Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Dmitry Schigel
Virve Viertiö
University of Helsinki
On the wings of bark beetles:
Ips typographus and fungal arrival
to sp...
Outline
• Project: colonization gates
• GBIF.org and databases
• Student projects & Ips story
• Teaching dead wood in 2016
Dmitry Schigel: 2012-2015
Academy of Finland
Colonization gates and establishment
of wood-decaying fungi in European Spruc...
GBIF.org
Note new e-mail address: dschigel@gbif.org
GBIF BY THE NUMBERS
652,948,064
species occurrence
records
15,882
datasets
804
data-publishing
institutions
• http://www.g...
 O1 spatial and temporal aspects TIME
early colonization events SPACE
 O2 role of Coleoptera as vectors BEETLE
of wood-d...
Colonization gates: BEETLES & STUDENTS
Maria Faticov, MSc
University of Helsinki
fungivory and host use
Virve Viertiö,
Uni...
9
Colonization
of a new
resource
Fungal arrival to trees
• spores and mycelia
• Going thourgh defence
mechanisms of a tree...
Pheromone traps
• emptied once a
week all
summer
• beetles to zip-
lock bags and to
the freezer
• traps washed
with soap w...
Air control
• to separate fungi
from the air only vs.
the trap catch
= air + beetles
• Eppendorfs with
fungal spores vs.
g...
>sample1
TTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATACAATTCGGTCGGCGGGAAGGAGGGGGAG
CTGTCGCTGGCCTTGTGGCATGTGCACGCTCTCTTTGGAACGTCG...
• Two sites
• 8 traps checked
• May to October
• Air samples as controls
• Fungal DNA present
• sorting and counting compl...
14
• Using DNA, tens of fungal species / OTUs were detected in
every beetle and air sample
• Molecular identification and ...
University of Helsinki
Finland
Moscow State University
Russia
Swedish University
of Agricultural Sciences
2016: Nordic – R...
Education and outreach
• Polypores of the Białowieża forest Oct 2013
• Biodiversity in dead wood, Helsinki Nov 2013
• Next...
FUNGAL ECOLOGY MATHEMATICAL BIOLOGY GROUP
http://blogs.helsinki.fi/deadwoodmeeting
registration until 20 May, may close earlier
SX invertebrate teacher,
Conditions:
teaching for a cup of rice
(& travel, & accomodation)
Photo: Dmitry Schigel,
Virve Viertiö
Thank you!
Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. I...
Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. I...
Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. I...
Upcoming SlideShare
Loading in …5
×

Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. IX symposium on the conservation of saproxylic beetles, Genk, Belgium; oral presentation.

96 views

Published on

Project: colonization gates
GBIF.org and databases
Student projects & Ips story
Teaching dead wood in 2016

Published in: Science
  • Be the first to comment

  • Be the first to like this

Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. IX symposium on the conservation of saproxylic beetles, Genk, Belgium; oral presentation.

  1. 1. Dmitry Schigel Virve Viertiö University of Helsinki On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland
  2. 2. Outline • Project: colonization gates • GBIF.org and databases • Student projects & Ips story • Teaching dead wood in 2016
  3. 3. Dmitry Schigel: 2012-2015 Academy of Finland Colonization gates and establishment of wood-decaying fungi in European Spruce In Southern Finland Metsäkulma, Mäntsälä Rörstrand, Sipoo X = 2014 Basel -> GBIF
  4. 4. GBIF.org Note new e-mail address: dschigel@gbif.org
  5. 5. GBIF BY THE NUMBERS 652,948,064 species occurrence records 15,882 datasets 804 data-publishing institutions • http://www.gbif.org | 01 APR 2016
  6. 6.  O1 spatial and temporal aspects TIME early colonization events SPACE  O2 role of Coleoptera as vectors BEETLE of wood-decaying fungi colonizing living trees GBIF <- DATA Colonization gates
  7. 7. Colonization gates: BEETLES & STUDENTS Maria Faticov, MSc University of Helsinki fungivory and host use Virve Viertiö, University of Helsinki MSc project on fungal dispersal by insects
  8. 8. 9 Colonization of a new resource Fungal arrival to trees • spores and mycelia • Going thourgh defence mechanisms of a tree Animal vectors
  9. 9. Pheromone traps • emptied once a week all summer • beetles to zip- lock bags and to the freezer • traps washed with soap water • catch 2013: total 73 000 beetles 10 Pics: D. Schigel
  10. 10. Air control • to separate fungi from the air only vs. the trap catch = air + beetles • Eppendorfs with fungal spores vs. greywater from the beetle washing 11 Pics: Virve Viertiö
  11. 11. >sample1 TTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATACAATTCGGTCGGCGGGAAGGAGGGGGAG CTGTCGCTGGCCTTGTGGCATGTGCACGCTCTCTTTGGAACGTCGGTCGTCTTTCATATTTTCACCAGTG CACCCAATGTAGGATGCCTCTCCTCCGGGAGGGGGGACCTATGTCTTTTTCAGACGCCCCCACAGTTTA >sample2 GAAAGTCTCAGAATGTTTACTATCGTCGAACCATGACTTCCAGGAGACGTGGGTCGGCGAGATAAAAG TTATCACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATATG TAATGTGAATTGCAGATCTACAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCCTCGGTGTTCCG >sample3 PCR: Fungal ITS1 and ITS2 regions primers ITS1F – ITS4
  12. 12. • Two sites • 8 traps checked • May to October • Air samples as controls • Fungal DNA present • sorting and counting completed • DNA extracted -> PCR, Sequncing Virve Viertiö MSc student MSc project
  13. 13. 14 • Using DNA, tens of fungal species / OTUs were detected in every beetle and air sample • Molecular identification and statistical analysis ongoing • Which species of wood decomposing fungi will form a community here in 10, 20, 50 years?
  14. 14. University of Helsinki Finland Moscow State University Russia Swedish University of Agricultural Sciences 2016: Nordic – Russian Boreal Biodiversity and Data Education Network
  15. 15. Education and outreach • Polypores of the Białowieża forest Oct 2013 • Biodiversity in dead wood, Helsinki Nov 2013 • Next-gen seq sample prep course, Uppsala Jun 2014 • Biodiversity informatics and data management Jul 2014 • Polypore course, Russia Aug 2014 • Polypore course, Finland: ForBio Sep 2014 • Dead wood meeting, Lammi: SIU May 2015 * * * • Dead wood meeting & course Lammi, FIN Aug 2016 • Polypores as indicator species Lammi, FIN Sep 2016 • Biodiversity data skills Tartu, EST Nov 2016
  16. 16. FUNGAL ECOLOGY MATHEMATICAL BIOLOGY GROUP
  17. 17. http://blogs.helsinki.fi/deadwoodmeeting registration until 20 May, may close earlier
  18. 18. SX invertebrate teacher, Conditions: teaching for a cup of rice (& travel, & accomodation)
  19. 19. Photo: Dmitry Schigel, Virve Viertiö Thank you!

×