1/2 A      1/2 a                                                 1/2 A             AA         Aa                          ...
Objetivos tema                Principios mendelianos y extensiones Deberán quedar bien claros los siguientes puntos •El mé...
Los experimentos de Mendel                    demuestran que:                 •La herencia se transmite por elementos     ...
Monje austriaco                                                                Gregor Mendel                              ...
Características del                         experimento de Mendel :                         •Elección de caracteres cualit...
Flor de la planta                             del guisante, Pisum sativum                                estudiada por Men...
Los siete caracteres estudiadosDr. Antonio Barbadilla                           por Mendel                                ...
Polinización cruzada                                 AutofecundaciónDr. Antonio Barbadilla                         Método ...
Resultados de todos los cruzamientos                      monohíbridos de MendelFenotipo parental                 F1      ...
Interpretación genética del cruce monohíbrido de MendelDr. Antonio Barbadilla                                             ...
Primera ley de Mendel:                             Segregación equitativa                 Los dos miembros de un par de   ...
Cruce dihíbrido      Gen ColorY (amarillo) > y (verde)   Gen textura semilla   R (liso) > r (rugoso)Dr. Antonio Barbadilla...
Segunda ley deMendel: Cruce  dihíbrido El cuadrado de Punnett ilustralos genotipos que  dan lugar a las   proporciones    ...
Segunda ley de Mendel:                Transmisión independiente                     Durante la formación de los gametos   ...
Segunda ley de Mendel:                               1/4 AB 1/4 Ab 1/4 aB 1/4 ab                                          ...
Segunda ley de Mendel: Cruce trihíbrido                            P       AABBCC x aabbcc                            F1  ...
Segunda ley de Mendel: Cruce trihíbrido                            P      AABBCC x aabbcc                           F1    ...
Naturaleza probabilística de                 las leyes Mendel:                 Las leyes son probabilísticas              ...
Caracteres mendelianos en                                 humanos:             •Capacidad de sentir el sabor de la        ...
Caracteres mendelianos            AlbinismoDr. Antonio Barbadilla                                                         ...
Alelismo múltiple                 • Grupos AB0                 •A=B>0                 •Fenotipo    Genotipo               ...
Alelismo múltiple              A nivel de secuencia nucleotídica prácticamente cada copia              de un gen es difere...
Se usa la notación AA, Aa y aa para denominar a los genotipos   ¿Cómo explicamos los     mendelianos que determinan un fen...
•Gen letal y esencial             •Un gen que cuando está alterado es letal, es un gen esencial             •Gen y del rat...
•Edad de aparición de un   fenotipo                                                    Aparición tardía de la             ...
Relaciones genotipo-fenotipo                                  P1        Ausencia de        dominancia        en el Dondieg...
Cruce dihíbrido con ausencia de                            dominancia                                                     ...
Los número esperados de cruces                          mendelianos                              Monohíbrido Dihíbrido Tri...
Relación genotipo-fenotipo:                  Variación en la dominanciaDr. Antonio Barbadilla                             ...
Relación genotipo-fenotipo:                                Codominancia                   •Presencia de ambos fenotipos pa...
Relación genotipo-fenotipo:                           Niveles de dominancia             HbAHbA: Normal.     HbSHbS: Anemia...
Relación genotipo-fenotipo:                  Retinoblastoma hereditario                             R > r en el nivel celu...
Pleiotropía                                                   Ejemplo anemia falciforme                         Cambio de ...
Penetrancia y expresividad            Ambos conceptos se refieren a la expresión            fenotípica variable de ciertos...
Expresividad                  La polidactilia se manifiesta en grados distintosDr. Antonio Barbadilla                     ...
Expresividad                         10 grados de expresividad variable en elDr. Antonio Barbadilla                       ...
Caracteres determinados por                                más de un genDr. Antonio Barbadilla                            ...
Caracteres determinados por                                más de un genDr. Antonio Barbadilla                            ...
Interacción entre genes:dos o más genes determinan el fenotipo de unmodo que alteran las proporciones mendelianasesperadas...
