Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Growing is Forever, a film by Jesse Rosten
Building a new biology
watermelon eggplant carrot
banana corn broccoli
http://www.hhmi.org/biointeractive/dog-breeding
oil palm plantation
Genetically Engineered U.S. Domestic Product (2012)
http://www.nature.com/nbt/journal/v34/n3/abs/nbt.3491.html
http://en.wikipedia.org/wiki/Subtilisin
=
1x
~20x
~200,000x
~1980, better soap cut US domestic hot water
heating by up to ...
Graphic c/o "Synthetic Aesthetics,” MIT Press (2014)
http://www.apsnet.org/edcenter/intropp/lessons/viruses/Pages/PapayaRingspotvirus.aspx
Dennis
Gonsalves
11
12Free .PDF of full briefing via DOI 1721.1/38455
13
http://ai.eecs.umich.edu/people/conway/VLSI/MIT78/MIT78.html
Lynn Conway’sVLSI course (1978)
14Free .PDF of full briefing via DOI 1721.1/38455
15
Graphic from "Synthetic Aesthetics" MIT Press (2014)
TAATACGACTCACTATAGGGAGA
Gene & Genome Constr. = #1 Tech. of 21st Ctry.
From abstract
information to
physical, living
DNA d...
Luxo Jr., Pixar Animation Studios
http://www.wired.com/2013/04/how-pixar-used-moores-law-to-predict-the-future/
“When the group moved to California to becom...
http://en.wikipedia.org/wiki/Moore%27s_law
http://www.synthesis.cc/cgi-bin/mt/mt-search.cgi?blog_id=1&tag=Carlson%20Curves
DNA sequencing (read) & synthesis (write)
...
DNA sequencing (read) & synthesis (write)
are improving faster than silicon-based fab.
OK GO, on treadmills
https://www.yo...
How should we organize ourselves to synthesize
a first human genome? Should we? Stay tuned.
25
http://nas-sites.org/synbioroadmap/
Growing is Forever, a film by Jesse Rosten
Building anew, biology
http://www.livingplanetindex.org/projects?main_page_project=AboutTheIndex&home_flag=1
Past ~45 years, humans x 2, animals /...
The living bridges of Cherrapunji, India are made from the roots of the Ficus elastica tree. (http://rootbridges.blogspot....
www.syntheticaesthetics.org
SISSEL TOLAAS
CHRISTINA AGAPAKIS
SISSEL TOLAAS
CHRISTINA AGAPAKIS
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
SISSEL TOLAAS
CHRISTINA AGAPAKIS
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
SISSEL TOLAAS
CHRISTINA AGAPAKIS
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
SISSEL TOLAAS
CHRISTINA AGAPAKIS
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
You are what you eat!
We eat what we are...
SISSEL TOLAAS
CHRISTINA AGAPAKIS
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheti...
Cambridge iGEM 2009
46
Photo by Roger Lancaster (http://www.flickr.com/photos/rogeral/5813079061/); educational fair use
48
49
50
51
52
53
54
55
56
57
58
59
The living bridges of Cherrapunji, India are made from the roots of the Ficus elastica tree. (http://rootbridges.blogspot....
Building Anew, Biology
Building Anew, Biology
Building Anew, Biology
Building Anew, Biology
Building Anew, Biology
Building Anew, Biology
Building Anew, Biology
Building Anew, Biology
Building Anew, Biology
Building Anew, Biology
Building Anew, Biology
Building Anew, Biology
Building Anew, Biology
Building Anew, Biology
Building Anew, Biology
Upcoming SlideShare
Loading in …5
×

Building Anew, Biology

691 views

Published on

From "Building A New Biology" to "Building Anew, Biology." Slide deck used with parents & incoming frosh at Stanford's 2016 admit weekend.

