Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Introduccion a la BioInformatica | BioInformaticsGRX

131 views

Published on

¿Que es la BioInformatica? Es una disciplina técnica-cientifica que abarca muchos tipos de areas, donde toman principal importancia, la biología, la ingieneria informatica y las matematicas, etc... Nuestra comunidad en su circulo de charlas introductorias personalizadas para nuestro publico expande el conocimiento sobre todo lo que ofrece la BioInfo para la sociedad.

Published in: Education
  • Be the first to comment

  • Be the first to like this

Introduccion a la BioInformatica | BioInformaticsGRX

  1. 1. Bioinformática #BioInfGRX
  2. 2. ¿Qué es la bioinformática? La bioinformática es la aplicación de tecnologías computacionales a la gestión y análisis de datos biológicos. El término se acuñó en 1970 por Paulien Hogeweg y Ben Hesper 2/67
  3. 3. ÁCIDOS NUCLÉICOS 3/67
  4. 4. ¿Qué es el ADN? 4/67
  5. 5. De ADN a proteína 5/67
  6. 6. De ADN a proteína 6/67
  7. 7. 7/67 De ADN a proteína
  8. 8. 8/67
  9. 9. El código genético es degenerado 9/67
  10. 10. 10/67
  11. 11. De ADN a proteína 11/67
  12. 12. Campos de aplicación de la Bioinformática ▶ Medicina y medicina preventiva ▶ Microbiología ▶ Desarrollo de fármacos ▶ Resistencia antibiótica ▶ Biotecnología ▶ Agricultura ▶ Veterinaria ▶ Análisis forenses ▶ Muchas otros 12/67
  13. 13. Formas de aplicación de la Bioinformática Genómica Proteómica Transcriptómica Metabolómica 13/67
  14. 14. Ejemplo Molde de ADN: 5’-ATGAAGTTTGGCACTTAA-3’ 3’-TACTTCAAACCGTGAATT-5’ 14/67
  15. 15. Ejemplo: Mioglobina Secuencia: GAGCATGTTGGCCTGGTCCTTTG CTAGGTACTGTAGAGCAGGTGAG AGAGTGAGGGGGAAGGACTCCAA ATTAGACCAGTTCTTAGCCATGAA GCAGAGACTCTGAAGCCAGACTA CCTGGGTCCCAATCTTGGGCTTG GTATTTCCTCGCTGTGTGACTCTG GGTAAGTTACTTAACTTCTCTGTG CCTCAGTTCTCTCAAGTGTAAA... Aminoácidos: MGLSDGEWQLVLNVWGKVEADIPG HGQEVLIRLFKGHPETLEKFDKFKHL ... 15/67
  16. 16. Ejemplo: Mioglobina 16/67
  17. 17. Matemáticas #BioinformaticsGRX
  18. 18. Alguien tendrá que traducir los requerimientos biológicos en un lenguaje entendible para la máquina 18/67
  19. 19. 19/67
  20. 20. Multitud de herramientas matemáticas a nuestra disposición. ▶ Geometría diferencial ▶ Análisis ▶ Teoría de nudos ▶ Probabilidad y estadística ▶ Álgebra y álgebra abstracta 20/67
  21. 21. 1. Empecemos por lo básico.
  22. 22. ¿Cómo representamos el código genético? 22/67 Claves ▶ Simetrías ▶ Matrices ▶ Código degenerado ▶ Inmunidad al ruido
  23. 23. Una posible idea: Discernir subconjuntos dentro del código genético y utilizar con ellos lenguaje binario: 23/67
  24. 24. Aprovechar los algoritmos existentes: 24/67 Si denominamos : Como el Kernel de la familia de matrices, inmediatamente podemos establecer una conexión con nuestro código genético: ▶ Matrices de Hadamard y producto de Kronecker:
  25. 25. 25/67
  26. 26. 26/67
  27. 27. 2. Alineación
  28. 28. Bases Una alineación entre dos (o más) secuencias es una comparación entre los componentes de cada secuencia. El análisis básico de secuencias consiste en preguntar si hay dos o más secuencias relacionadas. Una verdadera alineación de las secuencias biológicas es aquella que refleja la relación evolutiva entre dos o más secuencias que comparten un antepasado común antepasado común. 28/67
  29. 29. Bases La base de la alineación y el análisis de la secuencia se basa en el hecho de que las secuencias biológicas se desarrollan a partir de secuencias preexistentes en lugar de ser inventado por la naturaleza desde el principio. 29/67 A esto debemos añadirle tres fenómenos principales: ▶ Mutaciones puntuales ▶ Inserciones ▶ Delecciones
  30. 30. Bases Además de los conceptos biológicos, debemos hacernos preguntas específicas con las que deberemos trabajar, y de las que dependerá nuestro método: ▶ ¿Qué tipo de alineamiento estamos buscando? ▶ ¿Qué puntuación aplicamos al alineamiento? ▶ ¿Qué algoritmo desarrollamos de forma óptima para llevar nuestro método a la máquina? ▶ ¿Cuál es la significación estadística de nuestro resultado? 30/67