Tipos de interacción genética según la   modificación de las proporciones mendelianas         9                  3        ...
Genética bioquímica: estudio de         la relación entre genes y                  enzimas                  Hipótesis un g...
Genética bioquímica: muchos genes                         cooperan en el producto finalDr. Antonio Barbadilla             ...
Explicación bioquímica de la proporción 9:7      en el color de la aleurona del maíz                          Precursor   ...
Genética bioquímica:        Relación                   concentración enzima y producto finalDr. Antonio Barbadilla        ...
Upcoming SlideShare
Loading in …5
×

Genética Mendeliana. Dr. Antonio Barbadilla Prados. Tema 3

2,915 views

Published on

"Principios Mendelianos", del Dr. Antonio Barbadilla Prados de la Universidad Autónoma de Barcelona. Tema 3

Published in: Education
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
2,915
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
43
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Genética Mendeliana. Dr. Antonio Barbadilla Prados. Tema 3

  1. 1. 1/2 A 1/2 a 1/2 A AA Aa Principios 1/2 a Aa aa mendelianos y Razón genotípica extensiones 1/4 AA 1/2 Aa 1/4 aa Razón fenotípica 3/4 A-Dr. Antonio Barbadilla 1/4 aa 1 1 Tema 3: Principios mendelianos y extensiones
  2. 2. Objetivos tema Principios mendelianos y extensiones Deberán quedar bien claros los siguientes puntos •El método experimental y la terminología de Mendel •Ilustrar los dos principios de la transmisión de los genes (la leyes de Mendel) –Cruce monohíbrido y principio de la segregación 1:1 –Cruce dihíbrido y principio de la transmisión independiente •La naturaleza probabilística de los principios mendelianos •Relaciones genotipo-fenotipo –La distinción entre dominancia incompleta, parcial y codominancia –Alelismo múltiple –Gen esencial y letal –Pleiotropía –Penetrancia y expresividad –Interacción entre genes •Genética bioquímica: la hipótesis un gen-una enzimaDr. Antonio Barbadilla 2 2 Tema 3: Principios mendelianos y extensiones
  3. 3. Los experimentos de Mendel demuestran que: •La herencia se transmite por elementos particulados (no herencia de las mezclas), y •sigue normas estadísticas sencillas, resumidas en sus dos principiosDr. Antonio Barbadilla 3 3 Tema 3: Principios mendelianos y extensiones
  4. 4. Monje austriaco Gregor Mendel (1822-1884) Jardín del monasterio agustino de Santo Tomás de Brunn, actual república Checa, donde Mendel realizó sus experimentos de cruces conDr. Antonio Barbadilla el guisante Mendel Web: http://www.mendelweb.org/ 4 4 Tema 3: Principios mendelianos y extensiones
  5. 5. Características del experimento de Mendel : •Elección de caracteres cualitativos (alto-bajo, verde-amarillo, rugoso-liso, ...) •Cruces genéticos de líneas puras (línea verde x línea amarilla) •Análisis cuantitativos de los fenotipos de la descendencia (proporción de cada fenotipo en la descendencia)Dr. Antonio Barbadilla 5 5 Tema 3: Principios mendelianos y extensiones
  6. 6. Flor de la planta del guisante, Pisum sativum estudiada por MendelDr. Antonio Barbadilla 6 6 Tema 3: Principios mendelianos y extensiones
