11th International Gluten Workshop     Starch Biosynthesis in Rice Grains      —— Natural Variation and Genetic Improvemen...
Outline1. Allelic diversities in rice starch biosynthesis   and genetic network for rice grain quality2. Genetic engineeri...
Determinants of rice grain quality      Milling quality      Appearance quality      Cooking & eating quality      Nutriti...
Three key physicochemical properties determine          rice cooking and eating quality                          GT       ...
Wide diversity of cooking and eating             qualities among rice cultivars                              Amylose conte...
Starch, the major component in rice endospermAmylose   Amylopectin                                Amylopectin        Amylo...
Starch Synthesis Related Genes, SSRGs         Classification of key enzymes               Gene      Localization          ...
1. Natural variation of starch synthesis  To search and identify the allelic   variation of SSRGs among different   rice ...
70 varieties with diverse grain qualities                                   Indica (33)                                   ...
High correlation among AC, GC and GT               AC                    GC                        GT                     ...
Starch pasting curve of different rice cultivars                   6500                                  Tm           TN1 ...
16 core varieties selected for sequence analysis of SSRGs
Wx gene alignmentThe Wx gDNA alignment among different varieties                Varieties                   175   298     ...
Wx gene alignmentThe cDNA Alignment Among Different VarietiesVarieties                                                  11...
Association analysis? How many major and minor genes control grain  cooking and eating quality? Are AC, GC, and/or GT cont...
Association analysis                                  — e.g. Who control AC?                       2111-2112             3...
Association analysis                                                    — e.g. Who control AC?                      30.00 ...
Association analysis                                                      — e.g. Who control AC?                      30.0...
SSRGs form a network controlling rice cooking and eating quality                                  Wx and SSII-3 are centr...
Verification of SSRGsTransgenic tests         Near-isogenic lines                        Receptor╳ Donor (s)              ...
Verification of the major gene for AC, Wx               (Transgenic)Down-regulation             Over-expression
Verification of the minor gene for AC, SBE3                 (Transgenic)
Verification of the minor gene, SSSI                    (Near-isogenic lines)                                             ...
The starch quality of RNAi transgenic lines                                 containing different SSSI allele              ...
Q-RT-PCR analysis in developing rice seeds                                                                         12     ...
Molecular improvement of rice grain/starch qualityMarker-assisted selection (MAS)      Transgenic regulation              ...
MAS          Functional SSRGs‟ markers for MAS                                                      M   Nip LTF   9311 930...
MAS Improvement of cooking and eating quality    of the female line Longtefu by MAS                               AC      ...
TransgenicDown of AC by transformation of antisense Wx geneWxb   J1    J3   J4   J5                                       ...
Summary Rice grain cooking and eating qualities are  regulated by starch synthesis related genes  (SSRGs) in a network. ...
Outline1. Allelic diversities in rice starch biosynthesis   and genetic network for rice grain quality2. Genetic engineeri...
Resistant Starch (RS) Starch that escapes degradation in the small intestine,  and, therefore, is available for bacterial...
Content of resistant starch in different starch sources      Source            Resistant   Non-Resistant                  ...
High amylose content is a source ofResistant starch (%)                             resistant starch (RS)                 ...
Effects of regulation of different SSRGs       on high-amylose production                     Zhu et al., Plant Biotech J,...
Very-high-amylose rice grain with a high         level of RS and total dietary fiber(Wild type: Indica, high AC)          ...
Starch granule morphology of RS-rich riceWT                              RSPolygonal granules with sharp   Irregularly lar...
Fine structure of starches from RS-rich rice               WT        (High-amylose)                                    RS ...
RS-rich rice highly resistant to alkali         digestion and gelatinizationRegular rice                 High-resistant st...
WT   RS50 oC             Resistant to                  gelatinization                  during heating70 oC             in ...
Improvement in indices of animal health                       in rats by RS-rich rice meal                  360           ...
