Sequenziamento e analisi bioinformatica del genoma umano

9,993 views

Published on

by Frederic Reinier (CRS4)
What is human genome and what is sequencing....structure and steps in sequencing workflow..

Published in: Technology
2 Comments
1 Like
Statistics
Notes
  • Excelente !!! Science !!!

    Muchas Gracias !!! :D
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • <br /><object type="application/x-shockwave-flash" data="http://www.youtube.com/v/lYnD1WjLzNo?fs=1&amp;hl=en_US&amp;rel=0" width="350" height="288"><param name="movie" value="http://www.youtube.com/v/lYnD1WjLzNo?fs=1&amp;hl=en_US&amp;rel=0"></param><embed src="http://www.youtube.com/v/lYnD1WjLzNo?fs=1&amp;hl=en_US&amp;rel=0" width="350" height="288" type="application/x-shockwave-flash"></embed></object>
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
No Downloads
Views
Total views
9,993
On SlideShare
0
From Embeds
0
Number of Embeds
7
Actions
Shares
0
Downloads
132
Comments
2
Likes
1
Embeds 0
No embeds

No notes for slide

Sequenziamento e analisi bioinformatica del genoma umano

  1. 1. Sequenziamento e Analisi Bioinformatica del Genoma Umano Frederic Reinier reinier@crs4.it Sala Auditorium, Via Roma 253 Cagliari 11/05/2011venerdì 13 maggio 2011
  2. 2. • Cos’è il genoma umano ? – 46 cromosomi distinti (22 coppie di autosomi + X + Y) – ∼3,2 miliardi di paia di basi A-T e G-C. – ∼20,000–25,000 geni. 3venerdì 13 maggio 2011
  3. 3. • Cos’è il sequenziamento ? – Il sequenziamento del DNA è la determinazione dellordine dei diversi nucleotidi (basi) (Adenina, Citosina, Guanina e Timina) che costituiscono lacido nucleico (DNA). 4venerdì 13 maggio 2011
  4. 4. • Sequenziamento “ad alta processività” • Vantaggi delle piattaforme di nuova generazione • Rivoluzionaria diminuzione del costo e del tempo per generare dati di sequenza (lavorano in multi‐parallelo) – 10 Giorni per sequenziare il genoma di un individuo • Richiesta meno robotica nelle fasi precedenti al caricamento sul sequenziatore • Eccezionale risoluzione per molti tipi di esperimenti (es. analisi di espressione, sequenziamento di DNA immunoprecipitato e di micro RNA, analisi di medie/grandi inserzioni‐delezioni nei genomi....) 5venerdì 13 maggio 2011
  5. 5. •Work ow del sequenziamento 6venerdì 13 maggio 2011
  6. 6. •Work ow del sequenziamento 6venerdì 13 maggio 2011
  7. 7. •Work ow del sequenziamento 6venerdì 13 maggio 2011
  8. 8. •Primo Step - Preparazione del DNA 7venerdì 13 maggio 2011
  9. 9. 8venerdì 13 maggio 2011
  10. 10. • DNA fragmentation 9venerdì 13 maggio 2011
  11. 11. 10venerdì 13 maggio 2011
  12. 12. La Flowcell è un supporto in vetro delle dimensioni di un vetrino da microscopio contenente 8 “lane” a loro volta suddivise in 120 “tile” - quadrati in cui è possibile fissare circa 220.000 molecole di DNA. 11venerdì 13 maggio 2011
  13. 13. 12venerdì 13 maggio 2011
  14. 14. frammento originale Nuovo frammento esteso del frammento originale. 13venerdì 13 maggio 2011
  15. 15. 14venerdì 13 maggio 2011
  16. 16. 15venerdì 13 maggio 2011
  17. 17. 16venerdì 13 maggio 2011
  18. 18. 17venerdì 13 maggio 2011
  19. 19. 18venerdì 13 maggio 2011
  20. 20. 19venerdì 13 maggio 2011
  21. 21. Stesso fragmento di DNA = CLUSTERS 20venerdì 13 maggio 2011
  22. 22. CBOT 21venerdì 13 maggio 2011
  23. 23. CBOT 21venerdì 13 maggio 2011
  24. 24. • Flowcell –contiene i clusters che sono frammenti di DNA. • Tempo di preparazione –4 ore • Utilizzo della CBOT –permette l’incorporazione dei frammenti di DNA sulla owcell. 22venerdì 13 maggio 2011
  25. 25. Secondo Step - Il Sequenziamento 23venerdì 13 maggio 2011
  26. 26. Secondo Step - Il Sequenziamento 23venerdì 13 maggio 2011
  27. 27. Secondo Step - Il Sequenziamento 23venerdì 13 maggio 2011
  28. 28. Secondo Step - Il Sequenziamento 23venerdì 13 maggio 2011
  29. 29. Il laboratorio del CRS4 24venerdì 13 maggio 2011
  30. 30. 2009 25venerdì 13 maggio 2011
  31. 31. • Al interno del sequenziatore 26venerdì 13 maggio 2011
