Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Неінвазивна пренатальна ДНК-діагностика: можливості та обмеження

913 views

Published on

Неінвазивна пренатальна ДНК-діагностика: можливості та обмеження
Микитенко Д. О., Зукін В. Д.
Клініка репродуктивної медицини «НАДІЯ»

Published in: Health & Medicine
  • Be the first to comment

  • Be the first to like this

Неінвазивна пренатальна ДНК-діагностика: можливості та обмеження

  1. 1. Львів 2013 Неінвазивна пренатальна ДНК-діагностика: можливості та обмеження Микитенко Д. О., Зукін В. Д. Клініка репродуктивної медицини «НАДІЯ»
  2. 2. 2
  3. 3. Історія питання 3 1998 – RhD ni (обгрунтування) Lo YMD, New Eng J Med, 339 Faas B. H. Lancet, 352 2000 – Моногенна діагностика Saito H Lancet, 350 2001 / 2002 – Діагностика статі плода Rijnders RJ, Obstet Gynecol, 2001, 98 Costa JM, New Engl J Med, 2002, 346 2003 – 2007 – Маркери виділення плодової ДНК 2003 – епігенетичні – Lui Y. Y..Clin Chem, 49 2006 – ins/del – Page-Christiaens G.C. Ann NY Acad Sci, 1075 2007 – SNP – Chow KCK, Clin Chem, 53 2008 – діагностика материнських мутацій Lun FMF, Proc Natl, Acad Sci USA, 105 2008 – NIPD – NGS Fan H. C. Proc Natl Acad Sci USA, 105 Chiu PWK Proc Natl Acad Sci USA, 105 2006 –ануеплоідії епігенетичні маркери Tong Y.K. Clin Chem. 52 2007 – анеуплоідії по РНК Lo YMD, NatMed, 13 2009 – ануеплоідії – цифрова ПЛР Chiu RWK. Trends Genet, 25 2010 – Епігенетично-генетичний підхід до д-ки анеуплоідій Tong Y. K. Clin Chem, 56 2010 2013 1995 – відкриття cffDNA Kazakov V.I. et al. Tsitologiia, 37(3) 1977 /79– Циркуляція клітин плода в крові вагітної 1977 - Ciaranfi A Schweiz Med Wochenschr 107 1979- Herzenberg L.A. Proc Natl Acad Sci USA 76(3) 1997 – відкриття cffDNA Lo YMD, Lancet, 350 1948 – cell-free DNA Mandel P, Mйtals P: L es acides nuclйiques du sanguine chez l’homme. CR Acad Sci Paris, 142. 19701940 1990
  4. 4. 4 1997: detection of cffDNA fragments in maternal plasma Наукова основа неінвазивної ДНК-діагностики Cell Free Fetal DNA (cffDNA) • Detection: starting week 4 • Fetal fraction: 2 – 40 % • Stability: < 2 hours • Characteristics: short fragments, 80 % < 200 bp released from trophoblast cells (placenta) by apoptosis / necrosis * Lo et al., Lancet 1997; 350:485-7
  5. 5. 5 Динаміка концентрації cffDNA при вагітності
  6. 6. 6 Cell-free fetal nucleic acids for non-invasive prenatal diagnosis (Report of the UK expert working group) 2009
  7. 7. 7 Неінвазивна ДНК-діагностика резус-фактору плода Принцип: пошук послідовностей ДНК, характерних для гена RhD. з 9 ембр. т. (Клініка «Надія») Недоліки: - Підтвердження виділення плодової ДНК - Псевдонегативний результат внаслідок низької концентрації cffDNA (потребує повторного аналізу через 2 тижні) - Тільки для одноплідних вагітностей - Можливість розходження генотипу та фенотипу (~1% для Європеоїдної раси).
  8. 8. 8 Many RHD-positive Hybrid Alleles Avent and Reid Blood (2000) 95:375 >50
  9. 9. 9 Gene Conversion in RH Genes Wagner et al BMC Genet 2001 2(1):10
  10. 10. 10Wagner et al BMC Genet 2001 2(1):10 Additional RHD-Negative Alleles RHD RHCE
  11. 11. 11 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 RHCE RHD RhD-Negative Haplotyes in Africans Stop codon37 bp insert Singleton et al , Blood (2000) 95:12-18 D-positive D-negative RhD D-negative (C)ces D-negative Deletion 66% 15% 18% RHD observed in 24% RhD negative African Americans