Improvement in indices of animal health     in rats by RS-rich rice meal                           250                    ...
Reduce of blood glucose response in diabeticZucker fatty rats fed the RS-rich rice starch                16.0             ...
SummaryA   high-amylose (64.8%) rice enriched with resistant  starch (14.6%) was developed by transgenic regulation  of s...
Acknowledgements Collaborators:    Prof. Jiayang Li (Inst. Genet. Develop. Biol., CAS)    Prof. Mengming Hong (Shanghai In...
Thank you !
Upcoming SlideShare
Loading in …5
×

Starch Biosynthesis in Rice Grains: Natural Variation and Genetic Improvement

2,857 views

Published on

International Gluten Workshop, 11th; Beijing (China); 12-15 Aug 2012

Published in: Technology, Business
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
2,857
On SlideShare
0
From Embeds
0
Number of Embeds
227
Actions
Shares
0
Downloads
134
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Starch Biosynthesis in Rice Grains: Natural Variation and Genetic Improvement

  1. 1. 11th International Gluten Workshop Starch Biosynthesis in Rice Grains —— Natural Variation and Genetic Improvement Qiao-quan Liu(刘巧泉) College of Agriculture, Yangzhou University, Yangzhou, Jiangsu Province, China E-mail: qqliu@yzu.edu.cn Amylose Amylopectin
  2. 2. Outline1. Allelic diversities in rice starch biosynthesis and genetic network for rice grain quality2. Genetic engineering of starch biosynthesis for high resistant starch (RS) in rice
  3. 3. Determinants of rice grain quality Milling quality Appearance quality Cooking & eating quality Nutritional quality
  4. 4. Three key physicochemical properties determine rice cooking and eating quality GT GCGelatinization Gel consistencytemperature measures thedetermines the tendency of thetime required for cooked rice tocooking the rice harden on cooling. AC High amylose content grains cook dry, are less tender, and become hard upon cooling.
  5. 5. Wide diversity of cooking and eating qualities among rice cultivars Amylose content Gelatinization Gel Consistency (%) Temperature (ASV) (mm)Cultivar Maturity No. type type Range Mean Range Mean Range Mean Early 8 23.75-26.60 25.28 3.22-5.22 4.35 30-97 53.63 Indica Medium 33 9.68-30.64 24.16 2.67-6.89 4.89 20-120 56.21 Late 32 11.64-28.66 20.30 2.00-6.56 4.92 21-110 63.22 Early 13 10.54-23.09 15.25 5.94-6.91 6.42 51-95 71.77Japonica Medium 25 11.34-18.00 14.77 3.32-7.00 5.98 38-108 75.64 Late 5 15.64-22.16 18.35 6.00-6.94 6.38 24-85 59.20
  6. 6. Starch, the major component in rice endospermAmylose Amylopectin Amylopectin Amylose DBE SBE SSS ? AGPase ADPGlc
  7. 7. Starch Synthesis Related Genes, SSRGs Classification of key enzymes Gene Localization Large subunit 1 AGPL1 Chr 5ADP glucose pyrophosphorylase Large subunit 2 AGPL2 Chr 6 (AGPase) Small subunit AGPS Chr 9Granule-bound starch synthase GBSSI Wx Chr 6 (GBSS) GBSSII GBSSII Chr 7 SSSI SSSI Chr 6 SSSII-1 Chr 10 SSSII SSSII-2 Chr 2 Soluble starch synthase SSSII-3 Chr 6 (SSS) SSSIII-1 Chr 4 SSSIII SSSIII-2 Chr 8 SSSIV-1 Chr 1 SSSIV SSSIV-2 Chr 5 SBEI Sbe1 Chr 6 Starch branching enzyme (SBE) Sbe3 Chr 2 SBEII Sbe4 Chr 4 Starch debranching enzyme Isoamylase (ISA) ISA Chr 8 (DBE) Pullulanase (PUL) PUL Chr 4