  7. 7. Los siete caracteres estudiadosDr. Antonio Barbadilla por Mendel 7 7 Tema 3: Principios mendelianos y extensiones
  8. 8. Polinización cruzada AutofecundaciónDr. Antonio Barbadilla Método de cruzamiento empleado por Mendel 8 8 Tema 3: Principios mendelianos y extensiones
  9. 9. Resultados de todos los cruzamientos monohíbridos de MendelFenotipo parental F1 F2 Relación F21. Semilla lisa x rugosa Todas lisas 5474 lisas; 1850 rugosas 2,96:12. Semilla amarilla x Todas amarillas 6022 amarillas; 2001 verdes 3,01:1verde3. Pétalos púrpuras x Todas púrpuras 705 púrpuras; 224 blancos 3,15:1blancos4. Vaina hinchada x Todas hinchadas 882 hinchadas; 299 hendidas 2,95:1hendida5. Vaina verde x amarilla Todas verdes 428 verdes; 152 amarillas 2,82:16. Flores axiales x Todas axiales 651 axiales; 207 terminales 3,14:1terminales7. Tallo largo x corto Todos largos 787 largos; 277 cortos 2,84 1Dr. Antonio Barbadilla 9 9 Tema 3: Principios mendelianos y extensiones
  10. 10. Interpretación genética del cruce monohíbrido de MendelDr. Antonio Barbadilla 10 10 Tema 3: Principios mendelianos y extensiones
  11. 11. Primera ley de Mendel: Segregación equitativa Los dos miembros de un par de alelos segregan en proporciones 1:1. La mitad de los gametos lleva un alelo y la otra mitad el otro alelo Razón genotípica 1/2 A 1/2 a 1/4 AA 1/2 Aa 1/2 A AA Aa 1/4 aa 1/2 a Aa aa Razón fenotípica 3/4 A- 1/4 aaDr. Antonio Barbadilla 11 11 Tema 3: Principios mendelianos y extensiones
  12. 12. Cruce dihíbrido Gen ColorY (amarillo) > y (verde) Gen textura semilla R (liso) > r (rugoso)Dr. Antonio Barbadilla 12 12 Tema 3: Principios mendelianos y extensiones
  13. 13. Segunda ley deMendel: Cruce dihíbrido El cuadrado de Punnett ilustralos genotipos que dan lugar a las proporciones 9:3:3:1Dr. Antonio Barbadilla 13 13 Tema 3: Principios mendelianos y extensiones
  14. 14. Segunda ley de Mendel: Transmisión independiente Durante la formación de los gametos la segregación de alelos de un gen es independiente de la segregación de los alelos en el otro genDr. Antonio Barbadilla 14 14 Tema 3: Principios mendelianos y extensiones
  15. 15. Segunda ley de Mendel: 1/4 AB 1/4 Ab 1/4 aB 1/4 ab Razón genotípica AABB Aabb aaBB 1/4 AB AABB AAbB AaBB AaBb 1/16:1/16:1/16: aabb AaBb AABb 1/4 Ab AABb AAbb AabB Aabb 1/16:4/16:2/16: aaBb AaBB Aabb 2/16:2/16:2/16 1/4 aB AaBB AaBb aaBB aaBb 1/4 ab AaBb Aabb aaBb aabbDr. Antonio Barbadilla Razón fenotípica 9/16 A-B- 3/16 A-bb 3/16 aaB- 1/16 aabb 15 15 Tema 3: Principios mendelianos y extensiones
  16. 16. Segunda ley de Mendel: Cruce trihíbrido P AABBCC x aabbcc F1 AaBbCc x AaBbCc ABC ABc AbC Abc aBC aBc abC abcABC AABBCC AABBCc AABbCC AABbCc AaBBCC AaBBCc AaBbCC AaBbCcABc AABBCc AABBcc AABbCc AABbcc AaBBCc AaBBcc AaBbCc AaBbccAbC AABbCC AABbCc AAbbCC AAbbCc AaBbCC AaBbCc AabbCC AabbCcAbc AABbCc AABbcc AAbbCc AAbbcc AaBbCc AaBbcc AabbCc AabbccaBC AaBBCC AaBBCc AaBbCC AaBbCc aaBBCC aaBBCc aaBbCC aaBbCcaBc AaBBCc AaBBcc AaBbCc AaBbcc aaBBCc aaBBcc aaBbCc aaBbccabC AaBbCC AaBbCc AabbCC AabbCc aaBbCC aaBbCc aabbCC aabbCcabc AaBbCc AaBbcc AabbCc Aabbcc aaBbCc aaBbcc aabbCc aabbcc Dr. Antonio Barbadilla 16 16 Tema 3: Principios mendelianos y extensiones