  12. 12. 12 Неінвазивна ДНК-діагностика статі плода Принцип: пошук послідовностей ДНК, характерних для гена Y-хромосоми. з 7 ембр. т. (Клініка «Надія») Недоліки: - Підтвердження виділення плодової ДНК - Псевдонегативний результат внаслідок низької концентрації cffDNA (потребує повторного аналізу через 2 тижні) - Тільки для одноплідних вагітностей - Визначення тільки генетичної статі - Не виключає можливість наявності генної / хромосомної патології - Синдром де ля Шапеля (ХХ-синдром чоловіків) - Синдром Нуан (Каріотип 46,XY, фенотип 46,ХО через мутацію PTPN11) - Синдром Сваєра (каріотип XY, Фенотип жіночий через мутацію DHH (12), NR0B1 (Х), NR5A1 (9), SRY (Y), 9p24.3del ) - Синдром тестикулярної фемінізації - Адреногенітальний синдром
  13. 13. 13 Неінвазивна ДНК-діагностика моногенної патології На даний час – виявлення тільки батьківськх мутантних алелей, відмінних від материнских Носій: Мутантний алель виявлений у плазмі Норма: Мутантний алель не виявлений
  14. 14. 14 «Цифрова ПЛР»: аналіз розведенної ДНК у мікрореакторах Prenatal Diagnosis 2013, 33, 555–562 Алель дикого типу Мутантний алель Мати (клітини) Бітько Плазма, 1-а вагітність Плазма, контроль Негативних контроль Плазма, 2-а вагітність
  15. 15. Актуальність 15 Cell-free fetal nucleic acids for non-invasive prenatal diagnosis (Report of the UK expert working group) 2009 Неінвазивна ДНК-діагностика анеуплоїдій
  16. 16. 16
  17. 17. Неінвазивна ДНК-діагностика анеуплоїдій 17
  18. 18. Сепарація клітин плода з крові вагітної 18
  19. 19. Компанія Тест Технологія Франшиза MaterniT21® S-MPS PrenaTest ® S-MPS verifi® S-MPS NIFTY test T-MPS PrenaScan (Чехія) Harmony® T-MPS Panorama® SNP Неінвазивна діагностика шляхом NGS
  20. 20. 1. S-MPS (shotgun massively parallel sequencing): • Секвенування всієї ДНК плазми з низьким покриттям (<1x); • Аналіз співвідношення кількості «рідів» за кожною хромосомою (13, 18, 21, X, Y) у змішаній фракції ДНК. • Відносно проста біоінформатика; • Вимагає визначення вмісту cffDNA! • Висока собівартість одного тесту за рахунок зниження продуктивності секвенатору (оптимум 150 зразків / тиждень). 2. T-MPS (targeted shotgun massively parallel sequencing): • Секвенування локусів ДНК тільки певних хромосом. • Аналіз співвідношення кількості «рідів» за кожною хромосомою (13, 18, 21, X, Y) у змішаній фракції ДНК. • Відносно проста біоінформатика; • Низкая себестоимость одного теста при большом потоке. • Вимагає визначення вмісту cffDNA! • Вимагає великого потоку пацієнтів (300 зразків / тиждень, не менш, ніж 90 зразків / запуск). 3. Методики на основі SNP: • Секвенуються вибіркові ділянки геному з нейтральними SNP; • Аналіз співвідношення генотипів за кожним SNP у змішаній фракції ДНК. • Розраховується ступінь ризику за кожною хромосомою; • Необхідна система збагачення SNP-вмісних ділянок та їх зчитування з високим перекриттям; • Складні статистичні алгоритми. • Бажане отримання зразку батьківської ДНК Технології
  21. 21. Технології S-MPS & T-MPS ДНК плаценти: ~87% материнская ~13% плодная Вільна ДНК плами крові вагітної Еритроцити Фрагмент ДНК плода Тотальне секвенування ДНК Підрахунок кількості зчитувань за хромосомами Детекція анеуплоідії
  22. 22. ATTGTTCCCACAGACCG CGGCGAAGCATTGTTCC ACCGTGTTTTCCGACCG TTTCCGACCGAAATGGCTTGTTCCCACAGACCGTGAGCTCGATGCCGGCGAAG ATGCCGGCGAAGCATTGT TAATGCGACCTCGATGCC ACAGACCGTGTTTCCCGA AAGCATTGTTCCCACAG TGTTTTCCGACCGAAAT CCGACCGAAATGGCTCCTGCCGGCGAAGCCTTGT 17 bp 66 bp Довжина зчитувань (ріда): гарантована середня (454, Ion Torrent) чи стандартна (Illumina) довжина 1 зчитування. Довші зчитування – легше зборка Основний принцип NGS (shotgun sequencing)
