Understanding the effects of HMW-GS and LMW-GS on processing quality using near-isogenic linesand development of functiona...
Plant materials
Quality parameters Flour yield, energy, extensograph maximum resistance,  farinograph stability time, and noodle viscoela...
a                                                                                b       Glu-A3              Glu-B3       ...
LMWGS3c      650                    650     LMWGS3b              Aroona                                                   ...
Identification of LMW-GS genes in 16 Aroona NILs by        using the LMW-GS gene marker system
A3b A3c A3d A3e A3f B3a B3b B3c B3d B3f B3g B3h B3i D3a D3b D3c D3d D3f
The effects of glutenin subunits on dough properties  Different letters indicate the significant difference at 5% probabil...
The effects of glutenin subunits on pan bread quality   Different letters indicate the significant difference at 5% probab...
The effects of glutenin subunits on quantity of              gluten protein fractionsDifferent letters indicate the signif...
The effects of glutenin subunits on fresh white Chinese                     noodle quality   Different letters indicate th...
The effects of glutenin subunits on northern style Chinese                   steamed bread quality      Different letters ...
The effects of combination of HMW-GS and LMW-GS on                    dough propertiesTrait                    Combination...
The effects of combination of HMW-GS and LMW-GS on              quantity of gluten protein fractionsTrait                 ...
The effects of combination of HMW-GS and LMW-GS on                      processing qualityTrait                       Comb...
Cloning of Glu-B3 genes anddevelopment of functional markers
Primers used for cloning Glu-B3 genesTarget    Primer   Sequence (5'→3')             Reference   Primer      Ann    tempge...
Primers localization for cloning Glu-B3  a.      LB1F-LB1R             LB4F-LB4R              LB2F-LB2R  b.               ...
PCR amplification Amplified the isogenic lines with  different Glu-B3 protein alleles. Cloned 4 genes at Glu-B3 locus,  ...
Glu-B3 allelic variants          Allelic                    Accession No.Gene      variants   Allele   SizeGluB3-1   GluB3...
Relationship between Glu-B3 protein             alleles and gene haplotypesLines        Allele   GluB3   GluB3   GluB3-   ...
Sequence alignment of allelic variantsGLUB3-11   CAACCACAACAATTTCCACAACAGCAACCATGTTCACAACAACAACAACAACAACAACAACAACAACAAC   ...
Allele-specific PCR markers for the discriminationof different Glu-B3 protein alleles   Marker     Primer   Sequence (5'→3...
STS markers  a   b   c   d   e   f   g   h   I                                      gluB3a                                ...
STS markers  a   b   c   d   e   f   g   h   I                                      gluB3d                                ...
STS markers a   b   c   d   e   f   g   h   I                                     gluB3fg                                 ...
Validation of molecular markersTwenty wheat cultivars and 141 CIMMYT advancedlines were tested with the markers. The resul...
Allele-specific PCR markers for the discrimination         of different Glu-A3 protein alleles   Marker    Primer   Sequen...
Glu-A3 marker    A3a A3b A3c A3d A3e A3f A3g                                        AF33-A3A3R                            ...
Glu-A3 marker    A3a A3b A3c A3d A3e A3f A3g                                         AF63-A6D2R                           ...
Glu-A3 marker    A3a A3b    A3c A3d    A3e   A3f   A3g                                             A3F1F-A3F3R            ...
Glu-A3 multiplex PCR GluA3be       GluA3dfGluA3bf         GluA3dg
Glu-A3 multiplex PCR                                  a   GluA3b   GluA3d                                       GluA3be + ...
AcknowledgementKen Shepherd, SARDI Grain Quality Research LaboratoryMarie Appelbee, SARDI Grain Quality Research Laborator...
These studies were supported bythe National Basic Research Program (2009CB118300),National Natural Science Foundation of C...
Thank you !