  8. 8. 1. Natural variation of starch synthesis  To search and identify the allelic variation of SSRGs among different rice ecotypes.  To find how these genes controlling rice cooking and eating qualities. (Cooperated with Prof. Jiayang Li, IGDB, CAS)
  9. 9. 70 varieties with diverse grain qualities Indica (33) Japonica (37)
  10. 10. High correlation among AC, GC and GT AC GC GT -0.91 a * -0.46 AC 1.00 0.007 b 0.779 0.50 GC 1.00 0.326 GT 1.00a Correlation Coefficientsb Pr > F* The number marked in bold imply the according line and row quality arecorrelated with each other Tian et al., PNAS, 2009, 106: 21760-21765
  11. 11. Starch pasting curve of different rice cultivars 6500 Tm TN1 LTP GCH 5500 9311 WY7 High AC CJ06 NIP 4500 Viscosity (cP) JZXN THN SYN 3500 Low or intermediate AC 2500 1500 Very low or no AC 500 -500 0.0 2.0 4.0 6.0 8.0 10.0 12.0 14.0 16.0 Time (min) Rapid Visco Analyser (RVA)
  12. 12. 16 core varieties selected for sequence analysis of SSRGs
  13. 13. Wx gene alignmentThe Wx gDNA alignment among different varieties Varieties 175 298 495 528 771-785 841 926 987 1056 1083 1088Nipponbare ( japonica ) C C A C CT ( 18 ) T G AATT(6) A C AChunjiang 06 ( japonica ) C C A C CT ( 17 ) T G AATT(6) A C AWuyunjing 7 ( japonica ) C C A C CT ( 17 ) T G AATT(6) A C AJiangzhouxiangnuo ( japonica - glutinous) C C A C CT ( 16 ) T G AATT(6) A C ASuyunuo ( japonica - glutinous) C C A C CT ( 16 ) T G AATT(6) A C ATaihunuo ( japonica - glutinous) C C A C CT ( 16 ) T G AATT(6) A C A9308 ( indica ) C C A C CT ( 18 ) T G AATT(6) A C G9311 ( indica ) C C A C CT ( 18 ) T G AATT(6) A C AGuichao 2( indica ) C C G T CT ( 11 ) G A AATT(5) G T ALongtepu ( indica ) C T G T CT ( 11 ) G A AATT(5) G T AMinghui 63 ( indica ) C C A C CT ( 18 ) T G AATT(6) A C ATaizhongbendi 1( indica ) C C G T CT ( 11 ) G A AATT(5) G T AZhenshan97B ( indica ) A C G T CT ( 11 ) G A AATT(5) G T A 5„UTR Varieties 2111-2112 3019 3097 3804 4078 4211 4235 4244-4246 4282 4285Nipponbare ( japonica ) ------------------------ C C T C G G ATA A GChunjiang 06 ( japonica ) ------------------------ C C T C G G ATA A GWuyunjing 7 ( japonica ) ------------------------ C C T C G G ATA A GJiangzhouxiangnuo ( japonica - glutinous) ACGGGTTCCAGGGCCTCAAGCCC C C T C G G ATA A GSuyunuo ( japonica - glutinous) ACGGGTTCCAGGGCCTCAAGCCC C C T C G G ATA A GTaihunuo ( japonica - glutinous) ACGGGTTCCAGGGCCTCAAGCCC C C T C G G ATA A G9308 ( indica ) ------------------------ C C T C G G ATA A G9311 ( indica ) ------------------------ C C T C G G ATA A GGuichao 2( indica ) ------------------------ - T C T A A --- G ALongtepu ( indica ) ------------------------ - T C T A A --- G AMinghui 63 ( indica ) ------------------------ C C T C G G ATA A GTaizhongbendi 1( indica ) ------------------------ - T C T A A --- G AZhenshan97B ( indica ) ------------------------ - T C T A A --- G A Exon 2 intron exon intron
