Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Abstract <ul><li>Little is known about the reproductive habits of paddlefish, a threatened species in Wisconsin and Minnes...
Sample Preparation <ul><li>Eggs kept on ice until freezing at -80 o C </li></ul><ul><li>Single egg mashed with sterile gla...
Polymerase Chain Reaction (PCR) <ul><li>Mix together... </li></ul><ul><li>Sample DNA </li></ul><ul><li>dNTPs </li></ul><ul...
Sample size vs. PCR product After 30 cycles of amplification the primary DNA product will be the region found between the ...
Cytochrome b DNA Sequences <ul><li>PCR products from paddlefish, shovelnose sturgeon and lake sturgeon were cloned and seq...
Restriction Mapping Restriction enzymes cut DNA at specific sites.  A single change the sequence of that site will prevent...
Restriction Enzyme Digestion <ul><li>Mix together : </li></ul><ul><li>1 ul PCR product </li></ul><ul><li>8 ul buffer and w...
Figure 3.  Restriction digest of PCR products with the restriction enzyme  Hin cII.  Samples were run on a 3% Methaphor ag...
Figure 4.  Restriction digest of PCR products with the restriction enzyme  Nar I .  Samples were run on a 1% LE agarose ge...
Conclusions <ul><li>Enough DNA can be isolated from a single fish egg to allow for sucessful PCR amplification. </li></ul>...
Upcoming SlideShare
Loading in …5

Abstract Little is known about the reproductive habits of ...


Published on

  • Be the first to comment

  • Be the first to like this

Abstract Little is known about the reproductive habits of ...

  1. 1. Abstract <ul><li>Little is known about the reproductive habits of paddlefish, a threatened species in Wisconsin and Minnesota. Biologists studying paddlefish spawning grounds find it difficult to differentiate between the eggs of paddlefish and sturgeon based upon appearance alone. Both species are also threatened by poaching, with their eggs sold as caviar. A PCR based test has been developed to amplify a portion of the cytochrome B gene from a single paddlefish or sturgeon egg. The presence of distinct HincII restriction sites in the paddlefish and shovelnose sturgeon PCR products allows for the rapid determination of whether a single egg came from a paddlefish, shovelnose sturgeon or lake sturgeon. These tests will eventually allow fisheries biologists to better monitor and protect paddlefish spawning habitats. This test may also have forensic applications. </li></ul>
  2. 2. Sample Preparation <ul><li>Eggs kept on ice until freezing at -80 o C </li></ul><ul><li>Single egg mashed with sterile glass rod in 200 ul buffer (20 mM Tris, 20 mM KCl, 0.5% Tween 20, 5% Chelex, 0.2 mg/ml proteinase K) </li></ul><ul><li>Samples incubated 1.5 hours at 55 o C </li></ul><ul><li>Samples incubated 8 minutes at 95 o C </li></ul><ul><li>Samples centrifuged at 14,000 rpm for 10 minutes </li></ul><ul><li>An aliquot was removed for PCR amplification (1 ul) </li></ul>
  3. 3. Polymerase Chain Reaction (PCR) <ul><li>Mix together... </li></ul><ul><li>Sample DNA </li></ul><ul><li>dNTPs </li></ul><ul><li>Buffer </li></ul><ul><li>Taq DNA Polymerase </li></ul><ul><li>PCR Primers </li></ul><ul><li>CBL1 TGATGAAATTTTGGCTCACT </li></ul><ul><li>CBR1 GTGGAAGGCGAAGAATCG </li></ul>95 o C 55 o C 72 o C CBR1 CBL1 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 3’ 5’
  4. 4. Sample size vs. PCR product After 30 cycles of amplification the primary DNA product will be the region found between the two primers. Figure 1. PCR product concentration is affected by the amount of DNA in the sample. Volumes represent ul of egg homogenate. 3’ 5’ 10 u1 1 ul 0.1 ul 0.01 ul 500 bp 400 bp 300 bp 220 bp 200 bp
  5. 5. Cytochrome b DNA Sequences <ul><li>PCR products from paddlefish, shovelnose sturgeon and lake sturgeon were cloned and sequenced. </li></ul>Shovelnose Lake Paddlefish Lake Table 1. Percent DNA Sequence Identity 86.6% 86.0% 90.8%
  6. 6. Restriction Mapping Restriction enzymes cut DNA at specific sites. A single change the sequence of that site will prevent cleavage. Example: Hin cII cuts GTTAAC in paddlefish cyt b DNA but not GTAAAC in sturgeon cyt b DNA PA SN LK Hin cII Hin cII Nar I
  7. 7. Restriction Enzyme Digestion <ul><li>Mix together : </li></ul><ul><li>1 ul PCR product </li></ul><ul><li>8 ul buffer and water </li></ul><ul><li>1 ul restriction enzyme </li></ul><ul><li>Incubate 30 min, 37 o C. </li></ul><ul><li>Subject sample to agarose gel electrophoresis for 45 minutes. </li></ul><ul><li>Stain gel with ethidium bromide and photograph. </li></ul>
  8. 8. Figure 3. Restriction digest of PCR products with the restriction enzyme Hin cII. Samples were run on a 3% Methaphor agarose gel. PA uncut PA cut SN uncut SN cut LK uncut LK cut PS uncut PS cut Stds 500 bp 400 bp 300 bp 220 bp 200 bp
  9. 9. Figure 4. Restriction digest of PCR products with the restriction enzyme Nar I . Samples were run on a 1% LE agarose gel. PA uncut PA cut SN uncut SN cut LK uncut LK cut PS uncut PS cut Stds 500 bp 400 bp 300 bp 220 bp 200 bp
  10. 10. Conclusions <ul><li>Enough DNA can be isolated from a single fish egg to allow for sucessful PCR amplification. </li></ul><ul><li>DNA sequence analysis demosnstrates unique genetic markers in paddlefish, shovelnose sturgeon and lake sturgeon. </li></ul><ul><li>This assay will allow the species identification of a single egg within one day. </li></ul><ul><li>To date this assay has been tested on more than ten fish, from all over the country, with no observed discrepancies in the assay. </li></ul>