Upcoming SlideShare
Loading in …5
×

Understanding the effects of HMW-GS and LMW-GS on processing quality using near-isogenic lines and development of functional markers for LMW-GS in wheat

1,124 views

Published on

International Gluten Workshop, 11th; Beijing (China); 12-15 Aug 2012

Published in: Self Improvement, Technology
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
1,124
On SlideShare
0
From Embeds
0
Number of Embeds
229
Actions
Shares
0
Downloads
10
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Understanding the effects of HMW-GS and LMW-GS on processing quality using near-isogenic lines and development of functional markers for LMW-GS in wheat

  1. 1. Understanding the effects of HMW-GS and LMW-GS on processing quality using near-isogenic linesand development of functional markers for LMW-GS in wheat Xianchun Xia, Zhonghu He National Wheat Improvement Center, Chinese Academy of Agricultural Sciences xiaxianchun@caas.net.cn
  2. 2. Plant materials
  3. 3. Quality parameters Flour yield, energy, extensograph maximum resistance, farinograph stability time, and noodle viscoelasticity Chinese steamed bread, fresh white Chinese noodle, pan bread quality glutenin macropolymers, dough properties
  4. 4. a b Glu-A3 Glu-B3 Glu-D3 A3b A3d A3e A3f B3a B3c B3d B3f B3g B3h B3i D3a D3b D3d D3f B3i D3a HMW-GS D-group B3-688 A3-620 B3-691 B-group A3-620 B3-621 B3-570 D3-575 D3-575 B3-607 D3-578 D3-578 D3-525 D3-525 C-group B3-530 B3-510 D3-432 D3-442Fig. 1 Separation of HMW-GS and LMW-GS on SDS-PAGE
  5. 5. LMWGS3c 650 650 LMWGS3b Aroona 620 & 621 A3c/B3b/D3c Aroona-A3b 643 Aroona-A3d370 402 565 568 662 700 LMWGS3c Aroona-A3e 646 Aroona-A3f 640 600 LMWGS3b Aroona-B3a 548 593 624 700 688 LMWGS3b Aroona-B3c 548 700 688 LMWGS3b Aroona-B3d 548 Aroona-B3f 548 601 Aroona-B3g 544 700 LMWGS3b 800 Aroona-B3h 548 688 813 700 688 Aroona-B3i 510 570 691 LMWGS3b Fig. 2 Separation of Aroona-D3a 441 525 LMW-GS genes in 441 Aroona-D3b Aroona NILs using 583 the LMW-GS gene 441 Aroona-D3d 586 molecular marker 525 600 LMWGS3b Aroona-D3f system.
  6. 6. Identification of LMW-GS genes in 16 Aroona NILs by using the LMW-GS gene marker system
  7. 7. A3b A3c A3d A3e A3f B3a B3b B3c B3d B3f B3g B3h B3i D3a D3b D3c D3d D3f
  8. 8. The effects of glutenin subunits on dough properties Different letters indicate the significant difference at 5% probability level
  9. 9. The effects of glutenin subunits on pan bread quality Different letters indicate the significant difference at 5% probability level
  10. 10. The effects of glutenin subunits on quantity of gluten protein fractionsDifferent letters indicate the significant difference at 5% probability level
  11. 11. The effects of glutenin subunits on fresh white Chinese noodle quality Different letters indicate the significant difference at 5% probability level
