Brad Porter  Lecture: Introduction to PCR &  Analysis of Gene Expression Using RT-PCR  Fri, June 15, 2007 11:00 – 11:50 AM 
Briefly, what is PCR?
http://www.sumanasinc.com/webcontent/anisamples/molecularbiology/pcr.html Polymerase Chain Reaction DNA Denatures at 94 °C...
How was PCR discovered?
PCR originates from DNA sequencing. So, lets first  review DNA sequencing.
37°C Extension New DNA strand is created Sequencing is performed by DNA replication Primer 3’ 5’ 5’ 3’ Primer Anneals &  D...
TACGTACGTACG ???????????????????????????????? 5’ Primer 3’ DNA Pol. dNTPs (or bases) are being added, but we do not know t...
What if DNA extension could be terminated at a known nucleotide using a  mixture  of normal bases and  termination bases T...
dATP dGTP dCTP dTTP+ dATP dGTP dCTP+ dTTP dATP dGTP+ dCTP dTTP DNA What if four reactions were set up to stop at each nucl...
TACGTACGTACG  5’ Primer TACGTACGTACG  G 5’ Primer T Normal base gets incorporated ATGCATGCATGC????????????????????????????...
TACGTACGTACG T  5’ Primer TACGTACGTACG T  TAC 5’ Primer G Normal base gets incorporated ATGCATGCATGC??????????????????????...
TACGTACGTACG TGTA 5’ Primer ATGCATGCATGC???????????????????????????????????? 3’ 5’ DNA Pol. C
TACGTACGTACG ??? 5’ TACGTACGTACG ? 5’ TACGTACGTACG ???? 5’ TACGTACGTACG ?? 5’ A TACGTACGTACG ?????? 5’ A TACGTACGTACG ????...
TACGTACGTACG ???? 5’ 5’ 3’ Chain-termination provides sequence!  A TACGTACGTACG ??? 5’ TACGTACGTACG ?????? 5’ A TACGTACGTA...
What causes chain termination? D i d e o x y n u c l e o s i d e   T r i p h o s p h a t e s dATP dGTP dCTP dTTP+  ddTTP d...
Deoxynucleoside triphosphates Deoxy adenosine triphosphate (dATP) Deoxy guanosine triphosphate (dGTP) Deoxy thymidine trip...
The Sanger Dideoxy sequencing method was the foundation for the discovery of PCR.  PhD 1943   Cambridge University Nobel P...
http://smcg.cifn.unam.mx/enp-unam/03-EstructuraDelGenoma/animaciones/secuencia.swf Dideoxy sequencing, one more time.
Ok, but what is the connection between DNA sequencing and PCR?
1983 Emeryville, California Cetus Corporation  Henry Erlich was working on methods  for detecting  point mutations . 5’-TA...
Kary B. Mullis 5’-TACGTACGTACGA * GGAGTCCGGAATG-3’ CCTCAGGCCTTAC-5’ + Why not do Sanger  sequencing at a single  base pair...
First step to a Nobel Prize: As you think, ignore obvious  problems.
Kary wanted to use total genomic DNA, but he forgot the primer would likely mis-pair and ruin his experiment. In “misguide...
Kary and girlfriend chemist  Jennifer Barnett Mendocino County
+ What if I use two primers for  confirmation? ddTTP ddCTP ddGTP ddATP 3’-ATGCATGCATGCT * CCTCAGGCCTTAC-5’ 5’-GAATTCTACGTA...
+ 3’-ATGCATGCATGCT A CCTCAGGCCTTAC-5’ 5’-GAATTCTACGTACGTACGA T F-long 5’-TACGTACGTACGA T GGAGTCCGGAATG-3’ A CCTCAGGCCTTAC-...
+ 5’-TACGTACGTACGA * GGAGTCCGGAATG-3’ CCTCAGGCCTTAC-5’ R-short dNTP dNTP What about stray nucleotide triphosphates? ddTTP ...
I can destroy stray dNTPs with alkaline phosphatase! But, bacterial alkaline phosphatase  will remain because it cannot be...
Second step to a Nobel Prize: Make up problems that do not exist and try to solve them.
