Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Learning bioengineering by doing

132 views

Published on

How could you enable thousands and eventually millions of people to learn something new? What if the subject was poorly understood, wildly controversial yet profoundly important, and practically inaccessible to most? Stanford Professor Drew Endy reflects on a variety of experiences having to do with the emergence of a new engineering major (bioengineering) at both MIT and Stanford and the broader promulgation and advancement of these ideas globally via students everywhere through iGEM.

Published in: Education
  • Be the first to comment

  • Be the first to like this

Learning bioengineering by doing

  1. 1. main( ) { Learning by doing Engineering + biology = ? Now what? } # endy@stanford.edu # Yale NUS STEM Innovation # 27 April 2017 # fair use, public domain, have fun
  2. 2. Growing is Forever, a film by Jesse Rosten #include <biology.h>
  3. 3. watermelon eggplant carrot banana corn broccoli #include <domestication.h>
  4. 4. #include <breeding.h>
  5. 5. #include <landuse.h>
  6. 6. #include <rDNA.h>
  7. 7. http://www.whatisbiotechnology.org/science/rdna Engineering even a single gene can be incredibly important & valuable.
  8. 8. http://www.apsnet.org/edcenter/intropp/lessons/viruses/Pages/PapayaRingspotvirus.aspx Dennis Gonsalves
  9. 9. Graphic c/o "Synthetic Aesthetics,” MIT Press (2014)
  10. 10. http://www.nature.com/nbt/journal/v34/n3/abs/nbt.3491.html #include <bioeconomy.h>
  11. 11. Third sentence: “In the use of the term bioengineering in this book we exclude genetic engineering; that is, the systematic design of phenotypes by manipulation of genotypes.”
  12. 12. http://www.depts.washington.edu/hhmibio/MIT05.pdf
  13. 13. http://www.depts.washington.edu/hhmibio/MIT05.pdf
  14. 14. http://www.depts.washington.edu/hhmibio/MIT05.pdf
  15. 15. Cure diseases. Understand & “debug” natural biological systems. Teach me to… Save environments. Design & build organisms. Make doing the above easier.
  16. 16. Could we make biology easy to engineer? Atomic-scale thermal noise Self-mixing molecular systems Reproducing “machines” High heterogeneity Living ramifications
  17. 17. Free .PDF of full briefing via DOI 1721.1/38455
  18. 18. Graphic from "Synthetic Aesthetics" MIT Press (2014)
  19. 19. TAATACGACTCACTATAGGGAGA DNA synthesis = 4 key keyboard for genetic stuff Raw chemicals, not derived from existing DNA Play however you like to get the DNA you want, from scratch.
  20. 20. Systems = One or more devices encoding a human defined function(s). Note that my system your device, and so on. Devices = One or more parts encoding a human defined function(s). Parts = Basic biological functions encoded via molecules. DNA = Material encoding moleculesCTATAGGGAGA 8-bit counter Abstraction barrier! Do not cross! Abstraction barrier! Do not cross! Abstraction barrier! Do not cross!
  21. 21. https://en.wikipedia.org/wiki/Pedagogy_of_the_Oppressed “(Friere) argues for pedagogy to treat the learner as a co- creator of knowledge.”
  22. 22. MIT 2003
  23. 23. St-Pierre & Endy PNAS USA 2008 http://youtu.be/sLkZ9FPHJGM George Boole, c.1854
  24. 24. George Boole, c.1854
  25. 25. MIT 2004
  26. 26. SBC 2004
  27. 27. iGEM 2005
  28. 28. iGEM 2006
  29. 29. Tianjin 2006
  30. 30. iGEM 2007
  31. 31. iGEM 2008
  32. 32. http://diyhpl.us/wiki/dna/projects/
  33. 33. iGEM 2009
  34. 34. Cambridge iGEM 2009
  35. 35. iGEM 2010 38
  36. 36. iGEM.org ~2015
  37. 37. http://partsregistry.org/wiki/index.php?title=Part:BBa_K590087
  38. 38. http://synbiobeta.com/news/igem-startup-pvp-biologics-closes-35-million-agreement-pharmaceutical-company-takeda/
  39. 39. https://www.youtube.com/watch?v=JI5exP6iHWw
  40. 40. Overcoming Teaching Disorders & Delusional Deliverables
  41. 41. What is more valuable, the puzzle or the answer? kiva.org
  42. 42. What capacities should be available to all citizens? Jefferson to Adams re: “natural aristocracy” October 1813
  43. 43. How many people should be able to read and write? http://themindunleashed.com/2015/06/see-the-worlds-most-spoken-languages-in-one-eye-opening-infographic.html
  44. 44. http://githut.info/ https://www.infoq.com/news/2014/01/IDC-software-developers How many people should be able to read and write computer programs?
  45. 45. igem.org How many people should be able to read and write DNA?
  46. 46. What should be the price of using a language? http://www.cnn.com/2013/11/18/tech/innovation/gettysburg-address-preservation/
  47. 47. www.sb7.info

×