Outline
•  Introduction to GenomeSpace
•  GenomeSpace Tools and Recipes
•  GenomeSpace User Interface
•  Integrative analy...
The	
  vision:	
  Integra0ve	
  Transla0onal	
  Genomics	
  
GenePattern Cytoscape IGV/UCSC Genomica
Network
Compendium
Ex...
Driving	
  Biological	
  
Projects	
  
lincRNAs	
  
	
  
Cancer	
  stem	
  cells	
  
	
  
Pa1ent	
  Stra1fica1on	
  
	
  
O...
•  Support	
  for	
  all	
  types	
  of	
  resource:	
  Web-­‐
based,	
  desktop,	
  etc.	
  
•  Automa1c	
  conversion	
 ...
GenomeSpace-Enabled Tools
Integrative GenomicsViewer	

Cytoscape	

Galaxy	

GenePattern	

GenomeSpace Components
Authentic...
Register	
  
www.genomespace.org
Register	
  
Register	
  
Register	
  
Login	
  
Login	
  
GenomeSpace	
  UI	
  
Tools	
  and	
  Recipes	
  
Focus	
  on	
  Kitchen	
  Skills	
  
Agenda	
  
•  Review	
  of	
  GenomeSpace	
  tools	
  in	
  the	
  first	
  
exercises	
  
•  Basic	
  recipes	
  for	
  us...
GenomeSpace	
  Tools	
  
ArrayExpress	
  
Galaxy	
  
Cistrome	
  
Cytoscape	
  
GenePa9ern	
  
Genomica	
  
ISAcreator	
  ...
Cytoscape	
  
Cytoscape	
  is	
  an	
  open-­‐source	
  bioinforma1cs	
  soSware	
  plaTorm	
  
for	
  visualizing	
  mole...
Galaxy	
  
Galaxy	
  is	
  an	
  open-­‐source,	
  scalable	
  framework	
  for	
  tool	
  integra1on	
  that	
  allows	
 ...
Genomica	
  
Genomica	
  is	
  an	
  analysis	
  and	
  visualiza1on	
  tool	
  for	
  genomic	
  data	
  
that	
  can	
  ...
GenePa9ern	
  
GenePa9ern	
  is	
  a	
  powerful	
  genomic	
  analysis	
  plaTorm	
  that	
  provides	
  access	
  to	
  ...
ArrayExpress	
  
ArrayExpress	
  is	
  a	
  repository	
  of	
  over	
  30,000	
  func1onal	
  genomics	
  
experiments	
 ...
geWorkbench	
  
geWorkbench	
  is	
  an	
  open-­‐source	
  bioinforma1cs	
  plaTorm	
  that	
  offers	
  a	
  
comprehensi...
Cistrome	
  
In	
  addi1on	
  to	
  the	
  standard	
  Galaxy	
  func1ons,	
  Cistrome	
  has	
  29	
  ChIP-­‐chip-­‐	
  a...
Gitools	
  
•  Gitools	
  is	
  a	
  framework	
  for	
  analysis	
  and	
  visualiza1on	
  of	
  
genomic	
  data	
  usin...
Integra1ve	
  Genomics	
  Viewer	
  (IGV)	
  
The	
  Integra0ve	
  Genomics	
  Viewer	
  (IGV)	
  is	
  a	
  high-­‐perfor...
InSilicoDB	
  
InSilico	
  DB	
  is	
  a	
  web-­‐based	
  genomics	
  data	
  manager	
  containing	
  
thousands	
  of	
...
UCSC	
  Table	
  Browser	
  
The	
  Table	
  Browser	
  allows	
  you	
  to	
  retrieve	
  data	
  associated	
  with	
  a...
Basic	
  GenomeSpace	
  recipes	
  
•  Uploading	
  data	
  
•  Launching	
  tools	
  
•  Transi1oning	
  across	
  tools	...
Uploading	
  Data	
  
1	
  
2	
  
3	
  
Launching	
  tools	
  
Click on the tool’s icon
Launching	
  tools	
  
Open the tool’s context menu
Then click on Launch
(or Launch on File)
Then click on one of
The files to get the
Launch menu and pick
Your tool
Launching	
  Tools	
  