I can deplete nucleotides by adding polymerase first without ddNTP’s dNTP dNTP 3’-ATGCATGCATGCT * CCTCAGGCCTTAC-5’ 5’-GAAT...
Denature and anneal primers Polymerase extension DNA replicated! Anderson Valley Third step to a Nobel Prize.  Recognize P...
NOBEL PRIZE! … ..not so fast
Final step to a Nobel Prize: Try to get someone to listen to you.
“… no one was particularly enthusiastic about it.” 1984 annual Cetus Scientific Meeting…..”nobody seemed to be interested ...
1993 Nobel Prize
So, how is PCR important to your life, right now? Many SNP’s are associated with disease. Do you have a risk allele?
Let’s set up a PCR reaction and find out!
Loci for Type 2 Diabetes and Triglyceride Levels  GCAGCTCACCTCCAGCTTTAGTTTTC [C/T] CATGACAGTAAGTCTATTACCCTCC Risk allele
First, you need to select primers for PCR •  No , you do not need a computer program to select primers. •  I prefer 24 bp ...
Forward Primer Selection  TAAATTCTTTGGAACAGGGGCATGGATTATAAAAGATGTAAGATAATAAAAAGCATTTGTATTTGACTTTGGAATGTATTGTACTTACATTTGTCT...
TAAATTCTTTGGAACAGGGGCATGGATTATAAAAGATGTAAGATAATAAAAAGCATTTGTATTTGACTTTGGAATGTATTGTACTTACATTTGTCTAGAGGTGTGTCTATTCTGGCTATTCT...
AGAACACCATAACCTTTCCGGCCC ATTTTCTTTGTCAATAAGCGTTCTTGCCCTGTCAGCAGCTCACCTCCAGCTTTAGTTTTC X CATGACAGTAAGTCTATTACCCTCCTGATCTGTC...
Forward Primer: 5’-AGAACACCATAACCTTTCCGGCCC-3’ Reverse Primer: 5’-GCGTGAGCCACTGCACCCGACTGG-3’
Forward Primer: 5’-AGAACACCATAACCTTTCCGGCCC-3’ Before ordering:  Imagine the primers annealing to the DNA   Reverse Primer...
Order From IDT Forward Primer: 5’-AGAACACCATAACCTTTCCGGCCC-3’ Reverse Primer: 5’-GCGTGAGCCACTGCACCCGACTGG-3’
H 2 0 28.25 μ l 10XPCR Buffer 5.0 μ l 25mM MgCl 2  3.0 μ l 4mM dNTP’s 2.5 μ l 10pmol Forward Primer  5.0 μ l (10pmol) 10pm...
Use thin-wall tubes designed for PCR  Use thin-wall PCR tubes
Old School “Perkin Elmer 2400” PCR Thermocycler Hot bonnet prevents condensation.
If your thermocycler does not have a hot bonnet or if you will need to open the hot bonnet to remove or modify a reaction,...
Runs on antifreeze and refrigerant Paper towels to adsorb leaking orange-colored antifreeze.
Antifreeze
R134a frigerant
Radiator & fan
New Thermocyclers =  Peltier Cooling  &  Gradient Blocks Peltier effect  It occurs when a current is passed through two di...
A typical PCR thermocycling program
Gradient thermocyclers allow for optimization  of the annealing temperature 55°C 62°C 61°C 60°C 59°C 58°C 57°C 56°C
What is RT-PCR? Reverse Transcription-  Polymerase Chain Reaction
RT-PCR is like any other PCR except it uses cDNA as a template.
How do you make cDNA? cDNA can be created  from RNA using RNA-dependent DNA  polymerase (reverse transcriptase)
How do you make cDNA? mRNA AAAAAAAAAAAA 5’- -3’ TTTTTTTTTTTT -5’ cDNA Reverse transcriptase Oligo (dT) Primer Template For...
RT-PCR measures the presence of cDNA corresponding to  its respective RNA. RT-PCR is, therefore, used to indirectly  estim...
Major Points  •  Sequencing and PCR both use DNA polymerase and  replicate DNA (PCR uses TAQ DNA polymerase). •  Kary Mull...