  32. 32. Hiseq2000 2010 27venerdì 13 maggio 2011
  33. 33. 28venerdì 13 maggio 2011
  34. 34. @ CRS4 29venerdì 13 maggio 2011
  35. 35. 30venerdì 13 maggio 2011
  36. 36. 31venerdì 13 maggio 2011
  37. 37. G C G A T A G G T G T C A C T 32venerdì 13 maggio 2011
  38. 38. G C G A T A G G T G T C A C T 32venerdì 13 maggio 2011
  39. 39. G C G cycle 1 A T A G G T G T C A C T 32venerdì 13 maggio 2011
  40. 40. G C G cycle 1 A T A G G T G T C A C T 32venerdì 13 maggio 2011
  41. 41. X Y G C G cycle 1 A T A G G T G T C A C T 32venerdì 13 maggio 2011
  42. 42. G X Y G C G cycle 1 A T A G G T G T C A C T 32venerdì 13 maggio 2011
  43. 43. G Y G C G cycle 1 A T A G G T G T C A C T 32venerdì 13 maggio 2011
  44. 44. G G C G cycle 1 A T A G G T G T C A C T 32venerdì 13 maggio 2011
  45. 45. G G C G G cycle 1 A T A G G T G T C A C T 32venerdì 13 maggio 2011
  46. 46. G G C G G cycle 1 A T A T G G G T C A C T 32venerdì 13 maggio 2011
  47. 47. GT G C G G cycle 1 A T A T T cycle 2 G G G T C A C T 32venerdì 13 maggio 2011
  48. 48. GT G C G G cycle 1 A T A T T cycle 2 G A G G T C C T 32venerdì 13 maggio 2011
  49. 49. GT G C G G cycle 1 A T A T T cycle 2 G G A cycle 3 G T C C T 32venerdì 13 maggio 2011
  50. 50. GTA G C G G cycle 1 A T A T T cycle 2 G A G cycle 3 G T C C T 32venerdì 13 maggio 2011
  51. 51. GTA G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C G T C C T 32venerdì 13 maggio 2011
  52. 52. GTAC G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 G T C C T 32venerdì 13 maggio 2011
  53. 53. GTACT G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 G T C C T 32venerdì 13 maggio 2011
  54. 54. GTACT G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 G T C C T 32venerdì 13 maggio 2011
  55. 55. GTACT G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 G T C C T 32venerdì 13 maggio 2011
  56. 56. GTAC T G G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 G T C C T 32venerdì 13 maggio 2011
  57. 57. GTAC T G G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 G T C C T 32venerdì 13 maggio 2011
  58. 58. GTAC T G G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 G T C C T 32venerdì 13 maggio 2011
  59. 59. GTAC T G G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 G T C C T 32venerdì 13 maggio 2011
  60. 60. GTAC T G G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 G T C C T 32venerdì 13 maggio 2011
  61. 61. GTAC T G G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C G T C C T 32venerdì 13 maggio 2011
  62. 62. GTAC T G G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C G T C C T 32venerdì 13 maggio 2011
  63. 63. GTAC T G G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C G T C C T 32venerdì 13 maggio 2011
  64. 64. GTAC T G G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C G T C C T 32venerdì 13 maggio 2011
  65. 65. GTAC T G G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C G T C C T 32venerdì 13 maggio 2011
  66. 66. GTAC T G G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T 32venerdì 13 maggio 2011
  67. 67. GTAC T G T G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T 32venerdì 13 maggio 2011
  68. 68. GTAC T G TC G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T 32venerdì 13 maggio 2011
  69. 69. GTAC T G TCA G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T 32venerdì 13 maggio 2011
  70. 70. GTAC T G TCAT G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T 32venerdì 13 maggio 2011
  71. 71. GTAC T G TCATG G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T 32venerdì 13 maggio 2011
  72. 72. GTAC T G TCATGC G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T 32venerdì 13 maggio 2011
  73. 73. GTAC T G TCATGCG G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T 32venerdì 13 maggio 2011
  74. 74. GTAC T G TCATGCG T G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T 32venerdì 13 maggio 2011
  75. 75. GTAC T G TCATGCG TA G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T 32venerdì 13 maggio 2011
