Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Inheritance of coat colour and type of fleece in alpaca

1,893 views

Published on

INHERITANCE OF COAT COLOUR AND TYPE OF FLEECE IN ALPACAPonencia Magistral presentada en el III Simposium Internacional de Investigaciones Sobre Camélidos Sudamericanos. Arequipa - Perú.

  • Be the first to comment

  • Be the first to like this

Inheritance of coat colour and type of fleece in alpaca

  1. 1. INHERITANCE OF COAT COLOUR AND TYPE OF FLEECE IN ALPACA <ul><li>RENIERI Carlo </li></ul><ul><li>University of Camerino </li></ul><ul><li>School of Environmental Sciences </li></ul><ul><li>Animal Production Unit </li></ul><ul><li>Italy </li></ul>
  2. 2. RESEARCH GROUP Prof. Carlo Renieri, Senior Researcher Dr Marco Antonini, researcher Prof. Alessandro Valbonesi, reseracher Dr. Antonietta La Terza, PhD Tutor Vincenzo La Manna, PhD tutor Dr. Dario Pediconi, Post doc Siva Arumugam Saravanaperumal, PhD candidate Chandramohan Bathrachalam, PhD candidate Gabriela Molina, PhD candidate Annalisa Candelori, Phd candidate
  3. 3. Experimental Segregation Design An experimental trial involving 17 alpaca rams and 230 alpaca dams was performed at the Experimental Station of Quimsachata, Peru. The Station is located on the Andean Plateau at 4300 m under the management of the INIA ILLPA PUNO. The trial is organised in a hierarchical scheme as follows: One hundred forty nine (149) crias were born. At birth, the type of fleece and the coat colour were identified. Blood samples and skin biopsies for molecular genetic analysis were sampled from parents and crias. CROSS RAMS DAMS White x White 2 Suri 30 Huacaya 2 Huacaya 30 Suri White x Coloured 2 Suri 30 Huacaya Café 2 Huacaya 10 Suri Lf + 8 Ap + Gr Black x Black 2 Suri 30 Huacaya 2 Huacaya 17 Suri Black x Brown 1 Suri 15 Huacaya 1 Huacaya 15 Suri Brown x Brown 2 Suri 30 Huacaya 1 Huacaya 15 Suri Total 17 230
  4. 4. <ul><li>RENIERI C:, VALBONESI A., LA MANNA V., ANTONINI M., ASPARRIN M., 2009. Inheritance of Suri and Huacaya type of fleece in alpaca. Italian J. Anim. Sci., 8, 83-91. </li></ul><ul><li>VALBONESI A., PACHECO C., LEBBORONI G., ANTONINI M., RENIERI C., 2009. Phenotipic and genetic variation of fleece weight, fineness of fibre and its coefficient of variability in Peruvian alpaca. EAAP Annual Meeting 2009, abstract </li></ul><ul><li>VALBONESI A., APAZA CASTILLO N., LA MANNA V., GONZALES CASTILLO M.L., HUANCA MAMANI T., RENIERI C., 2009. Inheritance of white, black and brown coat color in alpaca by segregation analysis. Eaap Annual Meeting 2009, abstract 3947 </li></ul><ul><li>CREPALDI P., MILANESI E., NICOLOSO L., LA MANNA V., RENIERI C., 2009. Evualuation