Advertisement
Advertisement

More Related Content

Slideshows for you(20)

Similar to Plant Genetics and The Future of Food. Pam Ronald(20)

Advertisement

More from CIAT(20)

Advertisement

Plant Genetics and The Future of Food. Pam Ronald

  1. Plant Genetics and The Future of Food Professor Pamela Ronald Dept. Plant Pathology and the Genome Center Institute of Food and Agricultural Literacy University of California, Davis
  2. BLS BLS BLB BLB BLB BLB BLB BLBBacterial blight of rice Xanthomonas oryzae pv. oryzae (Xoo) What are the gene6c components controlling rice/Xoo interac6ons?
  3. Oryza longistaminata
  4. BLS BLS BLB BLB BLB BLB BLB BLBXa21: Broad-spectrum resistance to Xoo identified in the wild species Oryza longistaminata Gurdev Khush UC Davis International Rice Research Institute
  5. ENGINEERED WITH THE XA21 GENE CONVENTIONAL Song et al., 1995
  6. Ronald and Beutler, Science, 2010 1995 XA21 KKinase Rip1 Text TLR4 1998 TIR Plant and Animal Immune Receptors Pelle 1996 TIR TOLL ? Aspergillus fumigatus Homo sapiens Neisseria meningitidis
  7. Pruitt et al., 2015 Science Advances Pruitt et al., 2017 New Phytologist Microbial raxX is required for activation of XA21-mediated immunity RaxX XA21 Xoo RaxX RaxX is a small sulfated protein SS S
  8. RaxX21 is similar to the plant peptide hormone PSY1 • PSY1 is a secreted 18 amino acid peptide. • PSY1 is sulfated by the plant TyrosylProtein SulfoTransferase (TPST1). • PSY1 and TPST1 have homologs in many plants including Arabidopsis and rice. • PSY1 promotes cellular proliferation and expansion
  9. Live root imaging of Arabidopsis tpst1 seedlings treated with RaxX21-sY Wei Feng Jose Dinneny Mock RaxX21-sY
  10. Rice PSY receptor XA21 Immune response RaxX PSY PSY PSY RaxX Xoo RaxX Growth ??? Hypothesis: RaxX is a mimic of the growth promoting PSY (peptide sulfated on tyrosine) peptides.
  11. • Immune receptors in plants and animals are remarkably similar • Bacterial pathogens produce peptide hormone mimics hypothesized to give a selective advantage
  12. Engineering Rice for Tolerance to Submergence
  13. 25% of the world’s rice is grown in flood-prone areas In Bangladesh and India alone, 4 million tons of rice, enough to feed 30M people, is lost every year to floods An old rice variety, highly tolerant to submergence, was found in Eastern India X
  14. Genomic DNA Cloned DNA SSR1A Genetic Markers A211rf The Sub1 region contains genes encoding ethylene response factor (ERF)-genes: Sub1A, Sub1B and Sub1C Xu et al., Nature. 2006. Jung, An, Ronald. Nature Reviews Genetics. 2008. ERFs are known regulators of stress tolerance Kenong Xu Sub1A Sub1B Sub1C DNA sequence atgccgatggaaccatgccgatggaaccatgccgatggaaccatgccgatggaaccatgccgatggaaccatgccgatggaaccatgccgatggaaccatgccgatggaacc
  15. Genetic Engineering Validates Sub1A function
  16. M 202(Sub1) M 202(Sub1) Photo: Yufan Zhou, Ronald Lab CONVENTIONAL ENGINEERED WITH THE SUB1A GENE
  17. Marker assisted breeding to engineer submergence tolerant rice for farmers David Mackill, Abdel Ismail and colleagues in the Philippines, India and Bangladesh
  18. Conventional breeding Marker-assisted breeding Variety with desired trait Farmers favorite Hybrid Farmers favorite with desired trait Slow Fast Imprecise Precise
  19. Sub1 Time-lapse sequence IR64 + Sub1 vs. IR64 14 June to 16 October 2007 IRRI ES Plot G14
  20. Performance of Swarna-Sub1 in farmers’ fields 2008, Gotha, UP, India Swarna Swarna-Sub1 3-5 fold yield increase
  21. Video courtesy of Gene Hettel IRRI “I was surprised and happy when I saw that the Sub1 rice survived the flood” Harir Danga farmer, Bangladesh