  76. 76. GTAC T G TCATGCG TAT G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T A 32venerdì 13 maggio 2011
  77. 77. GTAC T G TCATGCG TAT G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T A 32venerdì 13 maggio 2011
  78. 78. GTAC T G TCATGCG TAT G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T A C 32venerdì 13 maggio 2011
  79. 79. GTAC T G TCATGCG TAT G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T A cycle 99 C 32venerdì 13 maggio 2011
  80. 80. GTAC T G TCATGCG TAT G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T A cycle 99 C cycle 100 32venerdì 13 maggio 2011
  81. 81. GTAC T G TCATGCG TATA G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T A cycle 99 C cycle 100 32venerdì 13 maggio 2011
  82. 82. GTAC T G TCATGCG TATAC G G G cycle 1 A T A T T cycle 2 G A G cycle 3 C cycle 4 C T G T C G T C T C A T G C G T A T A cycle 99 C cycle 100 32venerdì 13 maggio 2011
  83. 83. 33venerdì 13 maggio 2011
  84. 84. CTAGCGATCAG CGATGATCGAC CACAGCAGCTAC • 2 Miliardi (2Gbasi) di Clusters sulla owcell –2 Miliardi di Reads • 100 Bases per Reads 200 GB di basi sequenziate 34venerdì 13 maggio 2011
  85. 85. • copertura del genoma (coverage) –numero di volte che una base è rappresentata nell’insieme dei reads 35venerdì 13 maggio 2011
  86. 86. • Genome Analyzer (1 owcell) – genera 96 000 000 000 (96 Miliardi) di basi. – equivalente a 96/3 =~ 32 genomi umani letti una volta. – limitazione a 1 individuo/Lane: • 32/8 Lanes/2 owcells =~ 2x di copertura del genoma 36venerdì 13 maggio 2011
  87. 87. • Hiseq 2000 (2 owcells) – genera 400 000 000 000 (400 Miliardi) di basi. – equivalente a 400/3 =~ 133 genomi umani letti una volta. – limitazione a 1 individuo/Lane: • 133/8 Lanes/2 owcells =~ 8,3x di copertura del genoma 37venerdì 13 maggio 2011
  88. 88. 1 TB (1 TeraByte) = 1 000 USB keys of 1 GB analizza immagine (foto) 32 TB automaticamente “intensity data”: 2 TB si può conservare prima analisi base call / 250 GB 250 GB quality data allineamento 6TB 1.2 TB per ogni esperimento: 1.45 TB 38venerdì 13 maggio 2011
  89. 89. 39venerdì 13 maggio 2011
  90. 90. –OK abbiamo tanti reads, ma come li utilizziamo? –Siamo sicuri che questi dati sono di buona qualita ? 40venerdì 13 maggio 2011
  91. 91. il formato FASTQ per le sequenze @SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !*((((***+))%%%++)(%%%%).1***-+*))**55CCF>>>>>>CCCCCCC65 Sanger format can encode a Phred quality score from 0 to 93 using ASCII 33 to 126 (although in raw read data the Phred quality score rarely exceeds 60, higher scores are possible in assemblies or read maps). Also used in SAM format. 41venerdì 13 maggio 2011
  92. 92. !"#"#$%&&(#)*)+ • Phred-score Quality ! !"#"$"%&"()%&"* ! +,"*-./0$,1(./"234+56 * +,"74,/$14+8)"/..(."9.(747++56"! Phred quality scores are Probability of incorrect base call Base call accuracy logarithmically linked to error probabilities Phred Quality Score 10 1 in 10 90 % 20 1 in 100 99 % 30 1 in 1000 99.9 % 40 1 in 10000 99.99 % 50 1 in 100000 99.999 % 42venerdì 13 maggio 2011
  93. 93. Terzo Step - Analisi dei Dati 43venerdì 13 maggio 2011
  94. 94. Terzo Step - Analisi dei Dati 43venerdì 13 maggio 2011
  95. 95. Terzo Step - Analisi dei Dati 43venerdì 13 maggio 2011
  96. 96. Terzo Step - Analisi dei Dati 43venerdì 13 maggio 2011
  97. 97. BIOINFORMATICS ORIGINAL PAPER Vol. 25 no. 14 2009, pages 1754–1760 doi:10.1093/bioinformatics/btp324 Sequence analysis Fast and accurate short read alignment with Burrows–Wheeler transform Heng Li and Richard Durbin∗ Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Cambridge, CB10 1SA, UK Received on February 20, 2009; revised on May 6, 2009; accepted on May 12, 2009 Advance Access publication May 18, 2009 Associate Editor: John Quackenbush ABSTRACT of scanning the whole genome when few reads are aligned. Motivation: The enormous amount of short reads generated by the The second