of MC1R gene polymorphism in Vicugna pacos. EAAP Annual Meeting 2009, abstract 4093. </li></ul><ul><li>BATHRACHALAM C., LA MANNA V., RENIERI C., LA TERZA A., 2009. Asip and MC1R in coat color variation in Alpaca. Eaap 2009, abstract 4398. </li></ul><ul><li>PRESCIUTTINI S., VALBONESI A., APAZA N., ANTONINI M., HUANCA T., RENIERI C., 2010. Fleece variation in alpaca (Vicugna pacos): a two-locus model for the Suri/Huacaya phenotype. BMC Genetics 2010, 11:70. http://www.biomedcentral.com/1471-2156/11/70 </li></ul><ul><li>ALLAIN D., RENIERI C., 2010. Genetics of fibre production and fleece characteristics in small ruminants, Angora rabbit and South American camelids. Animal, 2010 (4) 9: 1472-1481 </li></ul><ul><li>La Manna V., La Terza A., Grezzi S., Saravanaperumal S.A., Apaza N., Huanca T., Renieri C., Bozzi R., 2010. A microsatellite study on the genetic distance between suri and huacaya sub populations in Peruvian Alpacas (Vicugna pacos). BMC Genetics, submitted. </li></ul><ul><li>Chandramohan B., La Manna V., Renieri C., La Terza A., 2010. Asip and MC1R genes in Alpaca. WCGALP, PP2-154, p. 238 </li></ul>
  5. 6. FULL WHITE Dominante or recessive ? <ul><li>Dominante </li></ul><ul><ul><li>Bustinza (1968) </li></ul></ul><ul><ul><li>Davis (2010) </li></ul></ul><ul><li>Recessive </li></ul><ul><ul><li>Gandarillas (1971) </li></ul></ul>
  6. 7. BUSTINZA (1968) <ul><li>WHITE x WHITE </li></ul><ul><ul><li>619 full and spotted white </li></ul></ul><ul><ul><li>387 solid </li></ul></ul><ul><li>WHITE x SOLID </li></ul><ul><ul><li>746 full and spotted white </li></ul></ul><ul><ul><li>712 solid </li></ul></ul>
  7. 8. DAVID (2010) <ul><li>WHITE x WHITE </li></ul><ul><ul><li>71 full and spotted white </li></ul></ul><ul><ul><li>30 solid </li></ul></ul><ul><li>WHITE x SOLID </li></ul><ul><ul><li>91 full and spotted white </li></ul></ul><ul><ul><li>108 solid </li></ul></ul>
  8. 9. BLACK vs BROWN <ul><li>DOMINANCE OF BLACK </li></ul><ul><ul><li>Davis (2010) </li></ul></ul><ul><li>DOMINANCE OF BROWN </li></ul><ul><ul><li>Velasco (1981) </li></ul></ul><ul><ul><li>Gandarillas (1971) </li></ul></ul>
  9. 10. VELASCO (1981) <ul><li>BLACK x BLACK </li></ul><ul><ul><li>5 black </li></ul></ul><ul><li>BLACK x BROWN </li></ul><ul><ul><li>3 black </li></ul></ul><ul><ul><li>5 brown </li></ul></ul><ul><li>BROWN x BROWN </li></ul><ul><ul><li>4 black </li></ul></ul><ul><ul><li>27 brown </li></ul></ul>
  10. 11. DAVIS (2010) <ul><li>BLACK x BLACK </li></ul><ul><ul><li>44 black </li></ul></ul><ul><ul><li>7 brown </li></ul></ul><ul><li>BLACK x BROWN </li></ul><ul><ul><li>26 black </li></ul></ul><ul><ul><li>17 brown </li></ul></ul><ul><li>BROWN x BROWN </li></ul><ul><ul><li>16 black </li></ul></ul><ul><ul><li>69 brown </li></ul></ul>