Published in: Engineering
  • Be the first to comment

Building Anew, Biology

  1. 1. Growing is Forever, a film by Jesse Rosten Building a new biology
  2. 2. watermelon eggplant carrot banana corn broccoli
  3. 3. http://www.hhmi.org/biointeractive/dog-breeding
  4. 4. oil palm plantation
  5. 5. Genetically Engineered U.S. Domestic Product (2012) http://www.nature.com/nbt/journal/v34/n3/abs/nbt.3491.html
  6. 6. http://en.wikipedia.org/wiki/Subtilisin = 1x ~20x ~200,000x ~1980, better soap cut US domestic hot water heating by up to 10% (or 100,000 bbl oil per day) 7
  7. 7. Graphic c/o "Synthetic Aesthetics,” MIT Press (2014)
  8. 8. http://www.apsnet.org/edcenter/intropp/lessons/viruses/Pages/PapayaRingspotvirus.aspx Dennis Gonsalves
  9. 9. 11
  10. 10. 12Free .PDF of full briefing via DOI 1721.1/38455
  11. 11. 13 http://ai.eecs.umich.edu/people/conway/VLSI/MIT78/MIT78.html Lynn Conway’sVLSI course (1978)
  12. 12. 14Free .PDF of full briefing via DOI 1721.1/38455
  13. 13. 15 Graphic from "Synthetic Aesthetics" MIT Press (2014)
  14. 14. TAATACGACTCACTATAGGGAGA Gene & Genome Constr. = #1 Tech. of 21st Ctry. From abstract information to physical, living DNA designs. 2003: $4/bp 2015: $0.04/bp 2027: $0.0004/bp? 16
  15. 15. Luxo Jr., Pixar Animation Studios
  16. 16. http://www.wired.com/2013/04/how-pixar-used-moores-law-to-predict-the-future/ “When the group moved to California to become part of Lucasfilm, we got close to making a computer-animated movie again in the mid-1980s — this time about a monkey with godlike powers but a missing prefrontal cortex. We had a sponsor, a story treatment, and a marketing survey. We were prepared to make a screen test: Our hot young animator John Lasseter had sketched numerous studies of the hero monkey and had the sponsor salivating over a glass- dragon protagonist. But when it came time to harden the deal and run the numbers for the contracts, I discovered to my dismay that computers were still too slow: The projected production cost was too high and the computation time way too long. We had to back out of the deal. This time, we [knew enough] to correctly apply Moore’s Law — [] we had to wait another five years to start making the first movie. And sure enough, five years later Disney approached us to make Toy Story.” — Alvy Ray Smith
  17. 17. http://en.wikipedia.org/wiki/Moore%27s_law
  18. 18. http://www.synthesis.cc/cgi-bin/mt/mt-search.cgi?blog_id=1&tag=Carlson%20Curves DNA sequencing (read) & synthesis (write) are improving faster than silicon-based fab.
  19. 19. DNA sequencing (read) & synthesis (write) are improving faster than silicon-based fab. OK GO, on treadmills https://www.youtube.com/watch?v=dTAAsCNK7RA
  20. 20. How should we organize ourselves to synthesize a first human genome? Should we? Stay tuned.
  21. 21. 25
  22. 22. http://nas-sites.org/synbioroadmap/
  23. 23. Growing is Forever, a film by Jesse Rosten Building anew, biology
  24. 24. http://www.livingplanetindex.org/projects?main_page_project=AboutTheIndex&home_flag=1 Past ~45 years, humans x 2, animals / 2
  25. 25. The living bridges of Cherrapunji, India are made from the roots of the Ficus elastica tree. (http://rootbridges.blogspot.com/) Reproducing, growing, & healing materials ~90 terawatts; pre-distributed Massively functional Living ramifications Biology is nature’s nanotechnology Take infectious & other diseases off the table Provide for all of humanity Stabilize & recover natural biodiversity Enable a culture of citizenship Understand life via building
  26. 26. www.syntheticaesthetics.org SISSEL TOLAAS CHRISTINA AGAPAKIS
  27. 27. SISSEL TOLAAS CHRISTINA AGAPAKIS SISSEL TOLAAS CHRISTINA AGAPAKIS www.syntheticaesthetics.org
  28. 28. SISSEL TOLAAS CHRISTINA AGAPAKIS SISSEL TOLAAS CHRISTINA AGAPAKIS www.syntheticaesthetics.org
  29. 29. SISSEL TOLAAS CHRISTINA AGAPAKIS SISSEL TOLAAS CHRISTINA AGAPAKIS www.syntheticaesthetics.org
  30. 30. SISSEL TOLAAS CHRISTINA AGAPAKIS SISSEL TOLAAS CHRISTINA AGAPAKIS www.syntheticaesthetics.org
  31. 31. SISSEL TOLAAS CHRISTINA AGAPAKIS www.syntheticaesthetics.org
  32. 32. SISSEL TOLAAS CHRISTINA AGAPAKIS www.syntheticaesthetics.org
  33. 33. SISSEL TOLAAS CHRISTINA AGAPAKIS www.syntheticaesthetics.org
  34. 34. You are what you eat! We eat what we are... SISSEL TOLAAS CHRISTINA AGAPAKIS SISSEL TOLAAS CHRISTINA AGAPAKIS www.syntheticaesthetics.org
  35. 35. Cambridge iGEM 2009 46
  36. 36. Photo by Roger Lancaster (http://www.flickr.com/photos/rogeral/5813079061/); educational fair use
  37. 37. 48
  38. 38. 49
  39. 39. 50
  40. 40. 51
  41. 41. 52
  42. 42. 53
  43. 43. 54
  44. 44. 55
  45. 45. 56
  46. 46. 57
  47. 47. 58
  48. 48. 59
  49. 49. The living bridges of Cherrapunji, India are made from the roots of the Ficus elastica tree. (http://rootbridges.blogspot.com/) Reproducing, growing, & healing materials ~90 terawatts; pre-distributed Massively functional Living ramifications Biology is nature’s nanotechnology Take infectious & other diseases off the table Provide for all of humanity Stabilize & recover natural biodiversity Enable a culture of citizenship Understand life via building

×