category of software, including SOAPv1 (Li et al., new DNA sequencing technologies call for the development of fast 2008b), PASS (Campagna et al., 2009), MOM (Eaves and and accurate read alignment programs. A first generation of hash Gao, 2009), ProbeMatch (Jung Kim et al., 2009), NovoAlign table-based methods has been developed, including MAQ, which (http://www.novocraft.com), ReSEQ (http://code.google.com/p/ is accurate, feature rich and fast enough to align short reads from a re-seq), Mosaik (http://bioinformatics.bc.edu/marthlab/Mosaik) and single individual. However, MAQ does not support gapped alignment BFAST (http://genome.ucla.edu/bfast), hash the genome. These for single-end reads, which makes it unsuitable for alignment of programs can be easily parallelized with multi-threading, but they longer reads where indels may occur frequently. The speed of MAQ is usually require large memory to build an index for the human also a concern when the alignment is scaled up to the resequencing genome. In addition, the iterative strategy frequently introduced by of hundreds of individuals. these software may make their speed sensitive to the sequencing Results: We implemented Burrows-Wheeler Alignment tool (BWA), error rate. The third category includes slider (Malhis et al., 2009) a new read alignment package that is based on backward search which does alignment by merge-sorting the reference subsequences with Burrows–Wheeler Transform (BWT), to efficiently align short and read sequences. sequencing reads against a large reference sequence such as the Recently, the theory on string matching using Burrows–Wheeler human genome, allowing mismatches and gaps. BWA supports both Transform (BWT) (Burrows and Wheeler, 1994) has drawn the base space reads, e.g. from Illumina sequencing machines, and attention of several groups, which has led to the development of color space reads from AB SOLiD machines. Evaluations on both SOAPv2 (http://soap.genomics.org.cn/), Bowtie (Langmead et al., simulated and real data suggest that BWA is ∼10–20× faster than 2009) and BWA, our new aligner described in this article. MAQ, while achieving similar accuracy. In addition, BWA outputs Essentially, using backward search (Ferragina and Manzini, 2000; alignment in the new standard SAM (Sequence Alignment/Map) Lippert, 2005) with BWT, we are able to effectively mimic the top- format. Variant calling and other downstream analyses after the down traversal on the prefix trie of the genome with relatively small alignment can be achieved with the open source SAMtools software memory footprint (Lam et al., 2008) and to count the number of exact package. hits of a string of length m in O(m) time independent of the size of Availability: http://maq.sourceforge.net the genome. For inexact search, BWA samples from the implicit Contact: rd@sanger.ac.uk prefix trie the distinct substrings that are less than k edit distance away from the query read. Because exact repeats are collapsed on 44 one path on the prefix trie, we do not need to align the reads againstvenerdì 13 maggio 2011 1 INTRODUCTION each copy of the repeat. This is the main reason why BWT-based
  98. 98. • Allineamento con l’algoritmo di BWA – index del genoma di riferimento • divide il genoma di riferimento in diversi pezzi – calcolo delle coordinate di “su x array” con il migliore allineamento sul riferimento index. – conversione della coordinate di “su x array” in coordinate “genomica”. 45venerdì 13 maggio 2011
  99. 99. • Data “management” del formato dei reads allineato – il formato SAM e BAM sono de niti dalla comunità scienti ca internazionale. – il programma samtools permette: • di ordinare i reads secondo le coordinate genomiche di allineamento • di creare un formato unico (chiamato SAM o BAM) • il formato BAM è la versione “compressa” del formato SAM. 46venerdì 13 maggio 2011