Click the checkbox for
one...
Launching	
  tools	
  
Then click the
Launch button
Click	
  and	
  drag	
  a	
  
File	
  onto	
  a	
  tool	
  	
  
icon	
...
Transi1oning	
  across	
  tools	
  
1.  Launch	
  Genomica	
  
-­‐  Load	
  (shared)	
  data	
  from	
  GenomeSpace	
  
-­...
Launch	
  Genomica	
  
•  Using	
  one	
  of	
  the	
  op1ons	
  you	
  saw	
  earlier	
  
–  Click	
  on	
  the	
  icon	
...
Loading	
  into	
  Genomica	
  
Home ▸ Shared to <your id> ▸ mmr ▸ FGED ▸ 80_module.gxp
Saving	
  Back	
  to	
  GenomeSpace	
  
Launching	
  GenePa9ern	
  	
  
•  You	
  can	
  do	
  this	
  from	
  within	
  Genomica	
  or	
  also	
  from	
  
the	
 ...
Process	
  the	
  data	
  
•  Run	
  PreprocessDataset	
  with	
  default	
  
parameters	
  
Save	
  the	
  result	
  
Use the context menu for the file on
either the job result page …
Save	
  the	
  result	
  
…or the context menu for the file on
the GenePattern home page.
Saving	
  to	
  GenomeSpace	
  
Click “Save to GenomeSpace”
from the context menu and then
select a targetdirectory
Send	
  to	
  IGV	
  
•  In	
  the	
  GenomeSpace	
  interface,	
  launch	
  IGV	
  
– Open	
  the	
  ‘GenomeSpace’	
  men...
Select	
  your	
  file	
  (from	
  GenePa9ern)	
  
Visualize	
  in	
  IGV	
  
GenomeSpace	
  UI	
  
A	
  detailed	
  tour	
  of	
  the	
  GenomeSpace	
  
User	
  Interface	
  
Agenda	
  
•  File	
  Management	
  
•  File	
  opera1ons	
  
•  Sharing	
  with	
  others	
  
•  Organizing	
  your	
  to...
File	
  Management	
  
	
  
•  Move	
  a	
  file	
  or	
  directory	
  
•  Copy	
  …	
  
•  Dele1ng	
  …	
  
•  Crea1ng	
  ...
File	
  Opera1ons	
  
•  Previewing	
  a	
  file	
  	
  
•  Extrac1ng	
  rows	
  and/or	
  columns	
  
•  Format	
  convers...
File	
  Preview	
  
Extrac1ng	
  Rows	
  and/or	
  Columns	
  
Extrac1ng	
  rows	
  and/or	
  columns	
  
• Check the columns you want to include
• Provide a first (and optionally last)...
Sharing	
  with	
  others	
  
•  Sharing	
  files	
  with	
  
– Individuals,	
  groups	
  
•  Crea1ng	
  groups	
  for	
  s...
Organizing	
  tools	
  
Drag and drop
tools in the list
reorder them
Uncheck the tool
To remove it from
The toolbar
Other	
  GenomeSpace	
  Tools	
  
ArrayExpress	
  
Galaxy	
  
Cistrome	
  
Cytoscape	
  
GenePa9ern	
  
Genomica	
  
ISAcr...
ArrayExpress	
  
•  Repository	
  of	
  over	
  30,000	
  gene	
  expression	
  and	
  other	
  
func1onal	
  genomics	
  ...
Cistrome	
  
29	
  ChIP-­‐chip	
  and	
  ChIP-­‐seq	
  tools,	
  including:	
  
•  Preliminary	
  peak	
  calling	
  
•  C...
Cytoscape	
  
•  Visualize	
  molecular	
  interac1on	
  networks	
  and	
  biological	
  
pathways	
  
•  Integrate	
  ne...
Galaxy	
  
Galaxy	
  is	
  an	
  open-­‐source,	
  scalable	
  framework	
  for	
  tool	
  integra1on	
  that	
  allows	
 ...
geWorkbench	
  
Analysis,	
  visualiza1on,	
  and	
  annota1on	
  of	
  biomedical	
  data,	
  including:	
  
•  Microarra...
Gitools	
  
Analysis	
  and	
  visualiza1on	
  of	
  genomic	
  data,	
  including:	
  
•  Interac1ve	
  heatmaps	
  
•  E...
InSilicoDB	
  
Web-­‐based	
  genomics	
  data	
  portal	
  containing	
  thousands	
  of	
  
curated	
  public	
  dataset...
UCSC	
  Table	
  Browser	
  
•  Query	
  and	
  retrieve	
  genomic	
  sequence	
  data	
  in	
  text	
  format	
  
•  Sen...
MSigDB	
  	
  
Molecular	
  Signatures	
  Database	
  
•  Query	
  and	
  retrieve	
  a	
  large	
  compendium	
  of	
  ge...
Michael Reich, GenomeSpace Workshop, fged_seattle_2013
Upcoming SlideShare
Loading in …5
×