  17. 17. Segunda ley de Mendel: Cruce trihíbrido P AABBCC x aabbcc F1 AaBbCc x AaBbCc ABC ABc AbC Abc aBC aBc abC abcABC AABBCC AABBCc AABbCC AABbCc AaBBCC AaBBCc AaBbCC AaBbCcABc AABBCc AABBcc AABbCc AABbcc AaBBCc AaBBcc AaBbCc AaBbccAbC AABbCC AABbCc AAbbCC AAbbCc AaBbCC AaBbCc AabbCC AabbCcAbc AABbCc AABbcc AAbbCc AAbbcc AaBbCc AaBbcc AabbCc AabbccaBC AaBBCC AaBBCc AaBbCC AaBbCc aaBBCC aaBBCc aaBbCC aaBbCcaBc AaBBCc AaBBcc AaBbCc AaBbcc aaBBCc aaBBcc aaBbCc aaBbccabC AaBbCC AaBbCc AabbCC AabbCc aaBbCC aaBbCc aabbCC aabbCcabc AaBbCc AaBbcc AabbCc Aabbcc aaBbCc aaBbcc aabbCc aabbcc Dr. Antonio Barbadilla Razón fenotípica 27 9 9 9 3 3 3 17 1 17 Tema 3: Principios mendelianos y extensiones
  18. 18. Naturaleza probabilística de las leyes Mendel: Las leyes son probabilísticas (como si los alelos de los genes se cogieran al azar de urnas), no deterministas •Permiten predecir la probabilidad de los distintos genotipos y fenotipos que resultan de un cruce •Permiten inferir el número de genes que influyen sobre un carácterDr. Antonio Barbadilla 18 18 Tema 3: Principios mendelianos y extensiones
  19. 19. Caracteres mendelianos en humanos: •Capacidad de sentir el sabor de la feniltiocarbamida •Albinismo •Tipo sanguíneo •Braquidactilia (dedos de manos y pies cortos) •Hoyuelos de la mejilla •Lóbulos oreja sueltos o adosados •Pecas en la cara •Pulgar hiperlaxo •Polidactilia OMIM - Online Mendelian Inheritance in ManDr. Antonio Barbadilla http://www.ncbi.nlm.nih.gov/sites/entrez?db=OMIM 19 19 Tema 3: Principios mendelianos y extensiones
  20. 20. Caracteres mendelianos AlbinismoDr. Antonio Barbadilla 20 20 Tema 3: Principios mendelianos y extensiones
  21. 21. Alelismo múltiple • Grupos AB0 •A=B>0 •Fenotipo Genotipo A- AA ó A0 B- BB ó B0 AB AB 0 00 •Color pelaje conejo C+ Cch Ch c C+ > Cch > Ch > c Salvaje Chinchilla Himalaya albinoDr. Antonio Barbadilla 21 21 Tema 3: Principios mendelianos y extensiones
  22. 22. Alelismo múltiple A nivel de secuencia nucleotídica prácticamente cada copia de un gen es diferente en algún nucleótido de su secuencia. El alelismo múltiple es ubicuo. BRCA2 Individual 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag Individual 2 acgtagcatcgtatgcgttagacggggtggtagcaccagtacag Individual 3 acgtagcatcgtatgcgttagacggcggggtagcaccagtacag Individual 4 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag Individual 5 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag Individual 6 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Individual 7 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Individual 8 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Individual 9 acgtagcatcgtttgcgttagacggcatggcaccggcagtacagDr. Antonio Barbadilla 22 22 Tema 3: Principios mendelianos y extensiones
  23. 23. Se usa la notación AA, Aa y aa para denominar a los genotipos ¿Cómo explicamos los mendelianos que determinan un fenotipo, pero en realidad éstos songenotipos mendelianos si en internamente heterogéneos en el nivel de DNA. Su asignación como genotipo AA ó aa se debe generalmente a que todas las secuenciasel nivel del DNA cada alelo que pertenecen al genotipo AA comparten un fenotipo distinto de las suele ser distinto? que pertenecen al genotipo aa y esta diferencia fenotípica se debe posiblemente a un nucleótido (o a unos pocos) que sería el verdadero genotipo que causa