR product wasran on a 0.7% Agarose gel using a Consort E865 Electrophoresis power supply setat 100V for 1.5 hours and shown in Fig.3.1. The annealing temperature used wasguided on the approximation of annealing at one minute for each kilo basepair inthe gene, thus the annealing temperature was estimated at 45 seconds as the thenumber of basepairs in the gene is 606bp.Reaction Mix 1GoTAQ® Master Mix 5µlhRBP4 G-5’ 1µlhRBP4 G-3’ 1µlcDNA (1:50) as per Table 4.SDW to 25µl Tube No. Primer Concentration cDNA Volume 1 10ìM 6ìl 2 20ìM 6ìl 3 10ìM 3ìl 4 20ìM 3ìlTable 4: Details of Primer concentration and cDNA volumes used in PCR 1. 23
  36. 36. 2.8.1-2 PCR Condition Set 1 Step Temperature Time Initial Denaturation 94oC 4min PCR Cycle at 35 Cycles Denaturation 94 oC 1min Annealing 58 oC 45secs Elongation 72 oC 45secs Finish Cycle Final Elongation 72 oC 10min2.8.2-1 PCR Reaction Mixture 2 A total of 6 reaction tubes numbered 2 to 7 were prepared using primerconcentrations of 1µM to 10-4µM in each tube respectively using a cDNA volumeof 6µl. Each reaction tube contained the mix as outlined below. A gradientannealing temperature method was employed for this PCR cycle. The temperaturegradient was based on the average TM of primers 1 and 2 using the followingcalculation: TM (Av) = (TM1 – TM2) = (81.5 + 67.4)/2 = 74.45 oC TAnneal(Average) = TM (Av) – 5oC = 74.45 oC – 5oC = 69.45oCThe temperature range based on TAnneal(Average) ±3-5oC (appox) and layout of PCRproduct tubes in the G-Storm PCR Instrument is outlined in Table 5. The PCRproduct was ran on a 0.7% Agarose gel using a Consort E865 Electrophoresispower supply set at 100V for 1 hour and shown in Fig.3.2Reaction Mix 2GoTAQ® Master Mix 5µlhRBP4 G-5’ 1µlhRBP4 G-3’ 1µlcDNA (1:50) 6µlSDW to 25µl 24
  37. 37. Lane 1 2 3 4 5 6 7 8 9 10 11 12ToC 60.1 60.4 61.1 62.2 63.6 65.1 66.7 68.3 70.1 71.2 71.8 72.2Tube - 2 - 3 - 4 - 5 - 6 - 7 Table 5: ToC gradient and tube layout for PCR 2. 2.8.2-2 PCR Condition Set 2 Step Temperature Time Initial Denaturation 94oC 4min PCR Cycle at 35 Cycles Denaturation 94 oC 1min Annealing 58 oC 45secs Elongation 72 oC 45secs Finish Cycle Final Elongation 72 oC 10min 2.8.3-1 PCR Reaction Mixture 3 A total of 3 reaction tubes numbered 1 to 3 were prepared using primer concentrations of 10-5µM, 10-3µM and 10-1µM in each tube respectively using a cDNA (1:500) volume of 4µl. Each reaction tube contained the mix as outlined below. The PCR product was ran on a 1% Agarose gel using a Consort E865 Electrophoresis power supply set at 100V for 1.5 hours and shown in Fig.3.3. Reaction Mix 3 GoTAQ® Master Mix 12.5µl hRBP4 G-5’ 1µl hRBP4 G-3’ 1µl cDNA (1:500) 4µl SDW to 25µl 25
  38. 38. 2.8.3-2 PCR Condition Set 3 Step Temperature Time Initial Denaturation 94oC 5min PCR Cycle at 35 Cycles Denaturation 94 oC 1min Annealing 70 oC 45secs Elongation 73 oC 45secs Finish Cycle Final Elongation 73 oC 9min2.8.4-1 PCR Reaction Mixture 4 A total of 3 reaction tubes numbered 1 to 2 were prepared using primerconcentrations of 10-5µM, and 10µM in each tube respectively using a cDNA(1:500) volume of 3µl. Alu gene at a 10-5µM concentration was used as a positivecontrol for the reaction set used. Each reaction tube contained the mix as outlinedbelow. The PCR product was ran on a 1% Agarose gel using a Consort E865Electrophoresis power supply set at 120V for 1hr-10mins and shown in Fig.3.4.Reaction Mix 4GoTAQ® Master Mix 12.5µlhRBP4 G-5’ / Alu 5’ 1µlhRBP4 G-3’ / Alu 5’ 1µlcDNA (1:500) 3µlSDW to 25µl 26