  12. 12. The effects of glutenin subunits on northern style Chinese steamed bread quality Different letters indicate the significant difference at 5% probability level
  13. 13. The effects of combination of HMW-GS and LMW-GS on dough propertiesTrait CombinationZSV Large 1/7+9/5+10/Glu-A3c/Glu-B3b/Glu-D3c 1/17+18/2+12/Glu-A3c/Glu-B3b/Glu-D3c Small 1/7+9/2+12/Glu-A3e/Glu-B3b/Glu-D3c 1/7+9/2+12/Glu-A3c/Glu-B3c/Glu-D3cST Long 1/7+9/5+10/Glu-A3c/Glu-B3b/Glu-D3c 1/7+9/2+12/Glu-A3f/Glu-B3b/Glu-D3c Short 1/7+9/2+12/Glu-A3c/Glu-B3c/Glu-D3c 1/7+9/2+12/Glu-A3e/Glu-B3b/Glu-D3cExt Good 1/7+9/2+12/Glu-A3c/Glu-B3i/Glu-D3c 1/7+9/2.2+12/Glu-A3c/Glu-B3b/Glu-D3c Bad 1/7+9/2+12/Glu-A3c/Glu-B3c/Glu-D3c 1/7+9/2+12/Glu-A3e/Glu-B3b/Glu-D3c
  14. 14. The effects of combination of HMW-GS and LMW-GS on quantity of gluten protein fractionsTrait CombinationGli/Glu Low 1/7+9/2+12/Glu-A3c/Glu-B3g/Glu-D3c 1/7+9/3+12/Glu-A3c/Glu-B3b/Glu-D3c High 1/7+9/2+12/Glu-A3e/Glu-B3b/Glu-D3c 1/7+9/2+12/Glu-A3c/Glu-B3c/Glu-D3c%UPP High 1/7+9/5+10/Glu-A3c/Glu-B3b/Glu-D3c 1/7+9/2+12/Glu-A3c/Glu-B3b/Glu-D3d Low 2*/7+9/2+12/Glu-A3c/Glu-B3b/Glu-D3c 1/7+9/2+12/Glu-A3e/Glu-B3b/Glu-D3c
  15. 15. The effects of combination of HMW-GS and LMW-GS on processing qualityTrait CombinationPBTS High 1/7+9/2+12/Glu-A3c/Glu-B3b/Glu-D3f 1/7+9/2+12/Glu-A3c/Glu-B3g/Glu-D3c Low 1/7+9/2+12/Glu-A3e/Glu-B3b/Glu-D3c N/7+9/2+12/Glu-A3c/Glu-B3b/Glu-D3cNoodle Good 1/7+9/2+12/Glu-A3c/Glu-B3d/Glu-D3c 1/7+9/2+12/Glu-A3c/Glu-B3f/Glu-D3cviscoelasticity Bad 1/7*+8/2+12/Glu-A3c/Glu-B3b/Glu-D3c 1/7+9/2+12/Glu-A3b/Glu-B3b/Glu-D3cSBTS High 1/7+9/2+12/Glu-A3c/Glu-B3b/Glu-D3f 1/7+9/2+12/Glu-A3c/Glu-B3a/Glu-D3c Low 1/7+9/2+12/Glu-A3c/Glu-B3g/Glu-D3c 1/7+9/2+12/Glu-A3c/Glu-B3d/Glu-D3c
  16. 16. Cloning of Glu-B3 genes anddevelopment of functional markers
  17. 17. Primers used for cloning Glu-B3 genesTarget Primer Sequence (5'→3') Reference Primer Ann tempgene gene locationa (oC)GluB3-1 LB1F GCACAAGCATCAAAACCAAGA AB262661 -13b 58 LB1R GACACTTTATTTGTCACCGCTG AB262661 1129GluB3-2 LB2F AACCTAACGCATTGTACCAAAAATC AY542898 208 61 LB2R GGCGGGTCACACATGACA AY542898 1499GluB3-3 LB3F CATCACAAGCACAAGCATCAA Y14104 472 58 LB3R CATATCCATCGACTAAACAAA AB119006 709GluB3-4 LB4F CACCCTATACAAGGTTCCAAAAT Y14104 77 60 LB4R TATTTCCATAATTTAAACTAGTTTGT AB062852 +1346 b
  18. 18. Primers localization for cloning Glu-B3 a. LB1F-LB1R LB4F-LB4R LB2F-LB2R b. LB3F-LB3RFig.1 Electrophoresis of the PCR products of the four gene-specific primer setson agarose gel. a GluB3-1, GluB3-4 and GluB3-2 genes, 1 Chinese Spring, 2N1AT1B, 3 N1BT1A, 4 N1BT1D and 5 N1DT1B. b GluB3-3 gene, 1, 2, 5, 6, 71BL.1RS lines, 3 Aroona-B3c, 4 Aroona-B3d, 8 Aroona-B3h, 9 Aroona-B3i, 10N1AT1B, 11 N1BT1A, 12 N1BT1D and 13 N1DT1B. M DNA Ladder 2000(100, 250, 500, 750, 1,000 and 2,000 bp)
  19. 19. PCR amplification Amplified the isogenic lines with different Glu-B3 protein alleles. Cloned 4 genes at Glu-B3 locus, with 17 allelic variants.
