Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Evolution of DNA Methylation - Sylvain Forêt

1,311 views

Published on

Epigenetic regulations are fundamental to the development and health of plants and animals. For instance DNA methylation in mammals is required for normal embryonic development and has been involved in number of diseases such as cancer and diabetes. However, different animal species have widely different DNA methylation landscapes.

Published in: Technology, Education
  • Be the first to comment

  • Be the first to like this

Evolution of DNA Methylation - Sylvain Forêt

  1. 1. Evolution of DNA Methylation Sylvain Forêt Evolution, Ecology and Genetics Research School of Biology
  2. 2. History
  3. 3. The double helix Watson, Crick, Wilkins 1942 1944 DNA is the support of genetic information Avery, MacLeod, McCarty 1953
  4. 4. Epigenetics The double helix Waddington Watson, Crick, Wilkins 1942 1944 DNA is the support of genetic information Avery, MacLeod, McCarty 1953
  5. 5. From Genomes to Cells
  6. 6. AATAATAACGCTATCGGTTATTGTATCATTATTGTATATATTCGTAGTCG GTTTCCGAACGCGAAACGAAACGGACGTGTTTCTCTCTGCTCTCCGAGTA AAGACTTTATCGCTGTGAATAAAATATTATAGTGTAAAAATTTATTAAAT AAAATAAAAATATTGTAGCGTAAAGATTATTAACGAATTTTATAAGTCAT ATAATAAATTCCAATTCCAAGAAGAGGAAATTTTTTAATCTTTAAAATTT TGTAAACTTTGAATCGCTGTATCTCCGAAGATAATAGCGATACCTACGAT TTTCTGATGTGATTGCGATCGGGAAACGTTGCTCTTTCGATTTAATCGTT ATTCCACGTCGAGAACTATCGTTGAAATGAACGCTATCGTTTAAATATGA GAAGAATCTTTGGAATTAAACTTGTGCAAACTTTCGACTGCTGTATCTCC AAAGATACAGTAGCGATATGTACGATTTTTTGAGATAGTTGCGAGCGGGA AACATTGCTCTTTATAATGTGGAAAAGGAAAAATAAAAAACTTAACCAAA TGTAAACGATTAGATCGATTTAAACTGATACTGATAATTGCAATGAAAAT AACCGGAAAATTAAGAAGATAAACGAAAGAAATCTTTGAATCTTTTTTTA CGCGTCTTATAAATTAATAATAATGAAAAAAAAATTAAAAAAAATTAATT ATCGAAAATATTATCGATAAAAAAAAATTAAATCATTAAATTTTAAAGAA ACGAAAAATAACGAAACGAATCTAACGGAGTAATATATTAACGAGTGATA AAATGTAAAAATAAAATGAAAATTAATAATACCTTATGAATATTATAGTG AATAAAATAGCGAACGTAAATCGTGTCGATTGGTATTGTATACGTCTCGG TTAAACGTACTCGTTTTCCAAATACGAAACGAAACACGTGTTCCTTCCAT TGTATTTATATACGTATAGACTAAACGTAGTCGGTTTTCGAACACGGAAC GGGACGGACGTATTCCTTTCCGCTCTCTCGATAAAAATTTTATCGATATA CGATATATTAATATTAAAATATAAATAATTGTTAAATAAATAAAATATGG AAGTGTAAGAATATCGAGTGTAATCATCATTAATACGTAAATCGATAAAA AGAAGAATTAAATATTTATCGAATACGAGGATAAAATGAAGAACGAAACG AGCCGAAACGTAAAAAAAAATAATCCTTTAACCGATAAATACTTAGAAAT TAAAAAAAAATAATATAATAATTAAAATCGATAAATAAAATAAAAAATTC GAATTATTCGATTCTTTTCTTTTATTTCATTTTCAATTTACATATATTTT TTCTTTTTCTCTTACATTTTAAATATTAAAATATGTATTATCGTATTAAA