los diferentes fenotipos Secuencia nucleotídica de una región del gen A en distintos individuosIndiv1Secuencia 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacagIndiv1Secuencia 2 acgtagcatcgtatgcgttagacggggtggtagcaccagtacag Alelo A = a Genotipo AA = aa -> Fenotipo A Alelo a = tIndiv2Secuencia 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacagIndiv2Secuencia 2 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag Genotipo Aa = at -> Fenotipo AIndiv3 Secuencia 1acgtagcatcgtttgcgttagacggcatggcaccggcagtacagIndiv3 Secuencia 2acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Genotipo aa = at -> Fenotipo a Dr. Antonio Barbadilla 24 24 Tema 8: Extensiones del análisis mendeliano
  24. 24. •Gen letal y esencial •Un gen que cuando está alterado es letal, es un gen esencial •Gen y del ratón doméstico es un ejemplo Alelo y es dominante para el color amarillo, letal en homocigosis. Alteración proporciones mendelianas de la F2 es 2:1Dr. Antonio Barbadilla 25 25 Tema 3: Principios mendelianos y extensiones
  25. 25. •Edad de aparición de un fenotipo Aparición tardía de la enfermedad de Huntington •Temprana •Tardía •Impronta parental •Ejemplo Factor crecimiento II tipo insulina (Igf2) en ratón. Mutante homocigoto -> enano. El fenotipo del heterocigoto depende del origen del aleloDr. Antonio Barbadilla Alelo salvaje es paterno -> fenotipo salvaje Alelo salvaje es materno -> fenotipo enano 26 26 Tema 3: Principios mendelianos y extensiones
  26. 26. Relaciones genotipo-fenotipo P1 Ausencia de dominancia en el Dondiego de noche F1 (Mirabilis jalapa) F2 Dr. Antonio Barbadilla 27 27 Tema 3: Principios mendelianos y extensiones
  27. 27. Cruce dihíbrido con ausencia de dominancia Razón genotípica ? 1/4 A1B1 1/4 A1B2 1/4 A2B1 1/4 A2B2 1/4 A1B1 A1A1B1B1 1/4 A1B2 1/4 A2B1 1/4 A1B2 Número fenotipos distintos? Razón fenotípica ?Dr. Antonio Barbadilla 28 28 Tema 3: Principios mendelianos y extensiones
  28. 28. Los número esperados de cruces mendelianos Monohíbrido Dihíbrido Trihíbrido Regla general n=1 n=2 n=3 nTipos de gametos en la F1 2 4 8 2nProporción de homocigotos 1/4 1/16 1/64 (¼)nrecesivos en la F2Número de fenotipos distintos de 2 4 8 2nla F2 suponiendo dominanciacompletaNúmero de genotipos distintos dela F2 (o fenotipos si no hay 3 9 27 3ndominancia) Dr. Antonio Barbadilla 29 29 Tema 3: Principios mendelianos y extensiones
  29. 29. Relación genotipo-fenotipo: Variación en la dominanciaDr. Antonio Barbadilla 30 30 Tema 3: Principios mendelianos y extensiones
  30. 30. Relación genotipo-fenotipo: Codominancia •Presencia de ambos fenotipos paternos en el heterocigoto •Grupo AB •Heterocigoto proteína detectada por electroforesis en hemoglobinaDr. Antonio Barbadilla 31 31 Tema 3: Principios mendelianos y extensiones
  31. 31. Relación genotipo-fenotipo: Niveles de dominancia HbAHbA: Normal. HbSHbS: Anemia grave. HbAHbS: No anemiaDr. Antonio Barbadilla 32 32 Tema 3: Principios mendelianos y extensiones
  32. 32. Relación genotipo-fenotipo: Retinoblastoma hereditario R > r en el nivel celularDr. Antonio Barbadilla pero r > R en el nivel del organismo 33 33 Tema 3: Principios mendelianos y extensiones