Upcoming SlideShare
Loading in …5
×

Introduction to PCR and analysis of gene expression using RT-PCR

4,906 views

Published on

Introduction to PCR and analysis of gene expression using RT-PCR

  1. 1. Brad Porter Lecture: Introduction to PCR & Analysis of Gene Expression Using RT-PCR Fri, June 15, 2007 11:00 – 11:50 AM 
  2. 2. Briefly, what is PCR?
  3. 3. http://www.sumanasinc.com/webcontent/anisamples/molecularbiology/pcr.html Polymerase Chain Reaction DNA Denatures at 94 °C Target DNA Primers anneal to single stranded DNA ~55 °C Thermostable TAQ polymerase extends primers at ~72°C 5’ 3’ 5’ 3’ Target DNA is doubled. Cycle is then repeated.
  4. 4. How was PCR discovered?
  5. 5. PCR originates from DNA sequencing. So, lets first review DNA sequencing.
  6. 6. 37°C Extension New DNA strand is created Sequencing is performed by DNA replication Primer 3’ 5’ 5’ 3’ Primer Anneals & DNA Polymerase Adds Deoxynucleoside triphosphates
  7. 7. TACGTACGTACG ???????????????????????????????? 5’ Primer 3’ DNA Pol. dNTPs (or bases) are being added, but we do not know the sequence. ATGCATGCATGC???????????????????????????????????? 3’ 5’ TACGTACGTACG ATGCATGCATGC???????????????????????????????????? 3’ 5’ 5’ Primer 3’ DNA Pol. ATGCATGCATGC???????????????????????????????????? 3’ 5’
  8. 8. What if DNA extension could be terminated at a known nucleotide using a mixture of normal bases and termination bases TACGTACGTACG TGT 5’ Primer A TACGTACGTACG TGT CG 5’ Primer A Normal base gets incorporated By probability termination will occur at every “A” ATGCATGCATGC???????????????????????????????????? 3’ 5’ DNA Pol. ATGCATGCATGC???????????????????????????????????? 3’ 5’ DNA Pol. A
  9. 9. dATP dGTP dCTP dTTP+ dATP dGTP dCTP+ dTTP dATP dGTP+ dCTP dTTP DNA What if four reactions were set up to stop at each nucleotide? dATP+ dGTP dCTP dTTP A T G C
  10. 10. TACGTACGTACG 5’ Primer TACGTACGTACG G 5’ Primer T Normal base gets incorporated ATGCATGCATGC???????????????????????????????????? 3’ 5’ DNA Pol. T ATGCATGCATGC???????????????????????????????????? 3’ 5’ DNA Pol. T
  11. 11. TACGTACGTACG T 5’ Primer TACGTACGTACG T TAC 5’ Primer G Normal base gets incorporated ATGCATGCATGC???????????????????????????????????? 3’ 5’ DNA Pol. G ATGCATGCATGC???????????????????????????????????? 3’ 5’ DNA Pol. G
  12. 12. TACGTACGTACG TGTA 5’ Primer ATGCATGCATGC???????????????????????????????????? 3’ 5’ DNA Pol. C
  13. 13. TACGTACGTACG ??? 5’ TACGTACGTACG ? 5’ TACGTACGTACG ???? 5’ TACGTACGTACG ?? 5’ A TACGTACGTACG ?????? 5’ A TACGTACGTACG ??????? 5’ TACGTACGTACG ????? 5’ G G TACGTACGTACG ??????? 5’ C TACGTACGTACG ??????? 5’ T T TACGTACGTACG 5’ TACGTACGTACG ??????? 5’
  14. 14. TACGTACGTACG ???? 5’ 5’ 3’ Chain-termination provides sequence! A TACGTACGTACG ??? 5’ TACGTACGTACG ?????? 5’ A TACGTACGTACG ????? 5’ G G TACGTACGTACG ? 5’ TACGTACGTACG ?? 5’ T T TACGTACGTACG 5’ C TACGTACGTACG ??????? 5’
  15. 15. What causes chain termination? D i d e o x y n u c l e o s i d e T r i p h o s p h a t e s dATP dGTP dCTP dTTP+ ddTTP dATP dGTP dCTP+ ddCTP dTTP dATP dGTP + ddGTP dCTP dTTP dATP + ddATP dGTP dCTP dTTP
  16. 16. Deoxynucleoside triphosphates Deoxy adenosine triphosphate (dATP) Deoxy guanosine triphosphate (dGTP) Deoxy thymidine triphosphate (dTTP) Deoxy cytidine triphosphate (dCTP) Chain Termination 3’ 5’ DNA Polymerase Lacks a 3’ hydroxyl group. Acts as a terminator because, once incorporated, no other nucelotide can be added. X 3’ 5’ DNA Polymerase Dideoxynucleoside triphosphates Dideoxy adenosine triphosphate (ddATP) Dideoxy guanosine triphosphate (ddGTP) Dideoxy thymidine triphosphate (ddTTP) Dideoxy cytidine triphosphate (ddCTP) Chain Extension
  17. 17. The Sanger Dideoxy sequencing method was the foundation for the discovery of PCR. PhD 1943 Cambridge University Nobel Prize In Chemistry 1958 Amino acid sequence of insulin Nobel Prize In Chemistry 1980 Sequenced the first genome, phage Φ-X174, by hand using a method that he developed. Frederick Sanger
  18. 18. http://smcg.cifn.unam.mx/enp-unam/03-EstructuraDelGenoma/animaciones/secuencia.swf Dideoxy sequencing, one more time.
