Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

CMB Final Presentation

237 views

Published on

  • If we are speaking about saving time and money this site ⇒ www.WritePaper.info ⇐ is going to be the best option!! I personally used lots of times and remain highly satisfied.
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • Be the first to like this

CMB Final Presentation

  1. 1. APPLYING MOLECULAR TECHNOLOGY TO MAP THE CONNECTOME
  2. 2. HOW CAN WE USE NEW VISUALIZATION TECHNOLOGY TO BETTER OUR UNDERSTANDING OF NEURAL CONNECTIONS AND THE CONNECTOME?
  3. 3. THE BRAIN INITIATIVE National Institutes of Health (NIH) Food and Drug Administration (FDA) National Science Foundation (NSF) Defense Advanced Research Projects Agency (DARPA) ● Set to begin in 2016 ● $4.5 Billion over 10 years
  4. 4. CIRCUITRY MAPPING IMPLICATIONS Nearly 1 in 6 of the world’s population suffer from neurological disorders “As humans, we can identify galaxies light years away and we can study particles smaller than an atom, but we still haven’t unlocked the mystery of the 3 lbs of matter that sits between our ears” - President Barack Obama on the BRAIN Initiative
  5. 5. ● Neurons: cells in the nervous system ● Action Potential: an electrical impulse sent through neurons to transmit information ● Synapse: the connection between neurons ● Axon: the projection that carries the electrical impulse NEURON STRUCTURE AND FUNCTION
  6. 6. SPINAL CORD DEVELOPMENT Growth cones respond to navigational cues
  7. 7. WHAT CAUSES CELL DIFFERENTIATION All organisms contain the same genes or “building blocks” Cell differentiation happens as a product of the regulation of genes The regulation of genes is controlled by non-coding regions These non-coding regions switch on genes that give cells their unique identity
  8. 8. EVOLUTIONARILY CONSERVED REGULATORY ELEMENTS Only 1-3% of the DNA sequence is coding regions A non-coding DNA region that can act as a “gene switch” for a coding region of DNA ECR:
  9. 9. LOOKING AT TISSUES Tested ECRs using a blue reporter gene Screening to identify the purpose of ECRs in the gene These ECRs were recorded in a database Mouse embryo
  10. 10. ● A database that contains information on noncoding fragments of DNA ● This provides a database for scientists to identify tissue specific sequences ● Aided in our selection of ECR ● Our experiment is a secondary screening on the selected ECR
  11. 11. BIOLUMINESCENCE VS. FLUORESCENCE Bioluminescence - light produced chemically by an organism Different organisms use different biochemical strategies to emit light Fluorescence - organisms take in light and reemit it at a lower wavelength The emitted light is only visible when the stimulating source is present
  12. 12. ● GFP is a small protein and biological marker that is visible in living tissues ● GFP takes in blue light and emits green light GFP:GREEN FLUORESCENT PROTEIN GFP was derived from the “Crystal Jellyfish”
  13. 13. WHY GFP? ● GFP does not need another cofactor to fluoresce ● Relatively small ● If we can trick the neurons into producing these proteins all we would need is a stimulating light ● Easy for in lab use
  14. 14. ECR SPECIFICS The ECR selected is active in this region ECR was tied to reporter gene, expressing blue Using our transgene, we can see the entire neuron in more detail
  15. 15. EXPERIMENTAL OVERVIEW Transgene that includes ECR and the GFP A plasmid was used to transfer the gene into chicken embryos The transgene will illuminate specific neurons in the neural tube using the GFP
  16. 16. GFP reporter gene minimal promoterECRtransgen e Plasmid Configuration
  17. 17. PCR is the method of amplifying our ECR sequence through the variation of temperatures to achieve... 1. Denaturation 2. Annealing 3. Elongation REPLICATING THE ECR
  18. 18. ECR VERIFICATION Gel electrophoresis was used to confirm the length of the ECR A DNA Ladder was used to show known fragments so we can identify the length of ours
  19. 19. 2.0 kb 1.5 kb 1 kb DNA Ladder ECR 1% Agarose/TAE Gel 1.8 kb Confirming the ECR sequence length
  20. 20. SEPARATING AND PURIFYING ECR We cut the ECR band out of the gel and began the ECR purification process We purified our ECR using a silica matrix to bind the DNA to it and remove the unwanted waste
  21. 21. MAKING DNA PUZZLE PIECES We used restriction enzymes to create “sticky ends” at the ends of the ECR This allows for the insertion of the ECR into the plasmid which has the complementary “sticky ends” GGCGCGCCTAACGAATCCGATGGTTAATTAA CCGCGCGGATTGCTTAGGCTACCAATTAATT PacIAscI CGCGCCTAACGAATCCGATGGTTAAT GGATTGCTTAGGCTACCAAT
  22. 22. Plasmid ECR
  23. 23. 2.0 kb 1.5 kb 1 kb DNA Ladder ECR Fragment 1% Agarose/TAE Gel 1.8 kb Purifying the ECR after making “sticky ends”
  24. 24. INSERTING THE ECR INTO THE PLASMID Added a binding agent to the ECR and plasmid so we could seal the “sticky ends” through incubation.
  25. 25. AMPLIFYING THE PLASMID
  26. 26. PLASMID GROWTH & PURIFICATION Selected colonies were incubated to replicate the plasmid Bacteria cells were burst open using special buffer Purified and isolated the plasmid DNA Added restriction enzymes to some of the purified DNA E. coli colonies containing the transgene
  27. 27. 2.0 kb 1.5 kb 1 kb DNA Ladder Plasmid 1% Agarose/TAE Gel ECR: 1.8 kb 1 2
  28. 28. SCIENTIFIC MODELS Our model system in this experiment was the nervous system or more specifically the developing spinal cord Our model organism was the chicken (Gallus gallus) Fruit flyRoundwormChickenZebrafish
  29. 29. WHAT DID WE DO? Insert transgene containing a specific ECR into the chick embryo’s developing spinal cord using electroporation Examine the embryonic spinal cord and visualize the neurons that expressed the GFP reporter
  30. 30. INJECTION OF THE TRANSGENE Two students injecting chick embryos A student injection of the transgene into a chick embryo
  31. 31. membrane video and injection video
  32. 32. GETTING DNA INTO CELLS In order to properly transform the transgene into the chick embryos, a process called in ovo electroporation was used
  33. 33. Students removing the spinal cord from the chick embryo to analyze select neurons
  34. 34. VISUALIZING THE NEURAL TISSUE A dissected neural tube that will soon be cut and prepared for microscopic visualization
  35. 35. COMPARISON vs. comparison picture
  36. 36. ECRS IN GENE MANIPULATION An ECR, or a gene switch, will be active within a specific population of neurons We can target specific neurons and “knock out” receptors in them Through mutated receptors we can see the responses to specific cues
  37. 37. CONNECTOME
  38. 38. IMPORTANCE OF DATABASES In order for scientists to learn from each other, a collection of work needs to be established Bioinformatics is the field that creates applications and softwares for the safekeeping of biological data
  39. 39. Thank you Ralph and Linda for a once in a lifetime experience!

×