Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

An Introduction to Crispr Genome Editing

11,194 views

Published on

In this short presentation, I make a case for doing genome editing vs some of the approaches that have gone before, describe some of the tools available, and the focus on CRISPR-Cas9, what it is, where it's come from and how it works.

Published in: Science
  • Be the first to comment

An Introduction to Crispr Genome Editing

  1. 1. HORIZON DISCOVERY An Introduction To CRISPR Genome Editing Chris Thorne, PhD | Commercial Marketing Manager
  2. 2. 2 Disclaimer 2 • This Presentation does not constitute or form any part of an offer to sell, or invitation to purchase or apply for or enter into any contract or make any other commitment whatsoever in relation to, securities. Although reasonable care has been taken to ensure that the facts stated in this Presentation are accurate and that the opinions expressed are fair and reasonable, the contents of this Presentation have not been formally verified by Horizon Discovery plc (the “Company”) or any other person. Accordingly, no representation or warranty, expressed or implied, is made as to the fairness, accuracy, completeness or correctness of the information and opinions contained in this Presentation and no reliance should be placed on such information or opinions. Further, the information in this Presentation is not complete and is subject to updating, revision, further verification and amendment. Neither the Company, nor any of its subsidiaries, nor any of its respective members, directors, officers or employees nor any other person accepts any liability whatsoever for any loss howsoever arising from any use of such information or opinions or otherwise arising in connection with this Presentation. • Accordingly, information contained in the Presentation is being supplied to you solely for your information and may not be copied, reproduced or further distributed to any person or published in whole or in part, for any purpose. In particular, the distribution of this Presentation in certain jurisdictions may be restricted by law, and persons into whose possession this Presentation comes should inform themselves about, and observe, any such restrictions. Any failure to comply with these restrictions may constitute a violation of laws of any such jurisdiction. • This Presentation includes certain forward-looking statements, estimates and projections with respect to the anticipated future performance of Horizon Discovery plc, its products and the markets in which it operates. Forward-looking statements involve risks and uncertainties. Actual events could differ materially from those projected herein and such statements, estimates and projections reflect the various assumptions made by the Company which assumptions may or may not prove to be correct. These forward-looking statements speak only as at the date of this Presentation. The Company expressly disclaims any obligation or undertaking to disseminate any updates or revisions to any forward-looking statements contained in the Presentation to reflect any change in the Company’s expectations with regard thereto or any change in events, conditions or circumstances on which any such statements are based. • No part of this Presentation, or the fact of its distribution, should form the basis of or be relied upon in connection with any contract or commitment or investment decision whatsoever. This Presentation does not constitute a recommendation regarding the securities of the Company. • By participating in and/or accepting delivery of this Presentation you agree to be bound by the foregoing restrictions and the other terms of this disclaimer.
  3. 3. 3 Presenter Chris Thorne, PhD | Commercial Marketing Manager Chris has been working at Horizon for four years, during which he has been responsible for the genetic validation of all cell lines in Horizon’s catalogue, has been part of the launch of Horizon’s diagnostic reference materials and has supported hundreds of academic labs as they implement CRISPR genome editing with Horizon’s tools. Prior to Horizon Chris completed his PhD at the University of Liverpool.
  4. 4. 4 Contents 1. The Case for Genome Editing 2. What is Genome Editing and how is it done? 3. CRISPR-Cas9 – origins and it’s application to genome editing
  5. 5. 5 The Genomic Era…