  11. 14. Conclusions for white (1) <ul><li>The inheritance of white can be defined by a single gene segregation, without any modifying effect. </li></ul><ul><li>It is independent and completely dominant on pigmented animals, without any difference in segregation on black and brown pattern. </li></ul><ul><li>This hypothesis is fully supported by the segregations observed in crosses involving white rams and pigmented dams , as well as in crosses of white parents, assuming that the frequency of heterozygous females ranges from 35% up to 100%. </li></ul>
  12. 15. Conclusion for white (2) <ul><li>White in mammals arise from improper melanoblast development or survival, reflecting absence of mature melanocytes. </li></ul><ul><li>White can be caused by defects at various stages of melanocytes development, including proliferation, survival, migration, invasion of the integument, hair follicle entry and melanocytes stem cell renewal (Baxter et al., 2004). </li></ul><ul><li>Many white traits have been identified in mouse and man, and 10 of the genes have been cloned (Baxter et al., 2004). </li></ul><ul><li>The hypothesis is that the gene for white in alpaca is among these loci. </li></ul>
  13. 19. Conclusion for black and brown <ul><li>Black is dominant over brown. </li></ul><ul><li>This hypothesis is fully supported by the segregations observed in crosses involving black rams and brown dams , as well as in crosses of black parents, assuming that the frequency of heterozygous females ranges from 54% up to 100%. </li></ul>
  14. 21. API Faint Brown Light Brown Grey Black Brown Alpaca – Huacaya Type International Year of Natural Fibers 2009
  15. 22. Alpaca – Suri Type API Brown Redish brown Grey White Black International Year of Natural Fibers 2009
  16. 23. Mechanisam of action of Asip and MC1R
  17. 24. White (BL) X Brown (CA) S0502 BL 282298 CA 076108 LF EEI-024 NE 297204 CC 072108 BL Black (NE) X Brown (CC) Pedigree chart of samples in progress
  18. 25. <ul><li>Up to now we amplified full coding and 3’ UT region of Asip and MC1R </li></ul><ul><li>the full coding region of Asip comprises of 402 bp and it codes for a protein of 133 aa and 3’ UTR comprises of 243 bp </li></ul><ul><li>the entire coding region for MC1R comprises of 954 bp and it codes for a protein of 317 aa and 3’UTR includes 626 bp </li></ul><ul><li>Structure of Asip mRNA </li></ul>Our findings AAAAAAAAA 3’ Un Translated Region ATG TGA Coding Region 5’ UTR ??? AAAAAAAAA 3’ Un Translated Region ATG TGA Coding Region 5’ UTR ??? 402 bp Bp ??? 243 bp 626 bp 954 bp Bp ??? Structure of MC1R mRNA
  19. 30. MC1R Asip