  39. 39. 2.8.4-2 PCR Condition Set 4 Step Temperature Time Initial Denaturation 94oC 10min PCR Cycle at 35 Cycles Denaturation 94 oC 1min Annealing 60 oC 50secs Elongation 72 oC 1min Finish Cycle Final Elongation 72 oC 12min2.8.5-1 PCR Reaction Mixture 5 A total of 8 reaction tubes numbered 2 to 5 and 7 to 10 were prepared usingprimer concentrations of 10-5µM, 10µM and 1µM in each tube respectively usinga cDNA (1:500) volume of 3µl. Alu gene at a 10-5µM concentration was used as apositive control for the reaction sets used. Each reaction tube contained the mix asoutlined below. The PCR product was ran on a 1% Agarose gel using a ConsortE865 Electrophoresis power supply set at 110V for 1hr-15mins and shown inFig.3.5. Two reactions were run simultaneously for this experiment using twoPCR machines which allowed for faster analysis on the new primers using twodifferent PCR condition sets. This was carried out in Machine 1 and Machine 2which were in labs M4.06 and M4.02 respectively. Reaction mix 5.1 and 5.2 wereplaced in Machine 1 and Machine 2 respectively. The PCR Condition sets beloware numbered also in this fashion. A gradient annealing temperature method wasemployed for this PCR cycle. The temperature range of TAnneal(Average) ±3-5oC(appox) and layout of PCR product tubes is outlined in Table 6 and Table 7. Reaction Mix 5.1 Reaction Mix 5.2GoTAQ® Master Mix 12.5µl GoTAQ® Master Mix 12.5µlhRBP4 -5’ / Alu 5’ 1µl hRBP4 -5’ / Alu 5’ 1µlhRBP4 -3’ / Alu 5’ 1µl hRBP4 -3’ / Alu 5’ 1µlcDNA (1:500) 3µl cDNA (1:500) 3µlSDW to 25µl SDW to 25µl 27
  40. 40. 2.8.5-2 PCR Condition Set 5.1 Step Temperature Time Initial Denaturation 94oC 11min PCR Cycle at 35 Cycles Denaturation 94 oC 1min Annealing 57 - 62 oC 55secs Elongation 72 oC 1min Finish Cycle Final Elongation 72 oC 13min 2.8.5-2 PCR Condition Set 5.2 Step Temperature Time Initial Denaturation 94oC 9min PCR Cycle at 35 Cycles Denaturation 94 oC 1min Annealing 63 - 67 oC 55secs Elongation 72 oC 1min Finish Cycle Final Elongation 72 oC 12minLane 1 2 3 4 5 6 7 8 9 10 11 12No.ToC 57 57.2 57.5 57.9 58.3 59.1 59.8 60.5 61.2 61.7 61.9 62Tube 2 5 - - 3 - - - 4 - - - Table 6: ToC gradient and tube layout for PCR 5.1. (Machine 1) 28
  41. 41. Lane 1 2 3 4 5 6 7 8 9 10 11 12No.ToC 60.1 60.4 61.1 61.2 63.6 65.1 66.7 68.3 70.1 71.2 71.8 72.2Tube Table 7: ToC gradient and tube layout for PCR 5.2. (Machine 2) 2.9 Preparation of TAE Buffer A 50X stock solution of TAE buffer at pH ~8.5 was prepared by measuring out the following components in separate beakers and finally mixing in a Duran Bottle. 242g of Tris base, 57.1ml of glacial acetic acid, 37.2g Ethylenediaminetetraacetic Acid, Disodium Salt, Dihydrate (Na2EDTA.2H2O) and then dH2O was added to a final volume of 1litre. A 1X TAE buffer was prepared by measuring 20ml of 50X TAE and adding d.H2O to 1litre. 2.10 Purification and Expression of Kvβ2 Kvβ2 gene obtained from rat brain was cloned with an N-terminus His-tag. The E. coli BL21 (DE3, plysS) stock was transformed with pET15b-Kvβ2 vector- construct by culturing at 37°C in LB medium containing 50µg/ml ampicillin. Absorbance was measured at 600nm (A600 nm), thus when the A600 nm of the culture reached ~ 0.8, the expression of Kvβ2 protein was induced for 14hr by the addition of IPTG to a final concentration of 1mM, by incubating at 25°C and 280rpm. Cells were resuspended in lysis buffer (20mM Tris-HCl, pH 7.9, 5mM imidazole, 200mM NaCl) and lysed by sonication for 130 seconds while being on ice, as protein is extremely sensitive to fluctuation in temperature. Cell debris was collected by centrifugation at 39000g and the supernatant was run through the nickel-charged iminodiacetic acid column pre-equilibrated with lysis buffer/binding buffer. The Ni+ column was washed with 2.5 litres of the binding buffer/lysis buffer to remove the unbound proteins. Elution was carried out with 20mM Tris-HCl, pH 7.9, 200mM NaCl, and 300mM imidazole. Fifteen fractions of the post elution Kvβ2 were taken and absorbance (A280nm) of each tube was 29