  33. 33. Pleiotropía Ejemplo anemia falciforme Cambio de un nucleótido en el DNA del gen de la hemoglobina Rápida destrucción de Problemas Acumulación de células los glóbulos rojos circulatorios falciformes en el bazo Producción de hemoglobina S en lugar de la A Baja concentración de oxígeno en lo tejidos Daño Daños en Daño en Anemia cerebral otros órganos el bazo Agregación de la hemoglobina S para formar estructuras casi cristalinas en aguja en los glóbulos rojos Debilidad Fallo física cardiaco Parálisis Distorsión de los glóbulos rojos, adquieren forma de hoz (falciforme) Función mental Fallo renal disminuida Neumonía ReumatismoDr. Antonio Barbadilla 34 34 Tema 3: Principios mendelianos y extensiones
  34. 34. Penetrancia y expresividad Ambos conceptos se refieren a la expresión fenotípica variable de ciertos genes Penetrancia: Proporción de individuos en una población que presentan el fenotipo correspondiente a su genotipo. Si P < 1 se habla de penetrancia incompleta Expresividad: El grado de expresión individual de un fenotipo para un genotipo dadoDr. Antonio Barbadilla 35 35 Tema 3: Principios mendelianos y extensiones
  35. 35. Expresividad La polidactilia se manifiesta en grados distintosDr. Antonio Barbadilla 36 36 Tema 3: Principios mendelianos y extensiones
  36. 36. Expresividad 10 grados de expresividad variable en elDr. Antonio Barbadilla carácter piel manchada en perros. 37 37 Tema 3: Principios mendelianos y extensiones
  37. 37. Caracteres determinados por más de un genDr. Antonio Barbadilla 38 38 Tema 3: Principios mendelianos y extensiones
  38. 38. Caracteres determinados por más de un genDr. Antonio Barbadilla 39 39 Tema 3: Principios mendelianos y extensiones
  39. 39. Interacción entre genes:dos o más genes determinan el fenotipo de unmodo que alteran las proporciones mendelianasesperadasDr. Antonio Barbadilla 40 40 Tema 3: Principios mendelianos y extensiones
  40. 40. Tipos de interacción genética según la modificación de las proporciones mendelianas 9 3 3 1 13:3 9:7 9:3:4 12:3:1 15:1 A-B- A-bb aaB- aabb •Mutación supresora 13:3 •Duplicación génica recesiva 9:7 •Epistasia recesiva 9:3:4 •Epistasia dominante 12:3:1Dr. Antonio Barbadilla •Duplicación génica dominante 15:1 41 41 Tema 3: Principios mendelianos y extensiones
  41. 41. Genética bioquímica: estudio de la relación entre genes y enzimas Hipótesis un gen - una enzima (Beadle y Tatum 1941) -> Estudio de la ruta biosintética de la niacina (vitamina B3 en el hongo del pan Neurospora crassa)Dr. Antonio Barbadilla 42 42 Tema 3: Principios mendelianos y extensiones
  42. 42. Genética bioquímica: muchos genes cooperan en el producto finalDr. Antonio Barbadilla 43 43 Tema 3: Principios mendelianos y extensiones
  43. 43. Explicación bioquímica de la proporción 9:7 en el color de la aleurona del maíz Precursor Intermediario Producto final blanco blanco púrpura Enzima A Enzima B Gen A Gen B Para obtener el producto final púrpura necesitamos que tanto el gen A como el B produzcan una enzima funcional. Si uno de los dos genes falla (genotipo aa ó bb), el producto final será blanco Dr. Antonio Barbadilla 44 44 Tema 3: Principios mendelianos y extensiones
  44. 44. Genética bioquímica: Relación concentración enzima y producto finalDr. Antonio Barbadilla 45 45 Tema 3: Principios mendelianos y extensiones

×