  19. 19. Ok, but what is the connection between DNA sequencing and PCR?
  20. 20. 1983 Emeryville, California Cetus Corporation Henry Erlich was working on methods for detecting point mutations . 5’-TACGTACGTACGA * GGAGTCCGGAATG-3’ A? T? G? C?
  21. 21. Kary B. Mullis 5’-TACGTACGTACGA * GGAGTCCGGAATG-3’ CCTCAGGCCTTAC-5’ + Why not do Sanger sequencing at a single base pair? ddTTP ddCTP ddGTP ddATP
  22. 22. First step to a Nobel Prize: As you think, ignore obvious problems.
  23. 23. Kary wanted to use total genomic DNA, but he forgot the primer would likely mis-pair and ruin his experiment. In “misguided puttering”, Kary kept thinking! CCTCAGGCCTTAC-5’ CCTCAGGCCTTAC-5’ CCTCAGGCCTTAC-5’ CCTCAGGCCTTAC-5’
  24. 24. Kary and girlfriend chemist Jennifer Barnett Mendocino County
  25. 25. + What if I use two primers for confirmation? ddTTP ddCTP ddGTP ddATP 3’-ATGCATGCATGCT * CCTCAGGCCTTAC-5’ 5’-GAATTCTACGTACGTACGA F-long 5’-TACGTACGTACGA * GGAGTCCGGAATG-3’ CCTCAGGCCTTAC-5’ R-short
  26. 26. + 3’-ATGCATGCATGCT A CCTCAGGCCTTAC-5’ 5’-GAATTCTACGTACGTACGA T F-long 5’-TACGTACGTACGA T GGAGTCCGGAATG-3’ A CCTCAGGCCTTAC-5’ R-short F-long R-short ddTTP ddCTP ddGTP ddATP
  27. 27. + 5’-TACGTACGTACGA * GGAGTCCGGAATG-3’ CCTCAGGCCTTAC-5’ R-short dNTP dNTP What about stray nucleotide triphosphates? ddTTP ddCTP ddGTP ddATP 3’-ATGCATGCATGCT * CCTCAGGCCTTAC-5’ 5’-GAATTCTACGTACGTACGA F-long
  28. 28. I can destroy stray dNTPs with alkaline phosphatase! But, bacterial alkaline phosphatase will remain because it cannot be heat killed. It will destroy the ddNTP’s (not true).
  29. 29. Second step to a Nobel Prize: Make up problems that do not exist and try to solve them.
  30. 30. I can deplete nucleotides by adding polymerase first without ddNTP’s dNTP dNTP 3’-ATGCATGCATGCT * CCTCAGGCCTTAC-5’ 5’-GAATTCTACGTACGTACGA F-long 5’-TACGTACGTACGA * GGAGTCCGGAATG-3’ CCTCAGGCCTTAC-5’ R-short
  31. 31. Denature and anneal primers Polymerase extension DNA replicated! Anderson Valley Third step to a Nobel Prize. Recognize PCR when you find it. 1 Copy 2 Copies!