Michael Reich, GenomeSpace Workshop, fged_seattle_2013

714 views

Published on

GenomeSpace Workshop: Intro, tools and recipes, Integrative analysis exercise, development

Published in: Technology, Education
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
714
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
8
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Michael Reich, GenomeSpace Workshop, fged_seattle_2013

  1. 1. Outline •  Introduction to GenomeSpace •  GenomeSpace Tools and Recipes •  GenomeSpace User Interface •  Integrative analysis exercise •  Other GenomeSpace Tools •  GenomeSpace development •  Q and A
  2. 2. The  vision:  Integra0ve  Transla0onal  Genomics   GenePattern Cytoscape IGV/UCSC Genomica Network Compendium Expression Alterations atcgcgtttattcgataagg! atcgcgttttttcgataagg! ! CMAP Add Transcription Factor track from UCSC 6 Looks close to p53 site 7 Test for similarity of p53 and gene location 8 Extract module ii Learn p53 site/score on promoter iv Load compendium Show module map i Show Chromosome 5 Expand +1 (include neighbors) 4 Show network 3 Differentially Expressed Genes 1 Idea GSEA test enrichment 2 iii Arrests G2/M Conclusion vi Pathway activation Added to GenePattern v
  3. 3. Driving  Biological   Projects   lincRNAs     Cancer  stem  cells     Pa1ent  Stra1fica1on     Outreach  to  new  DBPs   Seed  Tools   Cytoscape   Galaxy   GenePa9ern   Genomica   IGV   UCSC  Browser     Outreach  to  new  tools   Online community to share diverse computational tools www.genomespace.org
  4. 4. •  Support  for  all  types  of  resource:  Web-­‐ based,  desktop,  etc.   •  Automa1c  conversion  of  data  formats   between  tools   •  Easy  access  to  data  from  any  loca1on   •  Ease  of  entry  into  the  environment   GenomeSpace: a connection layer between integrative analysis tools  
  5. 5. GenomeSpace-Enabled Tools Integrative GenomicsViewer Cytoscape Galaxy GenePattern GenomeSpace Components Authentication and Authorization Genome Space Server Data Manager Analysis and Tool Manager GenomeSpace Project Data GenomeSpace Server
  6. 6. Register   www.genomespace.org
  7. 7. Register  
  8. 8. Register  
  9. 9. Register  
  10. 10. Login  
  11. 11. Login  
  12. 12. GenomeSpace  UI  
  13. 13. Tools  and  Recipes   Focus  on  Kitchen  Skills  
  14. 14. Agenda   •  Review  of  GenomeSpace  tools  in  the  first   exercises   •  Basic  recipes  for  using  GenomeSpace   – Launching  tools   – Uploading  data  to  GenomeSpace   – Sending  data  to  tools  
  15. 15. GenomeSpace  Tools   ArrayExpress   Galaxy   Cistrome   Cytoscape   GenePa9ern   Genomica   ISAcreator   geWorkbench   Gitools   IGV   InSilicoDB   UCSC  Table  Browser   MSigDB  
  16. 16. Cytoscape   Cytoscape  is  an  open-­‐source  bioinforma1cs  soSware  plaTorm   for  visualizing  molecular  interac1on  networks  and  biological   pathways,  and  integra1ng  these  networks  with  annota1ons,   gene  expression  profiles,  and  other  state  data.    
  17. 17. Galaxy   Galaxy  is  an  open-­‐source,  scalable  framework  for  tool  integra1on  that  allows   users  to  analyze  mul1ple  alignments,  compare  genomic  annota1ons,  and   profile  metagenomic  samples,  among  many  possible  analyses;  workflows   allow  the  linking  together  of  analyses.  
  18. 18. Genomica   Genomica  is  an  analysis  and  visualiza1on  tool  for  genomic  data   that  can  integrate  gene  expression  data,  DNA  sequence  data,   and  gene  and  experiment  annota1on  informa1on.  
  19. 19. GenePa9ern   GenePa9ern  is  a  powerful  genomic  analysis  plaTorm  that  provides  access  to   more  than  150  tools  for  gene  expression  analysis,  proteomics,  SNP   analysis,  flow  cytometry,  RNA-­‐seq  analysis,  and  common  data  processing   tasks.  A  web-­‐based  interface  provides  easy  access  to  these  modules  and   allows  for  the  crea1on  of  mul1-­‐step  analysis  pipelines  that  enable   reproducible  in  silico  research.  