  20. 20. Glu-B3 allelic variants Allelic Accession No.Gene variants Allele SizeGluB3-1 GluB3-11 a 1213 EU369699 GluB3-12 b 1228 EU369700 GluB3-13 e 1225 EU369701 GluB3-14 f 1222 EU369702 GluB3-15 g 1162 EU369703GluB3-2 GluB3-21 a 1396 EU369704 GluB3-22 bef 1393 EU369721 GluB3-23 g 1393 EU369705GluB3-3 GluB3-31 c 1290 EU369715 GluB3-32 d 1290 EU369716 GluB3-33 h 1290 EU369717 GluB3-34 i 1290 EU369718GluB3-4 GluB3-41 acd 1636 EU369724 GluB3-42 b 1636 EU369719 GluB3-43 eh 1636 EU369727 GluB3-44 fg 1636 EU369729 GluB3-45 i 1615 EU369720
  21. 21. Relationship between Glu-B3 protein alleles and gene haplotypesLines Allele GluB3 GluB3 GluB3- GluB3- GluB3- GluB3- GluB3- GluB3- -11 -12 13 14 15 21 22 23Aroona-B3a a + +Aroona b + +Aroona-B3c cAroona-B3d dCheyenne e + +Aroona-B3f f + +Aroona-B3g g + +Aroona-B3h hAroona-B3i iLines Allele GluB3 GluB3 GluB3- GluB3- GluB3- GluB3- GluB3- GluB3- GluB3- -31 -32 33 34 41 42 43 44 45Aroona-B3a a +Aroona b +Aroona-B3c c + +Aroona-B3d d + +Cheyenne e +Aroona-B3f f +Aroona-B3g g +Aroona-B3h h + +Aroona-B3i i + +
  22. 22. Sequence alignment of allelic variantsGLUB3-11 CAACCACAACAATTTCCACAACAGCAACCATGTTCACAACAACAACAACAACAACAACAACAACAACAAC 280GLUB3-12 CAACCACAACAATTTCCACAACAGCAACCATGTTCACAACAACAACAACAACAACAACAACAACAACAAC 280GLUB3-13 CAACCACAACAATTTCCACAACAGCAACCATGTTCACAACAACAACAACAACAACAACAACAACAACAAC 280GLUB3-14 CAACCACAACAATTTCCACAACAGCAACCATGTTCACAACAACAACAACAACAACAACAACAACAACAAC 280GLUB3-15 CAACCACAACAATTTCCACAACAGCAACCATGTTCACAACAACAACAACAACAACAACAACAACAACAAC 280GLUB3-11 AACAACAACAACAACAACAACAACAACAACAACAACAA............CCATTATCGCAGCAACAACA 338GLUB3-12 AACAACAACAACAACAACAACAACAACAACAACAACAACaacaacaacaaCCATTATCGCAGCAACAACA 350GLUB3-13 AACAACAACAACAACAACAACAACAACAACAACAACAACaacaacaa...CCATTATCGCAGCAACAACA 347GLUB3-14 AACAACAACAACAACAACAACAACAACAACAACAACAACaacaa......CCATTATCGCAGCAACAACA 344GLUB3-15 AACAACAACAA........................................................... 292GLUB3-11 ACCACCATTTTCACAGCAACAACAACCACCATTTTCACAGCAACAACCACCATTTTCGCAGCAACAACAA 408GLUB3-12 ACCACCATTTTCACAGCAACAACAACCACCATTTTCACAGCAACAACCACCATTTTCGCAGCAACAACAA 420GLUB3-13 ACCACCATTTTCACAGCAACAACAACCACCATTTTCACAGCAACAACCACCATTTTCGCAGCAACAACAA 417GLUB3-14 ACCACCATTTTCACAGCAACAACAACCACCATTTTCACAGCAACAACCACCATTTTCGCAGCAACAACAA 414GLUB3-15 ....CCATTaTCgCAGCAACAACAACCACCATTTTCACAGCAACAACCACCATTTTCGCAGCAACAACAA 357GLUB3-11 CCAGTTCTACCGCAACAGCCATCATTTTCGCAGCAACAACTACCACCATTTTCACAACAACAACCACCGT 478GLUB3-12 CCAGTTCTACCGCAACAGCCATCATTTTCGCAGCAACAACTACCACCATTTTCACAACAACAACCACCGT 490GLUB3-13 CCAGTTCTACCGCAACAGCCATCATTTTCGCAGCAACAACTACCACCATTTTCACAACAACAACCACCGT 487GLUB3-14 CCAGTTCTACCGCAACAGCCATCATTTTCGCAGCAACAACTACCACCATTTTCACAACAACAACCACCGT 484GLUB3-15 CCAGTTCTACCGCAACAGCCATCATTTTCGCAGCAACAACTACCACCATTTTCACAACAACAACCACCGT 427GLUB3-11 TTTCACAACAACAACAACCAGTACTACCGCAACAACCACCATTTTCGCAACAACAACAACAACAA...CC 545GLUB3-12 TTTCACAACAACAACAACCAGTACTACCGCAACAACCACCATTTTCGCAACAACAACAACAACAAcaaCC 560GLUB3-13 TTTCACAACAACAACAACCAGTACTACCGCAACAACCACCATTTTCGCAACAACAACAACAACAAcaaCC 557GLUB3-14 TTTCACAACAACAACAACCAGTACTACCGCAACAACCACCATTTTCGCAACAACAACAACAACAAcaaCC 554GLUB3-15 TTTCACAACAACAACAACCAGTACTACCGCAACAACCACCATTTTCGCAACAACAACAACAACAA...CC 494
  23. 23. Allele-specific PCR markers for the discriminationof different Glu-B3 protein alleles Marker Primer Sequence (5'→3') Target Fragment PCR condition name set allele size gluB3a SB1F GCACAAGCATCAAAACCAAGA a 1095 94℃/35s-55℃/35s-72℃/90s SB1R TGGCACACTAGTGGTGGTC gluB3b SB2F ATCAGGTGTAAAAGTGATAG b 1570 94℃/35s-56℃/35s-72℃/90s SB2R TGCTACATCGACATATCCA gluB3c SB3F CAAATGTTGCAGCAGAGA c 472 94℃/35s-56℃/35s-72℃/90s SB3R CATATCCATCGACTAAACAAA gluB3d SB4F CACCATGAAGACCTTCCTCA d 662 94℃/35s-58℃/35s-72℃/90s SB4R GTTGTTGCAGTAGAACTGGA gluB3e SB5F GACCTTCCTCATCTTCGCAa e 669 94℃/35s-58℃/50s-72℃/90s SB5R GCAAGACTTTGTGGCATT gluB3fg SB6F TATAGCTAGTGCAACCTACCAT fg 812 94℃/35s-62℃/35s-72℃/90s SB6R CAACTACTCTGCCACAACG gluB3g SB7F CCAAGAAATACTAGTTAACACTAGT g 853 94℃/35s-60℃/35s-72℃/90s C SB7R GTTGGGGTTGGGAAACA gluB3h SB8F CCACCACAACAAACATTAA h 1022 94℃/35s-60℃/35s-72℃/90s SB8R GTGGTGGTTCTATACAACGA gluB3i SB9F As SB6F i 621 94℃/35s-58℃/35s-72℃/90s SB9R TGGTTGTTGCGGTATAATTT gluB3bef SB10F GCATCAACAACAAATAGTACTAGAA bef 750 94℃/35s-60℃/35s-72℃/90s SB10R GGCGGGTCACACATGACA
  24. 24. STS markers a b c d e f g h I gluB3a 1095bp gluB3b 1615bp gluB3c 472bp
  25. 25. STS markers a b c d e f g h I gluB3d 662bp gluB3e 669bp gluB3bef 750bp
  26. 26. STS markers a b c d e f g h I gluB3fg 812bp gluB3g 853bp gluB3h 1022bp gluB3i 621bp