  32. 32. NOBEL PRIZE! … ..not so fast
  33. 33. Final step to a Nobel Prize: Try to get someone to listen to you.
  34. 34. “… no one was particularly enthusiastic about it.” 1984 annual Cetus Scientific Meeting…..”nobody seemed to be interested in my poster….” “People would glance at it and keep walking.” At first, people did not get it. Then Joshua Lederberg (also a Nobel Laureate) said: “ Why didn’t I think of that?”
  35. 35. 1993 Nobel Prize
  36. 36. So, how is PCR important to your life, right now? Many SNP’s are associated with disease. Do you have a risk allele?
  37. 37. Let’s set up a PCR reaction and find out!
  38. 38. Loci for Type 2 Diabetes and Triglyceride Levels GCAGCTCACCTCCAGCTTTAGTTTTC [C/T] CATGACAGTAAGTCTATTACCCTCC Risk allele
  39. 39. First, you need to select primers for PCR • No , you do not need a computer program to select primers. • I prefer 24 bp long and end on G or C • Others prefer 20 bp long and end on A or T • Try to have at least 50% G’s +C’s to ensure reasonable annealing temperature That’s about it. Do not waste too much time selecting primers.
  40. 40. Forward Primer Selection TAAATTCTTTGGAACAGGGGCATGGATTATAAAAGATGTAAGATAATAAAAAGCATTTGTATTTGACTTTGGAATGTATTGTACTTACATTTGTCTAGAGGTGTGTCTATTCTGGCTATTCTCTTTAAAGGAGCCATTCTATCGTGAACAGATCCTGTTGGAGCTGTTTTCTTGTTCTACCAACCTTCAGCCACCTCTCTGTCTTTCATATTACTTATTGGCAGGGTTTCAAAAGGTTTTAGTCCTTACTTAATATAAACAAAAATGTACAATATTGACAAAGTTTCAGTTAAGCAGATGAAATTCTAAGAGTTAAGCTGGGATTTTCCAAAATAATCCTGTTAACAGACTTGAAAGCACTTATCAGTTCTGTCTAATGAAGACATT AGAACACCATAACCTTTCCGGCCC ATTTTCTTTGTCAATAAGCGTTCTTGCCCTGTCA GCAGCTCACCTCCAGCTTTAGTTTTC X CATGACAGTAAGTCTATTACCCTCC TGATCTGTCTTCTGGCTCCTCCTACCCAGGATGGGGAAGGTTTTTGACTTTACTGATATTCTCAGAACAAATTTTGGGAAGTAAATATAAGGTTTTCCAGTCGGGTGCAGTGGCTCACGCCTATGATCCCAGCGCTTTGGGAAACCAAGGTGGGTGGATCACCTGAGGTCAGGAGTTTGAGACCAGCTTGGCCAATAAGGTGAAACCCCATCTCTACAAAAATTAGTTGGGCGTGGTGGCGGCACCTGTAAATCCAGCTACTCAGGAGGCTGAGGCAAGAGGATTGCTTGAATCTGGGAGCCGGAGGTTGAAGTGAACTGAGATTGGGCCACTGCATTCTAGCCTGGGCGACAAGAGTGAAGCTCCATCTCAAAAAAAAAAAAAAAGATGAGGTTTTCCTTAAGAGCACTAACCTAGTATACTGCACAGGTGCCTGTATTCATGCATCCCACACAGAAAGAGAAAATACTTGTCTGAACTTGTCCATAAATTCAGAATCCTGCCCCTTAAC Forward Primer: 5’-AGAACACCATAACCTTTCCGGCCC-3’