  20. 20. ArrayExpress   ArrayExpress  is  a  repository  of  over  30,000  func1onal  genomics   experiments  comprising  nearly  1  million  assays.  Users  can   query  and  retrieve  data  in    a  number  of  different  formats   including  the  MIAME  and  MINSEQE  standards.  
  21. 21. geWorkbench   geWorkbench  is  an  open-­‐source  bioinforma1cs  plaTorm  that  offers  a   comprehensive  and  extensible  collec1on  of  tools  for  the  management,   analysis,  visualiza1on,  and  annota1on  of  biomedical  data.  For  microarrays,   there  are  tools  for  filtering  and  normaliza1on,  basic  sta1s1cal  analyses,   clustering,  network  reverse  engineering,  as  well  as  many  common   visualiza1on  tools  
  22. 22. Cistrome   In  addi1on  to  the  standard  Galaxy  func1ons,  Cistrome  has  29  ChIP-­‐chip-­‐  and   ChIP-­‐seq-­‐specific  tools  in  three  major  categories,  from  preliminary  peak   calling  and  correla1on  analyses,  to  downstream  genome  feature   associa1on,  gene  expression  analyses,  and  mo1f  discovery.  
  23. 23. Gitools   •  Gitools  is  a  framework  for  analysis  and  visualiza1on  of   genomic  data  using  interac1ve  heatmaps.  
  24. 24. Integra1ve  Genomics  Viewer  (IGV)   The  Integra0ve  Genomics  Viewer  (IGV)  is  a  high-­‐performance  visualiza1on   tool  for  interac1ve  explora1on  of  large,  integrated  genomic  datasets.  It   supports  a  wide  variety  of  data  types,  including  array-­‐based  and  next-­‐ genera1on  sequence  data,  and  genomic  annota1ons.  
  25. 25. InSilicoDB   InSilico  DB  is  a  web-­‐based  genomics  data  manager  containing   thousands  of  curated  public  datasets.    The  datasets  can  be   exported  to  analysis  tools  and  GenomeSpace.  
  26. 26. UCSC  Table  Browser   The  Table  Browser  allows  you  to  retrieve  data  associated  with  a  track  in  text   format,  to  calculate  intersec1ons  between  tracks,  and  to  retrieve  DNA   sequence  covered  by  a  track.    ASer  you  select  the  op1ons  for  your  output   file,  you  can  opt  to  send  your  output  file  to  your  GenomeSpace  cloud   storage.  
  27. 27. Basic  GenomeSpace  recipes   •  Uploading  data   •  Launching  tools   •  Transi1oning  across  tools  
  28. 28. Uploading  Data   1   2   3  
  29. 29. Launching  tools   Click on the tool’s icon
  30. 30. Launching  tools   Open the tool’s context menu Then click on Launch (or Launch on File)
  31. 31. Then click on one of The files to get the Launch menu and pick Your tool Launching  Tools   Click the checkbox for one (or more) files
  32. 32. Launching  tools   Then click the Launch button Click  and  drag  a   File  onto  a  tool     icon  
  33. 33. Transi1oning  across  tools   1.  Launch  Genomica   -­‐  Load  (shared)  data  from  GenomeSpace   -­‐  Save  it  back  to  a  new  folder   2.  Launch  GenePa9ern  on  your  data   -­‐  Do  a  simple  processing  step   -­‐  Save  it  back  to  GenomeSpace   -­‐  Send  it  to  IGV   3.  Visualize  the  procesed  data  IGV  
  34. 34. Launch  Genomica   •  Using  one  of  the  op1ons  you  saw  earlier   –  Click  on  the  icon   –  or  use  the  context  menu   –  or  use  the  launch  menu   •  Load  data  from  GenomeSpace     Home  ▸    Public  ▸    SharedData  ▸    Demos  ▸    Scenario  ▸    step3  ▸    80_module.gxp   Or   Home  ▸    Shared  to  <your  id>  ▸  mmr  ▸    FGED  ▸    80_module.gxp    
  35. 35. Loading  into  Genomica   Home ▸ Shared to <your id> ▸ mmr ▸ FGED ▸ 80_module.gxp
  36. 36. Saving  Back  to  GenomeSpace  
  37. 37. Launching  GenePa9ern     •  You  can  do  this  from  within  Genomica  or  also  from   the  GenomeSpace  interface   •  Select  “PreprocessDataset”  in  the  send  to  module  
  38. 38. Process  the  data   •  Run  PreprocessDataset  with  default   parameters  
  39. 39. Save  the  result   Use the context menu for the file on either the job result page …