  20. 36. MC1R sequence alingment of Black X Cafe claro 10 20 30 40 50 60 70 80 90 .........|.........|.........|.........|.........|.........|.........|.........|.........| ATGCCTGTGCTCGGCCCCCAGAGGAGGCTGCTGGGCTCCCTCAACTCCACCCCCCAAGCC ACCACCCACCTCGGACTGGCC A CCAACCAG ATGCCTGTGCTCGGCCCCCAGAGGAGGCTGCTGGGCTCCCTCAACTCCACCCCCCAAGCC ACCACCCACCTCGGACTGGCC A CCAACCAG ATGCCTGTGCTCGGCCCCCAGAGGAGGCTGCTGGGCTCCCTCAACTCCACCCCCCAAGCC ACCACCCACCTCGGACTGGCC G CCAACCAG 100 110 120 130 140 150 160 170 180 .........|.........|.........|.........|.........|.........|.........|.........|.........| A C GGGGCCCCAGTGCCTGGAGGTGTCTGTTCCCGA T GGGCTGTTCCTCAGCCTGGGGCTGGTGAGCCTCGTGGAGAACGTGCTGGTGGTG A C GGGGCCCCAGTGCCTGGAGGTGTCTGTTCCCGA T GGGCTGTTCCTCAGCCTGGGGCTGGTGAGCCTCGTGGAGAACGTGCTGGTGGTG A T GGGGCCCCAGTGCCTGGAGGTGTCTGTTCCCGA C GGGCTGTTCCTCAGCCTGGGGCTGGTGAGCCTCGTGGAGAACGTGCTGGTGGTG 190 200 210 220 230 240 250 260 270 .........|.........|.........|.........|.........|.........|.........|.........|.........| GCTGCCATCACCAAGAACCGCAACCTGCATTCTCCCATGTATTACTTCATCTGCTGCCTGGCCGCGTCGGACCTGCTG A TGAGCATGAGC GCTGCCATCACCAAGAACCGCAACCTGCATTCTCCCATGTATTACTTCATCTGCTGCCTGGCCGCGTCGGACCTGCTG A TGAGCATGAGC GCTGCCATCACCAAGAACCGCAACCTGCATTCTCCCATGTATTACTTCATCTGCTGCCTGGCCGCGTCGGACCTGCTG G TGAGCATGAGC 280 290 300 310 320 330 340 350 360 .........|.........|.........|.........|.........|.........|.........|.........|.........| AACGTGCTGGAGACGGCCGTCATGCTGCTGCTGGAGGCTGGCGCCCTGGCCACATGGGCTACGGTGGTGCAGCAGCTGGACAA T GTCATG AACGTGCTGGAGACGGCCGTCATGCTGCTGCTGGAGGCTGGCGCCCTGGCCACATGGGCTACGGTGGTGCAGCAGCTGGACAA T GTCATG AACGTGCTGGAGACGGCCGTCATGCTGCTGCTGGAGGCTGGCGCCCTGGCCACATGGGCTACGGTGGTGCAGCAGCTGGACAA G GTCATG 370 380 390 400 410 420 430 440 450 .........|.........|.........|.........|.........|.........|.........|.........|.........| GATGTGCTCATCTGC A GCTCCATGGTGTCCAGCCTCTGCTCTCTGGGTGCTATCGCCGTGGACCGCTACATCTCCATCTTCTATGCACTG GATGTGCTCATCTGC A GCTCCATGGTGTCCAGCCTCTGCTCTCTGGGTGCTATCGCCGTGGACCGCTACATCTCCATCTTCTATGCACTG GATGTGCTCATCTGC G GCTCCATGGTGTCCAGCCTCTGCTCTCTGGGTGCTATCGCCGTGGACCGCTACATCTCCATCTTCTATGCACTG 460 470 480 490 500 510 520 530 540 .........|.........|.........|.........|.........|.........|.........|.........|.........| CGCTACCACAGCATCGTGACGCTGCCTCGGGCATGGCGGGCCATCGCGGCCATCTGGGTGGCCAGCGTCCTCTCCAGCACCCTCTTCATC CGCTACCACAGCATCGTGACGCTGCCTCGGGCATGGCGGGCCATCGCGGCCATCTGGGTGGCCAGCGTCCTCTCCAGCACCCTCTTCATC CGCTACCACAGCATCGTGACGCTGCCTCGGGCATGGCGGGCCATCGCGGCCATCTGGGTGGCCAGCGTCCTCTCCAGCACCCTCTTCATC 550 560 570 580 590 600 610 620 630 .........|.........|.........|.........|.........|.........|.........|.........|.........