  27. 27. Validation of molecular markersTwenty wheat cultivars and 141 CIMMYT advancedlines were tested with the markers. The results wereconsistent with those detected by SDS-PAGE, exceptfor 4 lines.Wang et al. 2009, Theor Appl Genet 118:525–539
  28. 28. Allele-specific PCR markers for the discrimination of different Glu-A3 protein alleles Marker Primer Sequence (5'→3') a Target Fragmen PCR condition name set allele t size GluA3a LA1F AAACAGAATTATTAAAGCCGG a 529 94℃/35s-60℃/35s-72℃/90s SA1R GGTTGTTGTTGTTGCAGCA GluA3b LA3F TTCAGATGCAGCCAAACAA b 894 94℃/35s-60℃/35s-72℃/90s SA2R GCTGTGCTTGGATGATACTCTA GluA3ac LA1F AAACAGAATTATTAAAGCCGG acb 573 94℃/35s-60℃/35s-72℃/90s SA3R GTGGCTGTTGTGAAAACGA GluA3d LA3F TTCAGATGCAGCCAAACAA d 967 94℃/35s-60℃/35s-72℃/90s SA4R TGGGGTTGGGAGACACATA GluA3e LA1F AAACAGAATTATTAAAGCCGG e 158 94℃/35s-60℃/35s-72℃/90s SA5R GGCACAGACGAGGAAGGTT GluA3f LA1F AAACAGAATTATTAAAGCCGG f 552 94℃/35s-60℃/35s-72℃/90s SA6R GCTGCTGCTGCTGTGTAAA GluA3g LA1F AAACAGAATTATTAAAGCCGG g 1345 94℃/35s-60℃/35s-72℃/90s SA7R AAACAACGGTGATCCAACTAA
  29. 29. Glu-A3 marker A3a A3b A3c A3d A3e A3f A3g AF33-A3A3R GluA3a AF63-A6B3R GluA3b AF14-A3AC2R GluA3acWang et al. 2010, J. Cereal Sci 51:305-312
  30. 30. Glu-A3 marker A3a A3b A3c A3d A3e A3f A3g AF63-A6D2R GluA3d Af522-A5d1r GluA3d AF14-A3E3R GluA3eWang et al. 2010, J. Cereal Sci 51:305-312
  31. 31. Glu-A3 marker A3a A3b A3c A3d A3e A3f A3g A3F1F-A3F3R GluA3f AF33-A1G1R GluA3gWang et al. 2010, J. Cereal Sci 51:305-312
  32. 32. Glu-A3 multiplex PCR GluA3be GluA3dfGluA3bf GluA3dg
  33. 33. Glu-A3 multiplex PCR a GluA3b GluA3d GluA3be + GluA3df 967bp 894bp GluA3f 552bp GluA3e 158bp b GluA3bf + GluA3dg GluA3g GluA3b GluA3d 1345bp 967bp GluA3f 894bp 552bpWang et al. 2010, J Cereal Science 51:305-312
  34. 34. AcknowledgementKen Shepherd, SARDI Grain Quality Research LaboratoryMarie Appelbee, SARDI Grain Quality Research LaboratoryRudi Appels, University of MurdochWujun Ma, University of MurdochRoberto Peñ CIMMYT a,Aimin Zhang, Institute of Genetics, CASPeiyuan Mu and Zheru Fan for their assistance in the field trialsXianlin ZhaoLinhai WangXiaofei ZhangHui Jin
  35. 35. These studies were supported bythe National Basic Research Program (2009CB118300),National Natural Science Foundation of China (30830072),International Collaboration Project from Ministry ofAgriculture (2011-G3)
  36. 36. Thank you !

×