  40. 40. Save  the  result   …or the context menu for the file on the GenePattern home page.
  41. 41. Saving  to  GenomeSpace   Click “Save to GenomeSpace” from the context menu and then select a targetdirectory
  42. 42. Send  to  IGV   •  In  the  GenomeSpace  interface,  launch  IGV   – Open  the  ‘GenomeSpace’  menu  and  ‘Load  from   GenomeSpace’  
  43. 43. Select  your  file  (from  GenePa9ern)  
  44. 44. Visualize  in  IGV  
  45. 45. GenomeSpace  UI   A  detailed  tour  of  the  GenomeSpace   User  Interface  
  46. 46. Agenda   •  File  Management   •  File  opera1ons   •  Sharing  with  others   •  Organizing  your  tools    
  47. 47. File  Management     •  Move  a  file  or  directory   •  Copy  …   •  Dele1ng  …   •  Crea1ng  subdirectories   •  Recent  uploads  
  48. 48. File  Opera1ons   •  Previewing  a  file     •  Extrac1ng  rows  and/or  columns   •  Format  conversion  
  49. 49. File  Preview  
  50. 50. Extrac1ng  Rows  and/or  Columns  
  51. 51. Extrac1ng  rows  and/or  columns   • Check the columns you want to include • Provide a first (and optionally last) row index to include • Edit the file name and ‘Save’
  52. 52. Sharing  with  others   •  Sharing  files  with   – Individuals,  groups   •  Crea1ng  groups  for  sharing   •  Sharing  links   – With  other  GenomeSpace  users   – To  people  without  GenomeSpace  accounts  
  53. 53. Organizing  tools   Drag and drop tools in the list reorder them Uncheck the tool To remove it from The toolbar
  54. 54. Other  GenomeSpace  Tools   ArrayExpress   Galaxy   Cistrome   Cytoscape   GenePa9ern   Genomica   ISAcreator   geWorkbench   Gitools   IGV   InSilicoDB   UCSC  Table  Browser   MSigDB  
  55. 55. ArrayExpress   •  Repository  of  over  30,000  gene  expression  and  other   func1onal  genomics  experiments  comprising  nearly  1  million   assays.     •  Query  and  retrieve  data  in    a  number  of  different  formats   including  MIAME  and  MINSEQE.  
  56. 56. Cistrome   29  ChIP-­‐chip  and  ChIP-­‐seq  tools,  including:   •  Preliminary  peak  calling   •  Correla1on  analyses   •  Downstream  genome  feature  associa1on   •  Gene  expression  analyses   •  Mo1f  discovery  
  57. 57. Cytoscape   •  Visualize  molecular  interac1on  networks  and  biological   pathways   •  Integrate  networks  with  annota1ons,  gene  expression  profiles,   and  other  data  
  58. 58. Galaxy   Galaxy  is  an  open-­‐source,  scalable  framework  for  tool  integra1on  that  allows   users  to  analyze  mul1ple  alignments,  compare  genomic  annota1ons,  and   profile  metagenomic  samples,  among  many  possible  analyses;  workflows   allow  the  linking  together  of  analyses.  
  59. 59. geWorkbench   Analysis,  visualiza1on,  and  annota1on  of  biomedical  data,  including:   •  Microarray  filtering,  normaliza1on,  clustering,  network  reverse   engineering   •  Basic  and  advanced  sta1s1cal  methods   •  Regulator  analysis   •  Common  visualiza1on  tools   •  Links  to  databases  
  60. 60. Gitools   Analysis  and  visualiza1on  of  genomic  data,  including:   •  Interac1ve  heatmaps   •  Enrichment  analysis  (e.g.  of  Gene  Ontology  terms)   •  Import  from  Web-­‐based  data  sources  (IntOgen,  BioMart)  
  61. 61. InSilicoDB   Web-­‐based  genomics  data  portal  containing  thousands  of   curated  public  datasets,  including  all  of  the  Gene  Expression   Omnibus  (GEO).    
  62. 62. UCSC  Table  Browser   •  Query  and  retrieve  genomic  sequence  data  in  text  format   •  Send  data  to  GenomeSpace  and  other  analysis  and  visualiza1on  tools   •  Calculate  intersec1ons  between  genome  tracks  
  63. 63. MSigDB     Molecular  Signatures  Database   •  Query  and  retrieve  a  large  compendium  of  gene  sets,  including  regulatory,     metabolic,  and  genomic  pathways,  genomic  posi1on-­‐based  gene  sets,  etc.   •  Send  data  to  GenomeSpace  and  other  analysis  and  visualiza1on  tools   •  Calculate  overlap  sta1s1cs  between  gene  sets  

×