| ACCTACTATGATCACACAGCCGTCCTCCTCTGTCTCGTCAGCTTTTTTGTAGCCATGCTGGCGCTCATGGCGGTGCT G TATGTCCACATG ACCTACTATGATCACACAGCCGTCCTCCTCTGTCTCGTCAGCTTTTTTGTAGCCATGCTGGCGCTCATGGCGGTGCT G TATGTCCACATG ACCTACTATGATCACACAGCCGTCCTCCTCTGTCTCGTCAGCTTTTTTGTAGCCATGCTGGCGCTCATGGCGGTGCT A TATGTCCACATG 640 650 660 670 680 690 700 710 720 .........|.........|.........|.........|.........|.........|.........|.........|.........| CTGGCCCGGGCGTGCCAGCATGCCCGGGGCATCGCCCAGCTCCACAAGAGACAGCGCCCCATCCACCAGGGCTTTGGCCTCAAGGGCGTG CTGGCCCGGGCGTGCCAGCATGCCCGGGGCATCGCCCAGCTCCACAAGAGACAGCGCCCCATCCACCAGGGCTTTGGCCTCAAGGGCGTG CTGGCCCGGGCGTGCCAGCATGCCCGGGGCATCGCCCAGCTCCACAAGAGACAGCGCCCCATCCACCAGGGCTTTGGCCTCAAGGGCGTG 730 740 750 760 770 780 790 800 810 .........|.........|.........|.........|.........|.........|.........|.........|.........| GCCACGCTCACCATCCTGCTGGGCATCTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCACCTTTTCCTCATCGTCCTCTGTCCTCAGCAC GCCACGCTCACCATCCTGCTGGGCATCTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCACCTTTTCCTCATCGTCCTCTGTCCTCAGCAC GCCACGCTCACCATCCTGCTGGGCATCTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCACCTTTTCCTCATCGTCCTCTGTCCTCAGCAC 820 830 840 850 860 870 880 890 900 .........|.........|.........|.........|.........|.........|.........|.........|.........| CTTTTCCTCATCGTCCTCTGTCCTCAGCACAACCTCTTCCTTGCCCTCATCATCTGCAACTCCATCGTGGACCCCCTCATCTATGCCTTC CTTTTCCTCATCGTCCTCTGTCCTCAGCACAACCTCTTCCTTGCCCTCATCATCTGCAACTCCATCGTGGACCCCCTCATCTATGCCTTC CTTTTCCTCATCGTCCTCTGTCCTCAGCACAACCTCTTCCTTGCCCTCATCATCTGCAACTCCATCGTGGACCCCCTCATCTATGCCTTC 910 920 930 940 950 .........|.........|.........|.........|.........|.........| C GCAGCCAGGAGCTCCGGAAGACACTCCAGGA G GTGCTGCAGTGCTCCTGGTGA T GCAGCCAGGAGCTCCGGAAGACACTCCAGGA G GTGCTGCAGTGCTCCTGGTGA T GCAGCCAGGAGCTCCGGAAGACACTCCAGGA A GTGCTGCAGTGCTCCTGGTGA Father (bLACK) Mother (Cafe claro) F1 (white) T T A R C C M M V S S G Father (bLACK) Mother (Cafe claro) F1 (white) Father (bLACK) Mother (Cafe claro) F1 (white) Father (bLACK) Mother (Cafe claro) F1 (white) Father (bLACK) Mother (Cafe claro) F1 (white) Father (bLACK) Mother (Cafe claro) F1 (white) Father (bLACK) Mother (Cafe claro) F1 (white) Father (bLACK) Mother (Cafe claro) F1 (white) Father (bLACK) Mother (Cafe claro) F1 (white) Father (bLACK) Mother (Cafe claro) F1 (white) Father (bLACK) Mother (Cafe claro) F1 (white)
  21. 37. MC1R Sequence alignment of White X Cafe A T T T T M C R R G S G 10 20 30 40 50 60 70 80 90 .........|.........|.........|.........|.........|.........|.........|.........|.........| ATGCCTGTGCTCGGCCCCCAGAGGAGGCTGCTGGGCTCCCTCAACTCCACCCCCCAAGCC ACCACCCACCTCGGACTGGCC G CCAACCAG ATGCCTGTGCTCGGCCCCCAGAGGAGGCTGCTGGGCTCCCTCAACTCCACCCCCCAAGCC ACCACCCACCTCGGACTGGCC A CCAACCAG ATGCCTGTGCTCGGCCCCCAGAGGAGGCTGCTGGGCTCCCTCAACTCCACCCCCCAAGCC ACCACCCACCTCGGACTGGCC A CCAACCAG 100 110 120 130 140 150 160 170 180 .........