  14. 14. Wx gene alignmentThe cDNA Alignment Among Different VarietiesVarieties 111-112 172 1086 1243Nipponbare ( japonica ) ---------------------------------------- T CChunjiang 06 ( japonica ) ---------------------------------------- T CWuyunjing 7 ( japonica ) ---------------------------------------- T CJiangzhouxiangnuo ( japonica - glutinous) ACGGGTTCCAGGGCCTCAAGCCC TGASuyunuo ( japonica - glutinous) ACGGGTTCCAGGGCCTCAAGCCC TGATaihunuo ( japonica - glutinous) ACGGGTTCCAGGGCCTCAAGCCC TGA9308 ( indica ) ---------------------------------------- T C9311 ( indica ) ---------------------------------------- T C StopGuichao2( indica ) ---------------------------------------- C T codonLongtepu ( indica ) ---------------------------------------- C TMinghui 63 ( indica ) ---------------------------------------- T CTaizhongbendi 1( indica ) ---------------------------------------- C TZhenshan97B ( indica ) ---------------------------------------- C T • The diversities of the coding sequences were much lower than those of whole genes in all SSRGs. • The diversities of the nonsynonymous substitution were lower than the synonymous. • This result suggested that these SSRGs had likely undergone artificial selection during domestication Tian et al., PNAS, 2009, 106: 21760-21765
  15. 15. Association analysis? How many major and minor genes control grain cooking and eating quality? Are AC, GC, and/or GT controlled by one or multiple genes? What is the relationship among these genes? …
  16. 16. Association analysis — e.g. Who control AC? 2111-2112 3019 3097 3804 4078 4211 4235 4244-4246 4282 4285 ------------------------ C C T C G G ATA A GWx II ------------------------ C C T C G G ATA A G ------------------------ C C T C G G ATA A G ACGGGTTCCAGGGCCTCAAGCCC C C T C G G ATA A GWx III ACGGGTTCCAGGGCCTCAAGCCC C C T C G G ATA A G ACGGGTTCCAGGGCCTCAAGCCC C C T C G G ATA A G ------------------------ C C T C G G ATA A G ------------------------ C C T C G G ATA A G ------------------------ - T C T A A --- G A ------------------------ - T C T A A --- G AWx I ------------------------ C C T C G G ATA A G ------------------------ - T C T A A --- G A ------------------------ - T C T A A --- G A Wx I Wx III Wx II Wx III Wx II
  17. 17. Association analysis — e.g. Who control AC? 30.00 A Major 25.00Amylose content (%) 20.00 15.00 10.00 5.00 0.00 Wx I Wx II Wx III
  18. 18. Association analysis — e.g. Who control AC? 30.00 Minor Minor Minor A Major B C D 25.00Amylose content (%) 20.00 15.00 10.00 5.00 0.00 Wx I Wx II Wx III SBE3 I SBE3 II SSII-3 I SSII-3 II SSIII-2 I SSIII-2 II 30.00 Minor Interaction E FAmylose content (%) 25.00 20.00 15.00 10.00 5.00 0.00 SSIV-2 I SSIV-2 II SBE3 I SBE3 II SBE3 I SBE3 II SBE3 I SBE3 II Wx I Wx II Wx III Tian et al., PNAS, 2009, 106: 21760-21765
