Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Interceptação do Wheat mosaic
virus (WMoV) no Brasil em
sementes de milho provenientes
dos Estados Unidos
Márcio Martinell...
Caracterização do Problema
Vírus em Poaceae
● Hospedeiros de importância econômica
● Vetores
● Sintomas similares
● Vírus ...
Caracterização do Problema
Complexo Aceria tosichella – vírus transmitidos
“Patossistema em expansão na América do Sul”
Wheat mosaic virus
Skare et al., 2006
Desenvolvimento métodos diagnose
Projeto cooperação bilateral Embrapa-INTA
Vírus transmitidos por semente (quarentena)
PCR em tempo real- SYBR green
● Primers desenhados para WMoV
5’ CTGACC...
Análises quarentenárias
Interceptação de WMoV
Teste Elisa – absorbância limite
qPCR – Ct 30 e 35
Melting analysis – single peak
Sequenciamento: 99...
Importância Econômica
● Milho: 50-60% das plantas infectadas não produzem espigas ou
espigas possuem sementes imaturas;
● Até o momento, não há relatos da presença de
WMoV no Brasil;
● O WMoV possui sintomas difíceis de se
identificar, necess...
Redes de Monitoramento ?
Truol et al., 2009
Melhoramento preventivo?
Projetos de cooperação internacional
Lista de pragas quarentenárias ausentes
Stephanie Botelho
Macária Duarte
Andreza Barbosa
Douglas Lau – Embrapa Trigo
Denise Návia – Embrapa Cenarge...
Interceptação do wheat mosaic virus (w mo v) no brasil em sementes de milho provenientes dos estados unidos
Upcoming SlideShare
Loading in …5

Interceptação do wheat mosaic virus (w mo v) no brasil em sementes de milho provenientes dos estados unidos


Published on

Seminário "Ciência e Tecnologia para a Defesa Agropecuária"

O evento aconteceu nos dias 7 e 8 de dezembro de 2016 e abordou a situação atual, desafios e avanços científicos relacionados às principais pragas e doenças que ameaçam a estabilidade da produção à luz dos novos rumos da defesa agropecuária brasileira.
O programa teve foco nas revisões e artigos científicos publicados no número temático “Pesquisa, Desenvolvimento e Inovações Frente a Ameaças Sanitárias para a Agropecuária” da revista Pesquisa Agropecuária Brasileira (PAB) de maio de 2016.

Published in: Science
  • Login to see the comments

  • Be the first to like this

Interceptação do wheat mosaic virus (w mo v) no brasil em sementes de milho provenientes dos estados unidos

  1. 1. Interceptação do Wheat mosaic virus (WMoV) no Brasil em sementes de milho provenientes dos Estados Unidos Márcio Martinello Sanches Embrapa Recursos Genéticos e Biotecnologia
  2. 2. Caracterização do Problema Vírus em Poaceae ● Hospedeiros de importância econômica ● Vetores ● Sintomas similares ● Vírus transmitidos por Aceria tosichella: Wheat streak mosaic virus (WSMV) Wheat mosaic virus (Wmov) = High plains virus Triticum mosaic virus (TriMV)
  3. 3. Caracterização do Problema Complexo Aceria tosichella – vírus transmitidos “Patossistema em expansão na América do Sul” Argentina: A. tosichella (2005) WSMV (2002), WMoV (2008), TriMV (2012) Brasil: A. tosichella (2006) WSMV (2010) Uruguai: A. tosichella (2007) Fotos: Douglas Lau
  4. 4. Wheat mosaic virus Skare et al., 2006
  5. 5. Desenvolvimento métodos diagnose Projeto cooperação bilateral Embrapa-INTA Vírus transmitidos por semente (quarentena) Testes de validação - WmoV PCR convencional (Lebas et al., 2005) – baixa sensibilidade Real-time PCR – (presente trabalho) WSMV- Detecção a partir de semente de trigo (PCR convencional) (Botelho et al., 2016)
  6. 6. PCR em tempo real- SYBR green ● Primers desenhados para WMoV HPVFW414 5’ GAGTGCTGGTTTTTCTAAGGAGCACA 3’ HPVREV565 5’ CTGACCATAGGTGCCACAAGGTCTGA 3’ Amplificação até diluição 10-8 ng/μl
  7. 7. Análises quarentenárias
  8. 8. Interceptação de WMoV Teste Elisa – absorbância limite qPCR – Ct 30 e 35 Melting analysis – single peak Sequenciamento: 99% - 100% de identidade com isolados do GenBank
  9. 9. Importância Econômica ● Milho: 50-60% das plantas infectadas não produzem espigas ou espigas possuem sementes imaturas; Redução produção até 75% em híbridos suscetíveis (E.U.A.); ● Infecta trigo, aveia, cevada e centeio; ● Sintomas podem ser mais severos que de WSMV, especialmente em infecções mistas; ● Doença emergente – 1°relato “High Plains” E.U.A. (1993) (relatos: Austrália, Argentina, Chile, China, Israel); ● Aumento na taxa de transmissão por semente em milho (4% nos E.U.A.)
  10. 10. ● Até o momento, não há relatos da presença de WMoV no Brasil; ● O WMoV possui sintomas difíceis de se identificar, necessitando de analises sorológicas e moleculares para confirmação; ● Tem potencial de causar grandes danos à economia agrícola nacional. Perspectivas
  11. 11. Redes de Monitoramento ? Truol et al., 2009
  12. 12. Melhoramento preventivo? Projetos de cooperação internacional Lista de pragas quarentenárias ausentes Inclusão? Monitoramento prévio?
  13. 13. Agradecimentos Stephanie Botelho Macária Duarte Andreza Barbosa Douglas Lau – Embrapa Trigo Denise Návia – Embrapa Cenargen Graciela Truol – INTA/Argentina Fernanda Rausch Fernandes – Embrapa Quarentena Apoio Financeiro – Embrapa/INTA
  14. 14. Obrigado