|.........|.........|.........|.........|.........|.........|.........|.........| A C GGGGCCCCAGTGCCTGGAGGTGTCTGTTCCCGA C GGGCTGTTCCTCAGCCTGGGGCTGGTGAGCCTCGTGGAGAACGTGCTGGTGGTG A C GGGGCCCCAGTGCCTGGAGGTGTCTGTTCCCGA T GGGCTGTTCCTCAGCCTGGGGCTGGTGAGCCTCGTGGAGAACGTGCTGGTGGTG A T GGGGCCCCAGTGCCTGGAGGTGTCTGTTCCCGA T GGGCTGTTCCTCAGCCTGGGGCTGGTGAGCCTCGTGGAGAACGTGCTGGTGGTG 190 200 210 220 230 240 250 260 270 .........|.........|.........|.........|.........|.........|.........|.........|.........| GCTGCCATCACCAAGAACCGCAACCTGCATTCTCCCATGTATTACTTCATCTGCTGCCTGGCCGCGTCGGACCTGCTG G TGAGCATGAGC GCTGCCATCACCAAGAACCGCAACCTGCATTCTCCCATGTATTACTTCATCTGCTGCCTGGCCGCGTCGGACCTGCTG A TGAGCATGAGC GCTGCCATCACCAAGAACCGCAACCTGCATTCTCCCATGTATTACTTCATCTGCTGCCTGGCCGCGTCGGACCTGCTG G TGAGCATGAGC 280 290 300 310 320 330 340 350 360 .........|.........|.........|.........|.........|.........|.........|.........|.........| AACGTGCTGGAGACGGCCGTCATGCTGCTGCTGGAGGCTGGCGCCCTGGCCACATGGGCTACGGTGGTGCAGCAGCTGGACAA C GTCATG AACGTGCTGGAGACGGCCGTCATGCTGCTGCTGGAGGCTGGCGCCCTGGCCACATGGGCTACGGTGGTGCAGCAGCTGGACAA T GTCATG AACGTGCTGGAGACGGCCGTCATGCTGCTGCTGGAGGCTGGCGCCCTGGCCACATGGGCTACGGTGGTGCAGCAGCTGGACAA T GTCATG 370 380 390 400 410 420 430 440 450 .........|.........|.........|.........|.........|.........|.........|.........|.........| GATGTGCTCATCTGC G GCTCCATGGTGTCCAGCCTCTGCTCTCTGGGTGCTATCGCCGTGGACCGCTACATCTCCATCTTCTATGCACTG GATGTGCTCATCTGC A GCTCCATGGTGTCCAGCCTCTGCTCTCTGGGTGCTATCGCCGTGGACCGCTACATCTCCATCTTCTATGCACTG GATGTGCTCATCTGC G GCTCCATGGTGTCCAGCCTCTGCTCTCTGGGTGCTATCGCCGTGGACCGCTACATCTCCATCTTCTATGCACTG 460 470 480 490 500 510 520 530 540 .........|.........|.........|.........|.........|.........|.........|.........|.........| CGCTACCACAGCATCGTGACGCTGCCTCGGGCATGGCGGGCCATCGCGGCCATCTGGGTGGCCAGCGTCCTCTCCAGCACCCTCTTCATC CGCTACCACAGCATCGTGACGCTGCCTCGGGCATGGCGGGCCATCGCGGCCATCTGGGTGGCCAGCGTCCTCTCCAGCACCCTCTTCATC CGCTACCACAGCATCGTGACGCTGCCTCGGGCATGGCGGGCCATCGCGGCCATCTGGGTGGCCAGCGTCCTCTCCAGCACCCTCTTCATC 550 560 570 580 590 600 610 620 630 .........|.........|.........|.........|.........|.........|.........|.........|.........| ACCTACTATGATCACACAGCCGTCCTCCTCTGTCTCGTCAGCTTTTTTGTAGCCATGCTGGCGCTCATGGCGGTGCT A TATGTCCACATG ACCTACTATGATCACACAGCCGTCCTCCTCTGTCTCGTCAGCTTTTTTGTAGCCATGCTGGCGCTCATGGCGGTGCT G TATGTCCACATG ACCTACTATGATCACACAGCCGTCCTCCTCTGTCTCGTCAGCTTTTTTGTAGCCATGCTGGCGCTCATGGCGGTGCT G TATGTCCACATG 640 650 660 670 680 690 700 710 720 .........|.........|.........|.........|.........|.........|.........|.........|.........