  7. 7. AATAATAACGCTATCGGTTATTGTATCATTATTGTATATATTCGTAGTCG GTTTCCGAACGCGAAACGAAACGGACGTGTTTCTCTCTGCTCTCCGAGTA AAGACTTTATCGCTGTGAATAAAATATTATAGTGTAAAAATTTATTAAAT AAAATAAAAATATTGTAGCGTAAAGATTATTAACGAATTTTATAAGTCAT ATAATAAATTCCAATTCCAAGAAGAGGAAATTTTTTAATCTTTAAAATTT TGTAAACTTTGAATCGCTGTATCTCCGAAGATAATAGCGATACCTACGAT TTTCTGATGTGATTGCGATCGGGAAACGTTGCTCTTTCGATTTAATCGTT ATTCCACGTCGAGAACTATCGTTGAAATGAACGCTATCGTTTAAATATGA GAAGAATCTTTGGAATTAAACTTGTGCAAACTTTCGACTGCTGTATCTCC AAAGATACAGTAGCGATATGTACGATTTTTTGAGATAGTTGCGAGCGGGA AACATTGCTCTTTATAATGTGGAAAAGGAAAAATAAAAAACTTAACCAAA TGTAAACGATTAGATCGATTTAAACTGATACTGATAATTGCAATGAAAAT AACCGGAAAATTAAGAAGATAAACGAAAGAAATCTTTGAATCTTTTTTTA CGCGTCTTATAAATTAATAATAATGAAAAAAAAATTAAAAAAAATTAATT ATCGAAAATATTATCGATAAAAAAAAATTAAATCATTAAATTTTAAAGAA ACGAAAAATAACGAAACGAATCTAACGGAGTAATATATTAACGAGTGATA AAATGTAAAAATAAAATGAAAATTAATAATACCTTATGAATATTATAGTG AATAAAATAGCGAACGTAAATCGTGTCGATTGGTATTGTATACGTCTCGG TTAAACGTACTCGTTTTCCAAATACGAAACGAAACACGTGTTCCTTCCAT TGTATTTATATACGTATAGACTAAACGTAGTCGGTTTTCGAACACGGAAC GGGACGGACGTATTCCTTTCCGCTCTCTCGATAAAAATTTTATCGATATA CGATATATTAATATTAAAATATAAATAATTGTTAAATAAATAAAATATGG AAGTGTAAGAATATCGAGTGTAATCATCATTAATACGTAAATCGATAAAA AGAAGAATTAAATATTTATCGAATACGAGGATAAAATGAAGAACGAAACG AGCCGAAACGTAAAAAAAAATAATCCTTTAACCGATAAATACTTAGAAAT TAAAAAAAAATAATATAATAATTAAAATCGATAAATAAAATAAAAAATTC GAATTATTCGATTCTTTTCTTTTATTTCATTTTCAATTTACATATATTTT TTCTTTTTCTCTTACATTTTAAATATTAAAATATGTATTATCGTATTAAA AATAATAACGCTATCGGTTATTGTATCATTATTGTATATATTCGTAGTCG GTTTCCGAACGCGAAACGAAACGGACGTGTTTCTCTCTGCTCTCCGAGTA AAGACTTTATCGCTGTGAATAAAATATTATAGTGTAAAAATTTATTAAAT AAAATAAAAATATTGTAGCGTAAAGATTATTAACGAATTTTATAAGTCAT ATAATAAATTCCAATTCCAAGAAGAGGAAATTTTTTAATCTTTAAAATTT TGTAAACTTTGAATCGCTGTATCTCCGAAGATAATAGCGATACCTACGAT TTTCTGATGTGATTGCGATCGGGAAACGTTGCTCTTTCGATTTAATCGTT ATTCCACGTCGAGAACTATCGTTGAAATGAACGCTATCGTTTAAATATGA GAAGAATCTTTGGAATTAAACTTGTGCAAACTTTCGACTGCTGTATCTCC AAAGATACAGTAGCGATATGTACGATTTTTTGAGATAGTTGCGAGCGGGA AACATTGCTCTTTATAATGTGGAAAAGGAAAAATAAAAAACTTAACCAAA TGTAAACGATTAGATCGATTTAAACTGATACTGATAATTGCAATGAAAAT AACCGGAAAATTAAGAAGATAAACGAAAGAAATCTTTGAATCTTTTTTTA CGCGTCTTATAAATTAATAATAATGAAAAAAAAATTAAAAAAAATTAATT ATCGAAAATATTATCGATAAAAAAAAATTAAATCATTAAATTTTAAAGAA ACGAAAAATAACGAAACGAATCTAACGGAGTAATATATTAACGAGTGATA AAATGTAAAAATAAAATGAAAATTAATAATACCTTATGAATATTATAGTG AATAAAATAGCGAACGTAAATCGTGTCGATTGGTATTGTATACGTCTCGG TTAAACGTACTCGTTTTCCAAATACGAAACGAAACACGTGTTCCTTCCAT TGTATTTATATACGTATAGACTAAACGTAGTCGGTTTTCGAACACGGAAC GGGACGGACGTATTCCTTTCCGCTCTCTCGATAAAAATTTTATCGATATA CGATATATTAATATTAAAATATAAATAATTGTTAAATAAATAAAATATGG AAGTGTAAGAATATCGAGTGTAATCATCATTAATACGTAAATCGATAAAA AGAAGAATTAAATATTTATCGAATACGAGGATAAAATGAAGAACGAAACG AGCCGAAACGTAAAAAAAAATAATCCTTTAACCGATAAATACTTAGAAAT TAAAAAAAAATAATATAATAATTAAAATCGATAAATAAAATAAAAAATTC GAATTATTCGATTCTTTTCTTTTATTTCATTTTCAATTTACATATATTTT TTCTTTTTCTCTTACATTTTAAATATTAAAATATGTATTATCGTATTAAA