  41. 41. TAAATTCTTTGGAACAGGGGCATGGATTATAAAAGATGTAAGATAATAAAAAGCATTTGTATTTGACTTTGGAATGTATTGTACTTACATTTGTCTAGAGGTGTGTCTATTCTGGCTATTCTCTTTAAAGGAGCCATTCTATCGTGAACAGATCCTGTTGGAGCTGTTTTCTTGTTCTACCAACCTTCAGCCACCTCTCTGTCTTTCATATTACTTATTGGCAGGGTTTCAAAAGGTTTTAGTCCTTACTTAATATAAACAAAAATGTACAATATTGACAAAGTTTCAGTTAAGCAGATGAAATTCTAAGAGTTAAGCTGGGATTTTCCAAAATAATCCTGTTAACAGACTTGAAAGCACTTATCAGTTCTGTCTAATGAAGACATTAGAACACCATAACCTTTCCGGCCCATTTTCTTTGTCAATAAGCGTTCTTGCCCTGTCA GCAGCTCACCTCCAGCTTTAGTTTTC X CATGACAGTAAGTCTATTACCCTCC TGATCTGTCTTCTGGCTCCTCCTACCCAGGATGGGGAAGGTTTTTGACTTTACTGATATTCTCAGAACAAATTTTGGGAAGTAAATATAAGGTTTT CCAGTCGGGTGCAGTGGCTCACGC CTATGATCCCAGCGCTTTGGGAAACCAAGGTGGGTGGATCACCTGAGGTCAGGAGTTTGAGACCAGCTTGGCCAATAAGGTGAAACCCCATCTCTACAAAAATTAGTTGGGCGTGGTGGCGGCACCTGTAAATCCAGCTACTCAGGAGGCTGAGGCAAGAGGATTGCTTGAATCTGGGAGCCGGAGGTTGAAGTGAACTGAGATTGGGCCACTGCATTCTAGCCTGGGCGACAAGAGTGAAGCTCCATCTCAAAAAAAAAAAAAAAGATGAGGTTTTCCTTAAGAGCACTAACCTAGTATACTGCACAGGTGCCTGTATTCATGCATCCCACACAGAAAGAGAAAATACTTGTCTGAACTTGTCCATAAATTCAGAATCCTGCCCCTTAAC Reverse Primer Selection Reverse Primer: 5’-GCGTGAGCCACTGCACCCGACTGG-3’
  42. 42. AGAACACCATAACCTTTCCGGCCC ATTTTCTTTGTCAATAAGCGTTCTTGCCCTGTCAGCAGCTCACCTCCAGCTTTAGTTTTC X CATGACAGTAAGTCTATTACCCTCCTGATCTGTCTTCTGGCTCCTCCTACCCAGGATGGGGAAGGTTTTTGACTTTACTGATATTCTCAGAACAAATTTTGGGAAGTAAATATAAGGTTTT CCAGTCGGGTGCAGTGGCTCACGC Amplified Fragment Will Be 230bp
  43. 43. Forward Primer: 5’-AGAACACCATAACCTTTCCGGCCC-3’ Reverse Primer: 5’-GCGTGAGCCACTGCACCCGACTGG-3’
  44. 44. Forward Primer: 5’-AGAACACCATAACCTTTCCGGCCC-3’ Before ordering: Imagine the primers annealing to the DNA Reverse Primer: 5’-GCGTGAGCCACTGCACCCGACTGG-3’ AGCCACTGCACCCGACTGG-3’  Reverse Primer: 5’-GCGTG TAAATTCTTTGGAACAGGGGCATGGATTATAAAAGATGTAAGATAATAAAAAGCATTTGTATTTGACTTTGGAATGTATTGTACTTACATTTGTCTAGAGGTGTGTCTATTCTGGCTATTCTCTTTAAAGGAGCCATTCTATCGTGAACAGATCCTGTTGGAGCTGTTTTCTTGTTCTACCAACCTTCAGCCACCTCTCTGTCTTTCATATTACTTATTGGCAGGGTTTCAAAAGGTTTTAGTCCTTACTTAATATAAACAAAAATGTACAATATTGACAAAGTTTCAGTTAAGCAGATGAAATTCTAAGAGTTAAGCTGGGATTTTCCAAAATAATCCTGTTAACAGACTTGAAAGCACTTATCAGTTCTGTCTAATGAAGACATT AGAACACCATAACCTTTCCGGCCC ATTTTCTTTGTCAATAAGCGTTCTTGCCCTGTCAGCAGCTCACCTCCAGCTTTAGTTTTC X CATGACAGTAAGTCTATTACCCTCCTGATCTGTCTTCTGGCTCCTCCTACCCAGGATGGGGAAGGTTTTTGACTTTACTGATATTCTCAGAACAAATTTTGGGAAGTAAATATAAGGTTTT CCAGTCGGGTGCAGTGGCTCACGC CTATGATCCCAGCGCTTTGGGAAACCAAGGTGGGTGGATCACCTGAGGTCAGGAGTTTGAGACCAGCTTGGCCAATAAGGTGAAACCCCATCTCTACAAAAATTAGTTGGGCGTGGTGGCGGCACCTGTAAATCCAGCTACTCAGGAGGCTGAGGCAAGAGGATTGCTTGAATCTGGGAGCCGGAGGTTGAAGTGAACTGAGATTGGGCCACTGCATTCTAGCCTGGGCGACAAGAGTGAAGCTCCATCTCAAAAAAAAAAAAAAAGATGAGGTTTTCCTTAAGAGCACTAACCTAGTATACTGCACAGGTGCCTGTATTCATGCATCCCACACAGAAAGAGAAAATACTTGTCTGAACTTGTCCATAAATTCAGAATCCTGCCCCTTAAC 5’-AGAACACCATAACCTTTCCGG CCC-3’ 
  45. 45. Order From IDT Forward Primer: 5’-AGAACACCATAACCTTTCCGGCCC-3’ Reverse Primer: 5’-GCGTGAGCCACTGCACCCGACTGG-3’