  100. 100. • GATK – GATK ricalibra ( modifica il Phred-score) lo score delle basi in un file di sequenze allineate • Dopo la ricalibrazione, lo score di ogni sequenza è piu “accurate”, nel senso che la qualità rappresenta la probabilità di non avere allineato correttamente il read sul genoma di riferimento. • Inoltre, la ricalibrazione prova a correggere la qualità in funzione del ciclo di sequenziamento della machina (efficienza dei reagenti chimici) . 47venerdì 13 maggio 2011
  101. 101. !"# • Controlli di qualita – !"!#$! "%&()* +,#&-.&/&,0&11,2313/&4,5/,67"7879 :69,;<=>,7,"8,;?=>@ +,"AB&C3D&,A/)5)E&/E,05E%,F3%5/&, G&CHACF3/& +,6B&C3D&,-.315EI,JK,!L=,3E,1&3)E,HAC,H5C)E, M=>,I1&) +,NACF311I,6BD,-.315EI,HAC,E%&,13)E,I1&) )%A.14,2&,2&E0&&/,OP,3/4,L= 48venerdì 13 maggio 2011
  102. 102. Il genoma di riferimento è una sequenza di DNA assemblato dagli scienziati durante il progetto genoma umano. 49venerdì 13 maggio 2011
  103. 103. 50venerdì 13 maggio 2011
  104. 104. 51venerdì 13 maggio 2011
  105. 105. • Programmazione Informatica –numeri linguaggio di programmazione sono usati: •C • C++ • Perl script • Python script • Bash script • Statistica e Matematica • Competenze in Biologia 52venerdì 13 maggio 2011
  106. 106. • Il sequenziamento del genoma sardo permette di definire i caratteri genetici specifici della popolazione. • Popolazione Isolata – Assenza sostanziale di sottostruttura di popolazione (basso tasso di immigrazione) – Presenza di varianti comuni nei sardi e rare o assenti in altre popolazioni – Nonostante sia una popolazione europea, si comporta come un outlier rispetto alla gamma di variabilità europea 53venerdì 13 maggio 2011
  107. 107. BIOMEDICINA ENERGIA E AMBIENTE DATA FUSION Collana di Seminari per la Valorizzazione dei Risultati della Ricerca al CRS4 prossimo appuntamento... 25 Maggio 30.03.2011 2011 Seminario 16:00 -18:00 P.M. AULA MAGNA DIP. FISICA Cittadella Universitaria - Monserrato Nel campo della ricerca biomedica, si possono veri care 3 situazioni in grado di generare importanti quantità di dati: l’elevato livello di digitalizzazione dei sistemi informativi sanitari pubblici, la presenza di rilevanti studi di popolazione su larga scala che raccolgono informazioni di tipo fenotipico e clinico e la disponibilità di moderni strumenti d’indagine, come i sequenziatori di nuova generazione, capaci di produrre importanti quantità di dati genomici. Studi di associazione genetica e disegno sperimentale “caso controllo”: La vastità e l’eterogeneità di questi dati implica necessariamente un nuovo approccio che, separando opportunamente il generico concetto applicazioni a diabete di tipo 1 e sclerosi multipla nella popolazione Sarda del dato dal suo formalismo, permetta il loro e ciente utilizzo per l’estrazione di informazioni a bene cio della ricerca. Durante il seminario sarà illustrata l’esperienza del CRS4 nell’approccio integrato alla gestione e alla fruizione analitica di grosse quantità di dati biologici e clinici in collaborazione con importanti istituti di ricerca. Relatore I recenti sviluppi delle nuove piattaforme sperimentali consentono Ilenia Zara CRS4 Relatore: Giammarco Cuccuru di studiare le caratteristiche genetiche di intere popolazioni utlizzando volumi di dati sempre crescenti con costi sempre minori. Questo tipo di studi rende necessaria l’interazione tra persone con una formazione medico/biologica e persone con competenze nei campivenerdì 13 maggio 2011 della statistica e dell’informatica.
  108. 108. Ringraziamenti !! CHRIS JONES LIDIA LEONI Ilenia Zara and her group Maria Valentini Riccardo Berutti PATRICIA RODRIGUEZ-TOME Rossano Atzeni and her group ANDREA ANGIUS FRANCESCO CUCCA Maria Francesca Urru Serena Sanna Manuela Oppo Carlo Sidore Rosella Pilu Marco Marcelli Groups VALE & Roberto Cusano OUTREACHvenerdì 13 maggio 2011
  109. 109. Info e iscrizione: www.crs4.it Video e slide: facebook.com/crs4fb twitter.com/crs4research youtube.com/CRS4video slideshare.net/CRS4 contatti: calis@crs4.itvenerdì 13 maggio 2011

×