| CTGGCCCGGGCGTGCCAGCATGCCCGGGGCATCGCCCAGCTCCACAAGAGACAGCGCCCCATCCACCAGGGCTTTGGCCTCAAGGGCGTG CTGGCCCGGGCGTGCCAGCATGCCCGGGGCATCGCCCAGCTCCACAAGAGACAGCGCCCCATCCACCAGGGCTTTGGCCTCAAGGGCGTG CTGGCCCGGGCGTGCCAGCATGCCCGGGGCATCGCCCAGCTCCACAAGAGACAGCGCCCCATCCACCAGGGCTTTGGCCTCAAGGGCGTG 730 740 750 760 770 780 790 800 810 .........|.........|.........|.........|.........|.........|.........|.........|.........| GCCACGCTCACCATCCTGCTGGGCATCTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCACCTTTTCCTCATCGTCCTCTGTCCTCAGCAC GCCACGCTCACCATCCTGCTGGGCATCTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCACCTTTTCCTCATCGTCCTCTGTCCTCAGCAC GCCACGCTCACCATCCTGCTGGGCATCTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCACCTTTTCCTCATCGTCCTCTGTCCTCAGCAC 820 830 840 850 860 870 880 890 900 .........|.........|.........|.........|.........|.........|.........|.........|.........| CTTTTCCTCATCGTCCTCTGTCCTCAGCACAACCTCTTCCTTGCCCTCATCATCTGCAACTCCATCGTGGACCCCCTCATCTATGCCTTC CTTTTCCTCATCGTCCTCTGTCCTCAGCACAACCTCTTCCTTGCCCTCATCATCTGCAACTCCATCGTGGACCCCCTCATCTATGCCTTC CTTTTCCTCATCGTCCTCTGTCCTCAGCACAACCTCTTCCTTGCCCTCATCATCTGCAACTCCATCGTGGACCCCCTCATCTATGCCTTC 910 920 930 940 950 .........|.........|.........|.........|.........|.........| T GCAGCCAGGAGCTCCGGAAGACACTCCAGGA A GTGCTGCAGTGCTCCTGGTGA C GCAGCCAGGAGCTCCGGAAGACACTCCAGGA G GTGCTGCAGTGCTCCTGGTGA C GCAGCCAGGAGCTCCGGAAGACACTCCAGGA G GTGCTGCAGTGCTCCTGGTGA Father (White) Mother (Cafe) F1 (Light fawn) Father (White) Mother (Cafe) F1 (Light fawn) Father (White) Mother (Cafe) F1 (Light fawn) Father (White) Mother (Cafe) F1 (Light fawn) Father (White) Mother (Cafe) F1 (Light fawn) Father (White) Mother (Cafe) F1 (Light fawn) Father (White) Mother (Cafe) F1 (Light fawn) Father (White) Mother (Cafe) F1 (Light fawn) Father (White) Mother (Cafe) F1 (Light fawn) Father (White) Mother (Cafe) F1 (Light fawn) Father (White) Mother (Cafe) F1 (Light fawn)
  22. 40. Conclusion for Asip and MC1R
  23. 42. HIP ÓTESIS GENÉTICAS <ul><li>Gene dominante: Velasco J., 1980 </li></ul><ul><li>Gene recesivo: Calle Escobar R., 1984 </li></ul><ul><li>Gene dominante o aplotipo: Ponzoni et al., 1997; Baychelier, 2000; Sponenberg, 2010). </li></ul>
  24. 43. VELASCO (1981) <ul><li>HUACAYA x HUACAYA </li></ul><ul><ul><li>129 H </li></ul></ul><ul><li>SURI x HUACAYA </li></ul><ul><ul><li>9 S </li></ul></ul><ul><ul><li>3 H </li></ul></ul><ul><li>SURI x SURI </li></ul><ul><ul><li>422 S </li></ul></ul><ul><ul><li>89 H </li></ul></ul>
  25. 44. PONZONI et al. (1997) <ul><li>HUACAYA x HUACAYA </li></ul><ul><ul><li>145 H </li></ul></ul><ul><li>SURI x HUACAYA </li></ul><ul><ul><li>11 S </li></ul></ul><ul><ul><li>13 H </li></ul></ul><ul><li>SURI x SURI </li></ul><ul><ul><li>29 S </li></ul></ul><ul><ul><li>6 H </li></ul></ul>