  42. 42. measured and plotted as described in Fig.3.6 to obtain the elution profile of theprotein.2.11 Dialysis of Kvβ22.11.1 Preparation of Dialysis Tubing The dialysis tube was boiled in water containing 1mM EDTA for 30 minutesas this will initiate the removal of glycerol, prepare the pores of the tubing andchelate any ions present. Removal of sulphur compounds was carried out bytreating the tubing with a 0.3% (w/v) solution of sodium sulphide at 80oC for 1minute followed by washing with hot water at 60oC for 2 minutes, followed byacidification with a 0.2% (v/v) solution of sulphuric acid, then rinsed with hotwater to remove the acid.2.11.2 Dialysis of Kvβ2 The dialysis of Kvβ2 was then carried out in 6 litres of pre-chilled 0.15Mpotassium phosphate buffer, pH 7.5 for 36 hours with one change2.12 HPLC assay to measure the inhibition of Kvβ2 mediated reduction of 4-nitrobenzaldehyde All inhibition studies were carried out in duplicate in 0.2M potassiumphosphate buffer, pH 7.5 containing 0.2mM NADPH at 22°C in the presence of~0.5mg of Kvβ2 appropriate concentration of inhibitor and 500µM of 4-nitrobenzaldehyde as substrate (final volume of 0.5ml).The inhibitor wasincubated with the protein for 15 minutes before the addition of substrate, whichwas added last, and the reaction was further incubated for 40 minutes at 37°C. Thereaction was quenched by adding an equal volume of the HPLC mobile phase(methanol/trifluroacetic acid/water, 60: 0.1: 39.9). Aliquots, (10µl), of theresultant mixture were analysed on a Nucleosil C18 (3.9 x 150 mm) HPLCcolumn with monitoring by a Millipore Waters (Mississauga, Canada) liquidchromatography UV detector at 274 nm. Controls with no enzyme wereincorporated in every reaction to monitor any background reaction of the inhibitorwith the substrate 4-nitrobenzaldehyde. This method was carried out for all threeinhibitory compounds Mobile phases; Solvents A, B and C, were prepared and 30
  43. 43. used for both the isocratic and gradient methods. The contents of Solvent A, B andC are outlined in the Appendices. An isocratic method was used for Quercitin.The isocratic method used 100% Solvent B.2.12.1 Method for Gradient HPLC Assay (Rutin & Resveratrol) All samples were prepared using the same protocol as outlined above for theIsocratic HPLC Assay. A gradient assay was set up using Empower software. Alinear gradient setting of Solvent A and B was set up with a runtime of 20mins ata flow rate of 0.9ml/min. The gradient breaks down as follows: 80% to 20%Solvent A and 20% to 80% Solvent B over 15mins, 100% Solvent B, 0% SolventA for 5mins then back to original conditions of 80% Solvent A, 20% Solvent B.Fig.2.1 below illustrates this gradient. 120 Gradient Profile Isocratic Profile Solvent A Solvent B 100 80 Solvent, % 60 Return to Normal Conditions 40 20 0 0 4 8 12 16 20 24 28 32 Run Time, minutesFig.2.1. Diagram representing the Gradient elution method employed for the HPLC Analysis ofResveratrol and Rutin 31