  23. 23. Method – Bioinformatic Analysis of the Sequencing Data Alignment of the fragments to the respective chromosome by comparison with a human reference genome in the public data base Counting of the sequences per chromosome, calculation of percentage (e.g. % chromosome 21) Sequencing and Alignment Quantification
  24. 24. Example for a Bioinformatic Analysis Data per sample (single read sequencing) • About 14.8 million 36bp reads (cover about 8 % of the human genome) • Thereof, 6.8 million reads fit to only one single position in the human reference genome (unique reads) • Thereof, 5.7 million reads fit exactly without mismatch to the human reference genome (unique without mismatch) • Thereof, about 70,000 belong to chromosome 21 • %chr21 (euploid): 1.25 vs. %chr21 (T21): 1.32 (= 73,000; only 1.05 fold higher) 14.8 m 6.8 m 5.7 m 70,000 73,000
  25. 25. Method – Calculation of the z-score z-score calculation: z-score ≥ 3 T21 positive < 3 T21 negative The z-score represents the distance between the value measured for a given sample and the median of the reference set in terms of the median absolute deviation (MAD) z-score of 1 = exactly 1 deviation z-score of 3 = 3 deviations Example for a frequency distribution of z-scores
  26. 26. Representation of z-scores as dot plot Representation of z-scores for a euploid reference set and a case of trisomy 21 as dot plot
  27. 27. 28 Неінвазивна ДНК-даігностика за SNP (Natera) Dhallan et al., 2007
  28. 28. Ринок неінвазивної ДНК-дагностики анеуплоідій Данные на 27 февраля 2013 Метод: SNP S-MPS S-MPS T-MPS
  29. 29. 30
  30. 30. • Технологічні платформи усіх компаній характеризуються однаковою ефективністю, мають подібні показники специфічності та чутливості. • Усі компанії мають певні труднощі з детекцією анеуплоідій за 13 та статевими хромосомами. Платформи NIPD
  31. 31. 32
  32. 32. 33
  33. 33. Залежність ефективності діагностики від концентрації плодової ДНК Метод: S-MPS
  34. 34. Zimmerman et al., 2012 Метод: SNP Залежність ефективності діагностики від концентрації плодової ДНК
  35. 35. Which group of pregnant women is the PrenaTest® suitable for? Taking the legal and methodological facts into account for the PrenaTest® to be carried out, the pregnant woman must • be in the 9th week of pregnancy or later • have an increased risk for chromosomal aberrations, especially for trisomy 13, 18 or 21 in the unborn child Risk factors (also inclusion criteria for the clinical study) are determined as follows: 35 years of age or older Fetal ultrasonographic findings indicating an increased risk of aneuploidy Increased risk for aneuploidy based on first trimester, sequential, or integrated screen, or quadruple screen History of a prior pregnancy with a trisomy Genetic predisposition for translocation trisomy Other medical reasons (to be decided by responsible doctor and patient)
  36. 36. • Неможливість застосування у випадку багатоплідних вагітностей • Неможливість детекції збалансованих структурних хромосомних перебудов • Можливість фетоплацентарного розходження каріотипу (джерело cffDNA – клітини трофобласту) • Неможливість детекції / кількісної характеритики мозаїцизму Обмеження PrenaTest® Додаткові умови ISPD, DGGG, GfH/GenDG , ACOG : • Неінвазивна діагностика – метод високої точності, але не є діагностичним. • Необхідність консультації пацієнтки до та після проведення тесту фахівцем, компетентним у питаннях неінвазивної діагностики. • До пацієнтки мають буди доведені усі шляхи дослідження аномалій та каріотипу плода, ризики, можливості та обмеження інвазивної та неінвазивної процедур • У випадку «позитивного результату» - медико-генетичне консультування та дослідження каріотипу плода (інвазивний метод) • У випадку «негативного результату» - УЗД-моніторинг з метою виключення вад розвитку