  6. 6. 6 The Genomic Era… 1. Elucidate the organisation of genetic networks and their contribution to cellular and organismal phenotypes 2. Understand heritable variations and their association with health and disease 3. Translate genome-based knowledge into health benefits Adapted from The US National Human Genome Research Institute, (2003) Nature
  7. 7. 7 Gene function analysis | Patient-derived cell lines Human cell lines contain pre-existing mutations are derived directly from human tumors Immense genetic diversity However Lack of wild type controls Availability of rare mutation models Cell line diversity makes it very hard link observations to specific genetics (Domke et al Nat. Comms 2013)
  8. 8. 8 Gene function analysis | RNAi Problems with RNAi can result in false positives or negatives Loss of function analysis using RNAi is inexpensive and widely applicable Incomplete knockdown However Lack of reproducibility Off-target effects Brass et al. Science 273 genes Total overlap only 3 genes Shalem et al Science 2014 HIV Host Factors
  9. 9. 9 Gene function analysis | Overexpression Overexpression of oncogenes can over represent their role in disease biology Gain of function analysis using overexpression is inexpensive and widely applicable Result may be artefact of overexpression However Difficult to achieve long- term overexpression • Large growth induction phenotype • Transforming alone • Milder growth induction phenotype • Non-transforming alone
  10. 10. 10 The Opportunity: Genome Editing
  11. 11. 11 The Opportunity: Genome Editing Adapted from The US National Human Genome Research Institute, (2003) Nature 1. Elucidate the organisation of genetic networks and their contribution to cellular and organismal phenotypes 2. Understand heritable variations and their association with health and disease 3. Translate genome-based knowledge into health benefits Knockouts Knock-ins Gene Therapy
  12. 12. 12 Genome Editing Tools Non- Nuclease Nuclease
  13. 13. 13 Nuclease mediated genome editing Exon 1 Exon 2 Exon 3 Exon Exon 2 Exon 31 Nuclease-induced DNA double-strand break Non-homologous end joining Exon 1 Homology-directed repair Exon 2 Exon 2Exon 2Exon 1 Frameshift mutation Exon 1
  14. 14. 14 CRISPR-Cas system: Adaptive immunity in bacteria
  15. 15. 15 CRISPR-Cas9 | How does it work? Crispr (cr) RNA + trans-activating (tra) crRNA combined = single guide (sg) RNA
  16. 16. 16 CRISPR mediated genome editing Exon 1 Exon 2 Exon 3 Exon Exon 2 Exon 31 Cas9 nuclease-induced DNA double-strand break Non-homologous end joining Exon 1 Homology-directed repair Exon 2 Exon 2Exon 2Exon 1 Frameshift mutation Exon 1
  17. 17. 17 CRISPR-Cas9: How does it work? AGCTGGGATCAACTATAGCG CGG gRNA target sequence PAM
  18. 18. 18 CRISPR Specificity Cas9 Wild type Cas9 Nickase (Cas9n) Induces double strand break Only “nicks” a single strand Only requires single gRNA Requires two guide RNAs for reasonable activity Concerns about off-target specificity Reduced likelihood of off-target events High efficiency of cleavage Especially good for random indels (= KO) Guide efficiency dictated by efficiency of the weakest gRNA Nishimasu et al Cell
  19. 19. 19 Hsu et al. Cell. 2014
  20. 20. 20 ... HOWEVER … Cell Line Engineered cells! Genome Editing Vector Screen for clones
  21. 21. 21 Next time: The Key Considerations For CRISPR Gene Editing Cell Line Gene Target Modification Choice of guide Strategy Design Screening Validation  Is it suitable?  Is it essential/expressed/amplified?  Knockin vs knockout  Efficiency vs specificity  Donor design to maximise efficiency  How many clones to find a positive?  Is my engineering as expected?
  22. 22. 22 And then… CRISPR modified cell lines What’s possible and how they will impact your research Exon 8 Exon 9 NanoLuc polyA Exon 1 Exon 3 Translocations and Fusions Gene tagging Chromosomal deletions Chr 1 Chr 19 Point mutations Exon 8 Exon 9 *
  23. 23. Your Horizon Contact: t + 44 (0)1223 655580 f + 44 (0)1223 655581 e info@horizondiscovery.com w www.horizondiscovery.com Horizon Discovery, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom Your Horizon Contact: t + 44 (0)1223 655580 f + 44 (0)1223 655581 e info@horizondiscovery.com w www.horizondiscovery.com Horizon Discovery, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom Chris Thorne, PhD Commercial Marketing Manager c.thorne@horizondiscovery.com +44 1223 204 799

×