  44. 44. 2.13 Bradford Method for Protein Concentration Determination The protein concentration of Kvβ2 enzyme was determined using Bradfordreagent and by employing the Bradford method. Analysis was carried on out onthree preparations as outlined in Table 8. A Bovine Serum Albumen (BSA)calibration standard curve was plotted by diluting 1mg/ml stock to yield theconcentrations 0-100 µg/ml of protein. This is seen in Fig.3.22. Bradford reagentwas added to each tube as described below and incubated for 5 minutes. Theabsorbance (A595nm) reading was measured using Milton Roy Spectonic 1201spectrophotometer.Tube No. Protein d.H2O Bradford Reagent 1 10ìl 70ìl 0.9ml 2 20ìl 80ìl 0.9ml 3 30ìl 70ìl 0.9mlTable 8: Outline of reaction mixtures for Bradford Method2.14 Flouresence Measurement of inhibitor - Kvβ2 binding Flourometirc analysis of the bound NADPH cofactor to Kvβ2 was takingusing Perkin Elmer fluorescence spectrometer LS50B at 22°C. A 2.0µM sampleof Kvβ2 bound NADPH was carried out in 0.2M potassium phosphate buffer at apH 7.5 and all inhibitor solutions were made in DMSO prior to dilution in 0.2Mpotassium phosphate buffer while maintaining a DMSO concentration ≤ 1% v/v.An excitation wavelength of 360nm and a slit size of 15nm were used an emissionspectra were analyzed from 300nm to 600nm. Spectra were recorded as noted inChapter 3. 10µl of inhibitor was then added to the Kvβ2 solution and invertedseveral times to mix. Using the same conditions, a spectrum was recorded at zerominutes (T0min) and at set intervals thereafter; T5min, T10min and T15min. 32
  45. 45. Chapter 3: Results 33
  46. 46. 3.0 Results3.1 PCR Results Primer concentrations are listed below each PCR image as the concentration ofsample used. Fig.3.1 to Fig.3.5 below outlines the amplification results from PCRexperiments one to five. 1 2 3 4 5Fig.3.1: PCR UV Photograph of PCR #1 on a 0.7% Agarose Gel taken at 302nm. Lane 1: 10µM:Lane 2: 20µM Sample. Lane 3: 10µM sample. Lane 4: 20µM Sample. Lane 5: 100bp Marker. 34
  47. 47. 1 2 3 4 5 6 7 8 91500bp500bp100bp Fig 3.2: PCR UV Photograph of PCR #2 on a 0.7% Agarose Gel taken at 302nm. Lane 1: 100bp Marker (sample leaked out of the well when loading, this there is streaks of DNA). Lane 2: 1µM Sample. Lane 3: 10-1µM sample. Lane 4: 10-2µM Sample. Lane 5: 10-3µM Sample. Lane 6&7: 10- 4 µM Sample. Lane 8: No sample. Lane 9: 100bp Marker. 35
  48. 48. 1 2 3 4 5 6 7 8 9 10 11 12 1500bp 500bp 100bpFig.3.3: PCR UV Photograph of PCR #3 on a 1% Agarose Gel taken at 302nm. Lane 1: 100bpmarker. Lane 2: 10-5µM Sample. Lane 3: 10-3µM Sample. Lane 4: 10-1µM Sample. Lanes 5-11: NoSample. Lane 12: 100bp marker. 1 2 3 4 5 1500bp 500bp 100bpFig.3.4: PCR UV Photograph of PCR #4 on a 1% Agarose Gel taken at 302nm. Lane 1: 100bpmarker. Lane 2: 10-5µM Alu Gene (Positive control). Lane 3: 10µM Sample. Lane 4: 10-5µMSample. Lanes 5: 100bp marker 36
  49. 49. 1 2 3 4 5 6 7 8 9 10 11 121500bp500bp100bpFig.3.5: PCR UV Photograph of PCR #5 on a 1% Agarose Gel taken at 302nm. Lane 1: 100bpmarker. Lane 2: 10µM Sample. Lane 3: 1µM Sample. Lane 4: 10-5µM Sample. Lanes 5: 10-5µMAlu Gene (Positive control). Lane 6: 100bp Marker. Lane 7: 10-5µM Alu Gene (Positive control).Lane 8: 10µM Sample. Lane 9: 1µM Sample. Lane 10: 10-5µM Sample. Lane 11: No Sample.Lane 12: 100bp marker3.2 Expression and Purification of Kvβ2 1 0.9 0.8 0.7 Absorbance (280nm) 0.6 0.5 0.4 0.3 0.2 0.1 0 -0.1 0 2 4 6 8 10 12 14 16 Protein Volume (ml)Fig. 3.6: Elution profile of purified Kvβ2 after being placed in a Ni+ column. The Phosphate bufferused during elution was measured as a blank and the protein was eluted as a single peak. 37