  46. 46. H 2 0 28.25 μ l 10XPCR Buffer 5.0 μ l 25mM MgCl 2 3.0 μ l 4mM dNTP’s 2.5 μ l 10pmol Forward Primer 5.0 μ l (10pmol) 10pmol Reverse Primer 5.0 μ l (10pmol) Template DNA >10 4 copies of target sequence (1.0 μ l) TAQ Polymerase 0.25 μ l (5u/ μ l) PCR Components Start Finish
  47. 47. Use thin-wall tubes designed for PCR Use thin-wall PCR tubes
  48. 48. Old School “Perkin Elmer 2400” PCR Thermocycler Hot bonnet prevents condensation.
  49. 49. If your thermocycler does not have a hot bonnet or if you will need to open the hot bonnet to remove or modify a reaction, use mineral oil. Mineral Oil Sample
  50. 50. Runs on antifreeze and refrigerant Paper towels to adsorb leaking orange-colored antifreeze.
  51. 51. Antifreeze
  52. 52. R134a frigerant
  53. 53. Radiator & fan
  54. 54. New Thermocyclers = Peltier Cooling & Gradient Blocks Peltier effect It occurs when a current is passed through two dissimilar metals or semiconductors (n-type and p-type) that are connected to each other at two junctions (Peltier junctions). The current drives a transfer of heat from one junction to the other: one junction cools off while the other heats up; as a result, the effect is often used for thermoelectric cooling . This effect was observed in 1834 by Jean Peltier .
  55. 55. A typical PCR thermocycling program
  56. 56. Gradient thermocyclers allow for optimization of the annealing temperature 55°C 62°C 61°C 60°C 59°C 58°C 57°C 56°C
  57. 57. What is RT-PCR? Reverse Transcription- Polymerase Chain Reaction
  58. 58. RT-PCR is like any other PCR except it uses cDNA as a template.
  59. 59. How do you make cDNA? cDNA can be created from RNA using RNA-dependent DNA polymerase (reverse transcriptase)
  60. 60. How do you make cDNA? mRNA AAAAAAAAAAAA 5’- -3’ TTTTTTTTTTTT -5’ cDNA Reverse transcriptase Oligo (dT) Primer Template For PCR 3’- 3’- mRNA AAAAAAAAAAAA 5’- -3’ TTTTTTTTTTTT -5’
  61. 61. RT-PCR measures the presence of cDNA corresponding to its respective RNA. RT-PCR is, therefore, used to indirectly estimate RNA abundance which MAY indicate the level of gene expression.
  62. 62. Major Points • Sequencing and PCR both use DNA polymerase and replicate DNA (PCR uses TAQ DNA polymerase). • Kary Mullis discovered PCR while thinking about a possible dideoxy sequencing experiment. • Half of a Nobel discovery is finding it, the other half is realizing what you have found. • RT-PCR is used to estimate gene expression

×