  22. Raut family Village of Naugaon, Orissa, India In flooded fields in India, villagers were able to harvest more rice for their families “Because of the Sub1 variety my family had more to eat this year and more money to spend” Video courtesy of Gene Hettel IRRI
  23. Samba Samba-Sub1 Samba-Sub1 IR64-Sub1 IR49830 (Sub1) IR64 IR42 IR64 IR64-Sub1 Samba-Sub1 IR49830 (Sub1) Samba IR64 IR64-Sub1 IR49830 (Sub1) IR42 IR64-Sub1 IR64 IR49830 (Sub1) IR49830 (Sub1) IR42 Samba IR42 Samba Xu et al., Nature 2006; Slide Courtesy of D. Mackill Sub1 is sufficient to confer tolerance to nearly all intolerant varieties (3-5 fold yield increase) New Sub1 lines after 17 days submergence in IRRI field
  24. Chen et al; In prep Xu et al., Nature. 2006 Fukao et al, 2006. Plant Cell 18: 2021-2034 ethanolic fermentation genes Submergence GA Ethylene Sub1ASub1C RAmy3D α-expansins Sus3 Pdc2 Pdc4 Adh1 Adh2 Cell elongation & carbohydrate breakdown } ethanolic fermentation genes The Sub1 locus activates a “hold your breath” strategy that conserves the shoot meristem and energy reserves until the flood subsides SBP
  25. New Tools for Genetic Analysis
  26. Arabidopsis genome sequence: 2000: 7 years, $70 million, 500 people 2017: 4 days, $1K Whole Genome Sequencing/Gene Discovery D’Hont et al., 2012
  27. Nipponbare Kitaake Fast neutron irradiation Sequenced 1504 mutants M2M1 M3 10,000 seeds 7,000 lines Storage Li et al., 2017, Plant Cell, In Press and BioRxiv Li et al., 2016, Molecular Plant Creation of a sequenced rice mutant population for forward and reverse genetics
  28. 1504 lines sequenced (45 fold coverage) 91,513 mutations affecting 32,307 genes 58% of all rice genes affected Li et al., 2017, Plant Cell
  29. GENOME-WIDE DISTRIBUTION OF FN-INDUCED MUTATIONS FN-induced mutations are distributed evenly across the genome.
  30. MUTATIONS AND AFFECTED GENES 33 SBS: single base substitutions; DEL: deletions; INS: insertions; INV: inversions; TRA: translocations; and DUP: tandem duplications. Deletions mutate the greatest number of genes.
  31. http://www.inetbio.org/ricenet/. Computational biology identifies genes and networks controlling valuable agronomic traits Linkage of ~70% of the 41,203 rice genes 50 million data points; 5 species
  32. 35 Iden6fica6on of a gene networks predicted to control the rice stress responses Lee, Marcoce and Ronald. 2011. PNAS Lee et al., 2015, NAR
  33. WT(ubi-Xa21) Mutant Identification for a rice mutant displaying deep primary roots using 3D phenotypic and genetic cosegregation analysis Images: Kevin Lehner (Benfey Lab) Topp et al., PNAS 2013
  34. How do you Know Foods with New Genes are Safe to Eat?
  35. Andrew Campbell Fake News Plagues Ag and Food
  36. Where do farmers get their seeds? The UC Davis Institute for Food & Agricultural Literacy Gluten probably won’t kill you and a gluten-free diet probably won’t either
  37. • Plant crops with enhanced resilience to the changing climate • Enhance food security and nutri6on • Support farmers and rural communi6es • Keep food affordable • Foster soil fer6lity, biodiversity and ecologically based farming prac6ces Goals of sustainable agriculture
  38. Collaborators Dave Macill, Kenong Xu (UC Davis/IRRI) Jürg Felix, Hubert Kalbacher, Markus Albert (University of Tübingen, Germany) Youssef Belkhadir (Gregor Mendel Institute, Austria) C Petzold, L Chan (JBEI/LBNL Berkeley, USA) K Lehner, P Benfey (Duke University) Jose Dinneny and Wei Feng (The Carnegie Institute of Plant Biology, USA) E Marcotte, Michelle Robinson and Jenny Brodbelt (UT Austin, USA) Insuk Le (Yonsei University) Xiang Li and Chang Liu (UC Irvine) Ronald Lab Anna Joe Mawsheng Chern Rory Pruitt Guotian Li Ben Schwessinger Nick Thomas Furong Liu DeeDee Luu Tsung Chi Chen Rashmi Jain Tony Wei Daniel Caddell Randy Ruan Weiguo Zhang Shannon Albers
Advertisement