  19. 19. SSRGs form a network controlling rice cooking and eating quality  Wx and SSII-3 are central in determining grain quality by affecting all three properties  Ttwo genes affect two properties simultaneously, both ISA and SBE3 affect GC and GT.  Several minor genes are specific for single properties, SSIII-2, AGPlar, PUL, and SSI for AC, AGPiso for GC, and SSIV-2 for GT.  The correlations among AC, GC, and GT were caused by the joint action of these associated genes and unequal haplotype combination. Fig. Summary of genescontrolling rice grain quality Tian et al., PNAS, 2009, 106: 21760-21765
  20. 20. Verification of SSRGsTransgenic tests Near-isogenic lines Receptor╳ Donor (s) F1 ╳ Receptor MAS BCnF1 BCnF2(3)
  21. 21. Verification of the major gene for AC, Wx (Transgenic)Down-regulation Over-expression
  22. 22. Verification of the minor gene for AC, SBE3 (Transgenic)
  23. 23. Verification of the minor gene, SSSI (Near-isogenic lines) 3500SSSI i SSSI j LTF 3000 ( SSSI i ) LTF × 9311 2500 NILs F1 × LTF ( SSSI j ) Viscosity (cP) 2000 1500 BC1F1 1000 500 BC6F1 BC6F3 0 0 200 400 600 800 LTF-NIL-SSSI j Time(Sec) Breeding of NILs RVA profiles of NILs
  24. 24. The starch quality of RNAi transgenic lines containing different SSSI allele Nipponbare (SSSI j) LTF (SSSI i) WT RNAi lines WT RNAi lines 4000 4000 3500 3500 LTF (SSSI i) 3000 Nipponbare (SSSI j) 3000Viscosity(cP) Viscosity(cP) 2500 2500 2000 2000 1500 1500 1000 RNAi 1000 RNAi 500 500 0 0 0 200 400 600 800 0 200 400 600 800 Time(sec) Time(sec)
  25. 25. Q-RT-PCR analysis in developing rice seeds 12 Expression level relative to ActinThe transcriptional level of 10 8SSSI j allele is much lower 6than that of SSSI i allele in 4rice endosperm 2 0 WXJ9 GLXN ZS97 LTP SSSI j SSSI i SSSI j-GUS GUS activity in developing seeds of transgenic rice GUS activity ATG TGA SSS I GUS 1 ATG TGA SSS I GUS SSSI i-GUS SSSI 0 0 100 200 300 400 500 13193 bp SSSI Liu et al., unpublished
  26. 26. Molecular improvement of rice grain/starch qualityMarker-assisted selection (MAS) Transgenic regulation Promoter GOI Ter Allele i Allele j Receptor × Donor F1 × Receptor MAS BC1F1 BC6F1 BC6F3
  27. 27. MAS Functional SSRGs‟ markers for MAS M Nip LTF 9311 9308 SYNTian et al., Chinese Sci Bull., 2010. 55: 3768-3777
  28. 28. MAS Improvement of cooking and eating quality of the female line Longtefu by MAS AC GC GTLine Wx allele (%) (cm) (ASV)LTF Wxa Wxa 27.81 6.00 7.00LTF-TT-1 Wxb Wxb 15.30 11.75 2.50LTF-TT-3 Wxb Wxb 17.91 11.05 3.00LTF-TT-5 Wxb Wxb 15.56 10.35 5.00 Liu et al., Crop Science, 2006; Yu et al., J Cereal Sci, 2009
  29. 29. TransgenicDown of AC by transformation of antisense Wx geneWxb J1 J3 J4 J5 30 Wild type 25 Amylose content (%) 20 15Wxa I1 I5 I6 wx 10 5 0 WY7 WY8 WX LTF QLZ TQ Japonica Indica Northern blot Liu et al., Mol Breed, 2005; Yu et al., J Cereal Sci, 2009
  30. 30. Summary Rice grain cooking and eating qualities are regulated by starch synthesis related genes (SSRGs) in a network. Transgenic and near-isogenic studies with selected major and/or minor SSRGs have verified the above results, and which shown that genetic modification with SSRGs will improve rice grain qualities as desired.