  50. 50. 3.3 HPLC Chromtatograms for the Inhibition of Kvβ2 Mediated Reduction of 4-nitrobenzaldehyde 3.3.1 Chromatogram Results for Rutin Experiment 0.10 9.036 NADPH 4-N-B-ald 1.702 0.08 0.06AU 7.588 0.04 0.02 4-N-B-alc 0.00 0.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 Minutes Fig.3.7: Chromatogram showing a control reaction for Rutin experiment containing 0.5mM 4- nitrobenzaldehyde, 0.2M phosphate buffer, ~10µM Kvβ2 and 0.2mM NADPH. This clearly shows the enzymatic reaction taking place with the production of 4-nitrobenzylaclohol (a product of the Kvβ2 mediated reduction of 4-nitrobenzaldehyde) 2.00 12.033 1.50 4-N-B-aldAU 1.00 9.023 1.704 0.50 NADPH 4-N-B-alc 0.00 0.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 Minutes Fig.3.8: Chromatogram showing a control reaction for Rutin experiment containing 0.5mM 4- nitrobenzaldehyde, 0.2M phosphate buffer and 0.2mM NADPH in a 10µl injection. The comparatively small peak intensity of the NADPH is due to the lack of the NADPH bound cofactor present with the inclusion of Kvβ2. 38
  51. 51. 0.030 0.028 0.026 0.024 0.022 No Rutin 0.020 0.018 100µM 0.016 300µM AU 0.014 500µM 0.012 700µM 0.010 0.008 0.006 0.004 0.002 0.000 7.12 7.14 7.16 7.18 7.20 7.22 7.24 7.26 7.28 7.30 7.32 7.34 7.36 7.38 7.40 7.42 7.44 7.46 7.48 7.50 7.52 7.54 7.56 7.58 7.60 MinutesFig.3.9: Concentration dependant inhibition of Kvβ2 by Rutin. The chromatogram shows thedecrease in peak area of the 4-nitrobenzylalcohol on the HPLC as a result of the increasingconcentration of Rutin (100µΜ, 300µΜ, 500µΜ and 700µΜ) in a mixture containing ~10 µΜΚvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-nitrobenzaldehyde (substrate), 200µM NADPHand various concentrations of Rutin, after the addition of Rutin to Κvβ2 containing NADPH. 39
  52. 52. 3.3.2 Chromatogram Results for Quercitin Experiment 0.20 4-N-B-alc 3.387 4-N-B-ald 0.15 NADPH 1.914AU 0.10 3.056 0.05 0.00 0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 11.00 12.00 13.00 14.00 15.00 Minutes Fig.3.10: Chromatogram showing a control reaction for Quercitin experiment containing 0.5mM 4-nitrobenzaldehyde, 0.2M phosphate buffer, ~10µM Kvβ2 and 0.2mM NADPH. This clearly shows the enzymatic reaction taking place with the production of 4-nitrobenzylaclohol (a product of the Kvβ2 mediated reduction of 4-nitrobenzaldehyde) 0.20 3.403 4-N-B-alc 0.15 NADPH AU 0.10 4.802 1.908 0.05 4-N-B-ald 0.00 0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 11.00 12.00 13.00 14.00 15.00 Minutes Fig. 3.11: Chromatogram showing a control reaction for Quercitin experiment containing 0.5mM 4-nitrobenzaldehyde, 0.2M phosphate buffer and 0.2mM NADPH in a 10µl injection. The comparatively small peak intensity of the NADPH is due to the lack of the NADPH bound cofactor present with the inclusion of Kvβ2. 40
  53. 53. 0.050 0.045 No Quercetin 0.040 0.035 0.030 50µM AU 0.025 100µM 0.020 300µM 0.015 500µM 0.010 0.005 0.000 2.96 2.98 3.00 3.02 3.04 3.06 3.08 3.10 3.12 3.14 3.16 3.18 3.20 MinutesFig.3.12: Concentration dependant inhibition of Kvβ2 by Quercitin . The chromatogram shows thedecrease in peak area of the 4-nitrobenzylalcohol on the HPLC as a result of the increasingconcentration of Quercitin (100µΜ, 300µΜ, 500µΜ and 700µΜ) in a mixture containing ~10 µΜΚvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-nitrobenzaldehyde (substrate), 200µM NADPHand various concentrations of Quercitin, after the addition of Quercitin to Κvβ2 containingNADPH. 41