  26. 45. SPONENBERG (2010) <ul><li>HUACAYA x HUACAYA </li></ul><ul><ul><li>4 S </li></ul></ul><ul><ul><li>19633 H </li></ul></ul><ul><li>SURI x HUACAYA </li></ul><ul><ul><li>56 S </li></ul></ul><ul><ul><li>89 H </li></ul></ul><ul><li>SURI x SURI </li></ul><ul><ul><li>1702 S </li></ul></ul><ul><ul><li>278 H </li></ul></ul>
  27. 52. SURI FROM HUACAYA PARENTS <ul><li>Flint (1996) </li></ul><ul><ul><li>12 among 8,446 1.4 </li></ul></ul><ul><li>Renieri et al. (2009) </li></ul><ul><ul><li>3 among 2,126 1.4 </li></ul></ul><ul><li>Sponenberg (2010) </li></ul><ul><ul><li>4 among 19633 0.025 </li></ul></ul>
  28. 54. Nueva mutaci ón dominante <ul><li>Mutaci ón con sobre exprésion genica </li></ul><ul><li>Tasa de mutación directa </li></ul><ul><li> = 3/2126 = 0.001411101 = 1,411101 x 10 -3 </li></ul>
  29. 56. CONVENIO UNICAM DSA - INIEA ILLPA PUNO CRUZAMIENTOS MACHOS HEMBRAS BLANCO X BLANCO 2 SURI 30 HUACAYA 2 HUACAYA 30 SURI BLANCO X COLOR 2 SURI 30 HUACAYA CAFÉ 2 HUACAYA 10 SURI LF + 8 AP + GR COLOR X COLOR NEGRO X NEGRO 2 SURI 30 HUACAYA 2 HUACAYA 17 SURI NEGRO X CAFÉ 1 SURI 15 HUACAYA 1 HUACAYA 15 SURI CAFÉ X CAFÉ 2 SURI 30 HUACAYA 1 HUACAYA 15 SURI TOTAL : 17 230
  30. 59. HUACAYA GENOTYPE <ul><li>DOBLE RECESSIVE </li></ul><ul><li>ab/ab </li></ul>
  31. 60. SURI GENOTYPE vs PHENOTYPE NO SEGREGATING GENOTYPES AA BB AA Bb Aa BB Aa Bb AA bb aa BB SEGREGATING GENOTYPES Aa Bb Aa bb aa Bb
  32. 61. TWO LINKED LOCI <ul><li>TEST CROSS </li></ul><ul><li>AB/ab x ab/ab </li></ul><ul><li>AB//ab configuration CIS </li></ul><ul><li>Ab//aB configuracion TRANS </li></ul>
  33. 62. CONFIGURATION CIS AB//ab x ab//ab <ul><li>AB//ab SURI </li></ul><ul><li>ab//ab HUACAYA </li></ul><ul><li>Segregation ratio 1:1 </li></ul><ul><li>THE MODEL IS INDISTINGUISHABLE FROM A SINGLE LOCUS RECESSIVE MODEL </li></ul>
  34. 63. R1 SEGREGATION RATIO <ul><li>R1 = ½ - h Huacaya : ½ + h Suri </li></ul><ul><li>Ratio close to 1 : 1 </li></ul>
  35. 64. CONFIGURATION TRANS AB//aB x ab//ab <ul><li>Ab//ab SURI </li></ul><ul><li>aB//ab SURI </li></ul><ul><li>NO SEGREGATION OF HACAYA </li></ul><ul><li>RECOMBINATION h </li></ul>
  36. 65. R2 SEGREGATION RATIO <ul><li>R2 = ½ h Huacaya : 1 – ½ h Suri </li></ul><ul><li>Ratio close 0 : 1 </li></ul>
  37. 66. h RECOMBINATION RATE <ul><li>MAXIMUM LIKELIHOOD ESTIMATE </li></ul><ul><li>h =0,099 </li></ul><ul><li>95% confidence limits </li></ul><ul><li>0.029 – 0.204 </li></ul>
  38. 74. Conclusions <ul><li>analysis of molecular variance (AMOVA), Nei’s and Cavalli-Sforza’s distance all suggest that there is no genetic differentiation between the two Suri and Huacaya populations for the studied loci. </li></ul>
  39. 75. THANK YOU ALL

×