  31. 31. 31/67 Alineamiento global: las secuencias se alinean a lo largo de toda su longitud, intentando alinear secuencias completas ● Se introducen huecos para igualar las longitudes de secuencia ● Útil para secuencias muy parecidas y de longitud similar Alineamiento local: sólo se alinean la partes más parecidas de la secuencia ● Favorece encontrar patrones similares dentro de la secuencia ● Un alineamiento local es una combinación de muchos alineamientos globales de secuencias cortas.
  32. 32. Siguiente paso: Alineamiento múltiple. 32/67
  33. 33. 3. Análisis de componentes principales
  34. 34. “Principal component analysis (PCA) is a statistical procedure that uses an orthogonal transformation to convert a set of observations of possibly correlated variables into a set of values of linearly uncorrelated variables called principal components (or sometimes, principal modes of variation)” Definición: 34/67
  35. 35. Existen dos formas básicas de aplicar el ACP: 1. Método basado en la matriz de correlación, cuando los datos no son dimensionalmente homogéneos o el orden de magnitud de las variables aleatorias medidas no es el mismo. 2. Método basado en la matriz de covarianzas, que se usa cuando los datos son dimensionalmente homogéneos y presentan valores medios similares. Formas básicas: 35/67
  36. 36. Caso particular: Correlación 36/67 http://setosa.io/ev/principal-component-analysis/
  37. 37. Drug discovery Mathematical models can help discover new drug targets. •Network-based modeling can reveal promising single or combinatorial drug targets. •Multiscale modeling can identify drug targets across different scales. •Interdisciplinary research is necessary to advance in drug discovery. 37/67
  38. 38. Multitud de herramientas matemáticas a nuestra disposición. ▶ Geometría diferencial ▶ Análisis ▶ Teoría de nudos ▶ Probabilidad y estadística ▶ Álgebra y álgebra abstracta 38/67
  39. 39. Informática Bioinformática
  40. 40. 40/67 Illumina MiSeq
  41. 41. 41/67 ¡Ups!
  42. 42. 42/67 ¿Qué recursos tenemos?
  43. 43. 43/67
  44. 44. 44/67 https://bioinf.comav.upv.es/courses/linux/presentacion_del_curso.html
  45. 45. ¿Qué podemos hacer? ▶ Programar ▶ Utilizar plataformas fiables y potentes 45/67
  46. 46. ¿Qué podemos hacer? ▶ Aprender a dar órdenes al ordenador con total libertad ▶ Utilizar plataformas fiables y potentes 46/67
  47. 47. Otros sistemas operativos 47/67 https://es.wikipedia.org/wiki/GNU/Linux
  48. 48. ¿Programar?
  49. 49. 49
  50. 50. 50
  51. 51. ¿Cuál? 51/67
  52. 52. ¿Python?
  53. 53. 53/67
  54. 54. ¿Por qué Python? ▶ Tiene una sintaxis sencilla ▶ Viene con bibliotecas por defecto con muchas tareas comunes ▶ Es libre ▶ Es interpretado ▶ Es muy utilizado (también en la comunidad científica) 54/67
  55. 55. Sintaxis sencilla Código en Python print("Hola mundo") Código en C #include <stdio.h> int main(void) { printf("Hello, World!n"); return 0; 55/67
  56. 56. Consola o intérprete 56/67
  57. 57. https://repl.it/languages/python3 57/67
  58. 58. OpenSource - www.python.org 58/67
  59. 59. Ranking de lenguajes según IEEE en 2017 59/67 https://stackoverflow.blog/2017/09/06/incredible-growth-python/
  60. 60. Predicción de tráfico en stack overflow 60/67 https://stackoverflow.blog/2017/09/06/incredible-growth-python/
  61. 61. http://biopython.org/ 61/67
  62. 62. Un ejemplito 62/67 dna = 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAA' nt = ['A', 'C', 'G', 'T'] for n in nt: nt_total = dna.count(n) print('{}: {}'.format(n, nt_total))
  63. 63. ¿Puedo tener más interactividad? 63/67
  64. 64. http://jupyter.org/ ▶ Interactividad ▶ Más lenguajes (+40): R, Perl, Octave… ▶ Compartir notebooks ▶ Incrustar imágenes, vídeos y componentes para manipular los datos 64/67
  65. 65. https://try.jupyter.org/ 65/67
  66. 66. Compartir y colaborar 66/67
  67. 67. Aplicación ▶ Libros ▶ Cursos ▶ Talleres 67/67
  68. 68. https://www.anaconda.com/distribution/ 68/67
  69. 69. Compartir y Colaborar Ciencia abierta
  70. 70. Artículo abierto sobre RNA http://nbviewer.jupyter.org/github/maayanlab/Zika-RNAseq-Pipeline/blob/master/Zika.ipynb 70/67
  71. 71. Ejercicios resueltos de Rosalind https://github.com/ciherraiz/bioinformatics/blob/master/rosalind.ipynb 71/67
  72. 72. ¡Muchas gracias! t.me/bioinformaticsGRX @bioinfGRX https://github.com/bioinformaticsGRX bioinformaticsgrx.slack.com (con invitación) Dónde encontrarnos Déjanos tu opinión: https://tinyurl.com/yc58omy7 @bioinfGRX bioinformaticsgrx@gmail.com

×