  37. 37. 1:10 29:1 1:1100 NIPT positive NIPT negative 1:100 3:1 1:11.000 NIPT negativeNIPT positive 1:270 1:1 1:13.000 NIPT positive positive: Confirmation of the result by invasive diagnosis negative: Substantial reduction of the risk, most likely no invasive diagnosis required Risk after FTS: Adjusted risk after NIPT: NIPT negative Model for the implementation of NIPT into the prenatal risk assessment of trisomy 21 Having an increased risk for fetal trisomy 21 after conventional first trimester screening (FTS), NIPT can help to decide for or against invasive diagnostic methods: modified from Benn et al., Ultrasound Obstet Gynecol 2012; 39: 127-130
  38. 38. 6000 pregnancies at 1:19 risk for fetal trisomy 21 300 trisomy 21 5700 euploid 295 NIPT + 2 no result 3 NIPT - 17 NIPT + 5637 NIPT -46 no result amniocentesis 297 + 63  1-2 miscarriages (1:200) low risk, probably abandon AC 3 + 5637 NIPT as Secondary Screening Test After Positive FTS Has the Potential to Decrease Procedure Related Fetal Losses: a Model Courtesy of Glenn E. Palomaki, Women & Infants Hospital, Alpert Medical School of Brown University, Providence, RI, USA direct AC in 6000 pregnancies  30 miscarriages (1:200)
  39. 39. „…yet be considered diagnostic. However, offering MPSS testing to women already at high risk for Down syndrome can reduce procedure-related losses by up 96%, while maintaining high detection. Confirmation by invasive testing is still needed…“ „… trisomy 21 among high risk pregnancies. If referrals for amniocentesis chorionic villus sampling were based on the sequencing results, about 98% of the invasive diagnostic procedures could be avoided…“ NIPT as Secondary Screening Test After Positive FTS As advanced or secondary screening test for pregnancies at increased risk after FTS, NIPT has the potential to substantially reduce the number of invasive prenatal procedures avoid procedure related fetal losses Chiu et al. 2011 BMJ Palomaki et al. 2011 Genetics in Medicine
  40. 40. Facts about the PrenaTest® • The only NIPT for fetal trisomies 21, 18 and 13 available in Europe, which is in accordance with the IVD Directive of the EU NGS based aneuploidy tests for trisomy are covered by the In-Vitro Diagnostics Directive 98/79/EG* of the European Union and the respective national laws.  The Software is CE-marked and monitored by a Notified Body  The Legal Manufacturer must ensure the application of a full quality assurance system (EN ISO 13485) Right now, PrenaTest® is the only test in accordance with these regulatory requirements. Therefore, PrenaTest® is the only lawfully marketable NIPT in Europe. 2 Nicolaides, Prenat Diagn 2011; 31:7-15
  41. 41. Клінічні випробування LifeCodexx
  42. 42. Результати LifeCodexx
  43. 43. Висновки • Неінвазивна пренатальна ДНК-діагностика є високочутливим методом, що в майбутньому стане альтернативою інвазивним, однак характеризується певними обмеженнями, що мають враховуватись при інтерпретації результатів. • Перспективи: – Розширення кількості хромосом, що аналізуються, та детекція материнських мутантних алелей у плода. – Здешевлення діагностики у випадку запровадження обов’язкового медичного страхування та покриття ним зазначених процедур 44
  44. 44. Дякуємо за увагу 45 (044) 537 7 597 info@ivf.com.ua www.ivf.com.ua Клініка репродуктивної медицини «НАДІЯ»

×