  31. 31. Outline1. Allelic diversities in rice starch biosynthesis and genetic network for rice grain quality2. Genetic engineering of starch biosynthesis for high resistant starch (RS) in rice
  32. 32. Resistant Starch (RS) Starch that escapes degradation in the small intestine, and, therefore, is available for bacterial fermentation in the large intestine.  Butyrate production  Prebiotic-stimulate growth  Inhibit cancer  Boost immune system  Reduce glycemic response (slower insulin release)  Low calorie intake Christer Jansson, Bioproducts, Nov. 2008
  33. 33. Content of resistant starch in different starch sources Source Resistant Non-Resistant starch starch Potato Oat Corn Wheat Pea Taro Millet Buck wheat Rice Bean Sweet potato Resistant starch
  34. 34. High amylose content is a source ofResistant starch (%) resistant starch (RS) Zhu et al., Carbohydrate Polymers, 2011, 86: 1751-1759
  35. 35. Effects of regulation of different SSRGs on high-amylose production Zhu et al., Plant Biotech J, 2012, 10: 353-362
  36. 36. Very-high-amylose rice grain with a high level of RS and total dietary fiber(Wild type: Indica, high AC) Zhu et al., Plant Biotech J, 2012, 10: 353-362
  37. 37. Starch granule morphology of RS-rich riceWT RSPolygonal granules with sharp Irregularly large voluminous starch granules and angles and edges sausage-like elongated small starch granulesWT RS J Agri & Food Chem, 2010, 58: 1224; 2010, 58:11946
  38. 38. Fine structure of starches from RS-rich rice WT (High-amylose) RS (Increase of B-chains) RS-WT Zhu et al., Plant Biotech J, 2012, 10: 353
  39. 39. RS-rich rice highly resistant to alkali digestion and gelatinizationRegular rice High-resistant starch rice (Intact milled rice soaked in 5% KOH solution for 16 hours) Wei et al., J Agri Food Chem, 2010, 2011
  40. 40. WT RS50 oC Resistant to gelatinization during heating70 oC in water75 oC80 oC90 oC Wei et al., Food Chemistry, 2011, 128: 645-652
  41. 41. Improvement in indices of animal health in rats by RS-rich rice meal 360 Regular rice group 320Body weight (g) 280 RS rice group 240 200 1 3 5 7 9 11 13 15 17 19 21 23 Feeding time (d) Zhu et al., Plant Biotech J, 2012, 10: 353-362
  42. 42. Improvement in indices of animal health in rats by RS-rich rice meal 250 200 WT RS Content (umole/g) 150 100 50 0 Acetic 乙酸 Propionic 丙酸 Butyric 丁酸 Total 短链脂肪酸 acid acid acid SCFAThe rats consuming the RS-rich rice excreted more total short chain fatty acids (SCFAs) than those fed the regular rice Zhu et al., Plant Biotech J, 2012, 10: 353-362
  43. 43. Reduce of blood glucose response in diabeticZucker fatty rats fed the RS-rich rice starch 16.0 14.0 WTGlucose level 12.0 RS 10.0 8.0 6.0 4.0 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5 6.0 6.5 7.0 7.5 Time (h) Acute oral rice tolerance test (ORTT) in type II diabetic rats Zhu et al., Plant Biotech J, 2012, 10: 353-362
  44. 44. SummaryA high-amylose (64.8%) rice enriched with resistant starch (14.6%) was developed by transgenic regulation of starch biosynthesis. RS-rich rice starches highly resistant to digestion and gelatinization Consumption of the RS-rich rice had improved in indices of animal health in both normal and diabetic rats.
  45. 45. Acknowledgements Collaborators: Prof. Jiayang Li (Inst. Genet. Develop. Biol., CAS) Prof. Mengming Hong (Shanghai Inst. Plant Physiol. Eco., CAS) Prof. Qian Qian (Chinese Rice Research Institute) Prof. Yongcheng Shi (Kansas State University, USA) ……Supported by: National Natural Science Foundation of China (NSFC) National Key Basic Research Projects (“973” project) National Major Projects for Transgenic Research
  46. 46. Thank you !

×