  54. 54. 3.3.3 Chromatogram Results for Resveratrol Experiment 1.699 8.881 0.08 4-N-B-ald NADPH 0.06 7.433AU 4-N-B-alc 0.04 0.02 0.00 0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 11.00 12.00 13.00 14.00 Minutes Fig.3.13: Chromatogram showing a control reaction for Resveratrol experiment containing 0.5mM 4-nitrobenzaldehyde, 0.2M phosphate buffer, ~10µM Kvβ2 and 0.2mM NADPH. This clearly shows the enzymatic reaction taking place with the production of 4-nitrobenzylaclohol (a product of the Kvβ2 mediated reduction of 4-nitrobenzaldehyde) 0.40 1 1 .7 2 0 1 .7 0 0 8 .8 0 9 0.30 4-N-B-alc 4-N-B-aldAU 0.20 NADPH 0.10 0.00 0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 11.00 12.00 13.00 14.00 15.00 16.00 17.00 18.00 19.00 20.00 Minutes Fig.3.14: Chromatogram showing a control reaction for Resveratrol experiment containing 0.5mM 4- nitrobenzaldehyde, 0.2M phosphate buffer and 0.2mM NADPH in a 10µl injection. The comparatively small peak intensity of the NADPH is due to the lack of the NADPH bound cofactor present with the inclusion of Kvβ2. 42
  55. 55. 0.018 No Resveratrol 0.016 100µM 0.014 300µM 0.012 500µM 0.010AU 0.008 0.006 0.004 0.002 0.000 7.30 7.35 7.40 7.45 7.50 7.55 7.60 7.65 7.70 7.75 7.80 7.85 7.90 7.95 8.00 MinutesFig.3.15. Concentration dependant inhibition of Kvβ2 by Resveratrol. The chromatogram showsthe decrease in peak area of the 4-nitrobenzylalcohol on the HPLC as a result of the increasingconcentration of Resveratrol (100µΜ, 300µΜ, 500µΜ and 700µΜ) in a mixture containing ~10µΜ Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-nitrobenzaldehyde (substrate), 200µMNADPH and various concentrations of Resveratrol, after the addition of Resveratrol to Κvβ2containing NADPH. 43
  56. 56. 3.4 Percentage Inhibition Results for Rutin, Quercitin and ResveratrolFig.3.16: Concentration dependant inhibition of Kvβ2 by Rutin. The graph shows the percentage-inhibition of the Kvβ2 activity as a result of increasing concentrations of Rutin (0-2000µM) in amixture containing ~10 µΜ Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-nitrobenzaldehyde(substrate), 200µM NADPH and various concentrations of Rutin, after the addition of Rutin toΚvβ2 containing NADPH and 4-nitrobenzaldehyde.Fig.3.17: Concentration dependant inhibition of Kvβ2 by Quercitin. The graph shows thepercentage-inhibition of the Kvβ2 activity as a result of increasing concentrations of Quercitin (0-2000µM) in a mixture containing ~10 µΜ Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-nitrobenzaldehyde (substrate), 200µM NADPH and various concentrations of Quercitin, after theaddition of Rutin to Κvβ2 containing NADPH and 4-nitrobenzaldehyde. 44
  57. 57. Fig.3.18: Concentration dependant inhibition of Kvβ2 by Resveratrol. The graph shows thepercentage-inhibition of the Kvβ2 activity as a result of increasing concentrations of Resveratrol(0-2000µM) in a mixture containing ~10 µΜ Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-nitrobenzaldehyde (substrate), 200µM NADPH and various concentrations of Resveratrol, after theaddition of Rutin to Κvβ2 containing NADPH and 4-nitrobenzaldehyde.3.5 Flouresence SpectraFig,3.19: Flourometric data showing the binding of Rutin to Kvβ2 in a 2µM Kvβ2 + 50µMphosphate buffer mixture which is leading to a 64% reduction in Flouresence emission of the peakat 460nm representing the bound cofactor. 45
  58. 58. Fig.3.20: Flourometric data showing the binding of Quercitin to Kvβ2 in a 2µM Kvβ2 + 50µMphosphate buffer mixture which is leading to a 82% reduction in Flouresence emission of the peakat 460nm representing the bound cofactor.Fig.3.21: Flourometric data showing the binding of Resveratrol to Kvβ2 in a 2µM Kvβ2 + 50µMphosphate buffer mixture which is leading to a 21% reduction in Flouresence emission of the peakat 460nm representing the bound cofactor. 46
  59. 59. 3.5 Bradford Method Standard Curve 0.5 0.4Absorbance at 595 nm 0.3 0.2 0.1 0 0 10 20 30 40 50 60 70 80 90 100 [BSA] (µg/ml) Fig.3.22: Data shown represents BSA standard curve for the estimation of protein concentration using the Bradford Method. 47
  60. 60. Chapter 4:Discussion 48
  61. 61. 49

×