  8. 8. AATAATAACGCTATCGGTTATTGTATCATTATTGTATATATTCGTAGTCG GTTTCCGAACGCGAAACGAAACGGACGTGTTTCTCTCTGCTCTCCGAGTA AAGACTTTATCGCTGTGAATAAAATATTATAGTGTAAAAATTTATTAAAT AAAATAAAAATATTGTAGCGTAAAGATTATTAACGAATTTTATAAGTCAT ATAATAAATTCCAATTCCAAGAAGAGGAAATTTTTTAATCTTTAAAATTT TGTAAACTTTGAATCGCTGTATCTCCGAAGATAATAGCGATACCTACGAT TTTCTGATGTGATTGCGATCGGGAAACGTTGCTCTTTCGATTTAATCGTT ATTCCACGTCGAGAACTATCGTTGAAATGAACGCTATCGTTTAAATATGA GAAGAATCTTTGGAATTAAACTTGTGCAAACTTTCGACTGCTGTATCTCC AAAGATACAGTAGCGATATGTACGATTTTTTGAGATAGTTGCGAGCGGGA AACATTGCTCTTTATAATGTGGAAAAGGAAAAATAAAAAACTTAACCAAA TGTAAACGATTAGATCGATTTAAACTGATACTGATAATTGCAATGAAAAT AACCGGAAAATTAAGAAGATAAACGAAAGAAATCTTTGAATCTTTTTTTA CGCGTCTTATAAATTAATAATAATGAAAAAAAAATTAAAAAAAATTAATT ATCGAAAATATTATCGATAAAAAAAAATTAAATCATTAAATTTTAAAGAA ACGAAAAATAACGAAACGAATCTAACGGAGTAATATATTAACGAGTGATA AAATGTAAAAATAAAATGAAAATTAATAATACCTTATGAATATTATAGTG AATAAAATAGCGAACGTAAATCGTGTCGATTGGTATTGTATACGTCTCGG TTAAACGTACTCGTTTTCCAAATACGAAACGAAACACGTGTTCCTTCCAT TGTATTTATATACGTATAGACTAAACGTAGTCGGTTTTCGAACACGGAAC GGGACGGACGTATTCCTTTCCGCTCTCTCGATAAAAATTTTATCGATATA CGATATATTAATATTAAAATATAAATAATTGTTAAATAAATAAAATATGG AAGTGTAAGAATATCGAGTGTAATCATCATTAATACGTAAATCGATAAAA AGAAGAATTAAATATTTATCGAATACGAGGATAAAATGAAGAACGAAACG AGCCGAAACGTAAAAAAAAATAATCCTTTAACCGATAAATACTTAGAAAT TAAAAAAAAATAATATAATAATTAAAATCGATAAATAAAATAAAAAATTC GAATTATTCGATTCTTTTCTTTTATTTCATTTTCAATTTACATATATTTT TTCTTTTTCTCTTACATTTTAAATATTAAAATATGTATTATCGTATTAAA AATAATAACGCTATCGGTTATTGTATCATTATTGTATATATTCGTAGTCG GTTTCCGAACGCGAAACGAAACGGACGTGTTTCTCTCTGCTCTCCGAGTA AAGACTTTATCGCTGTGAATAAAATATTATAGTGTAAAAATTTATTAAAT AAAATAAAAATATTGTAGCGTAAAGATTATTAACGAATTTTATAAGTCAT ATAATAAATTCCAATTCCAAGAAGAGGAAATTTTTTAATCTTTAAAATTT TGTAAACTTTGAATCGCTGTATCTCCGAAGATAATAGCGATACCTACGAT TTTCTGATGTGATTGCGATCGGGAAACGTTGCTCTTTCGATTTAATCGTT ATTCCACGTCGAGAACTATCGTTGAAATGAACGCTATCGTTTAAATATGA GAAGAATCTTTGGAATTAAACTTGTGCAAACTTTCGACTGCTGTATCTCC AAAGATACAGTAGCGATATGTACGATTTTTTGAGATAGTTGCGAGCGGGA AACATTGCTCTTTATAATGTGGAAAAGGAAAAATAAAAAACTTAACCAAA TGTAAACGATTAGATCGATTTAAACTGATACTGATAATTGCAATGAAAAT AACCGGAAAATTAAGAAGATAAACGAAAGAAATCTTTGAATCTTTTTTTA CGCGTCTTATAAATTAATAATAATGAAAAAAAAATTAAAAAAAATTAATT ATCGAAAATATTATCGATAAAAAAAAATTAAATCATTAAATTTTAAAGAA ACGAAAAATAACGAAACGAATCTAACGGAGTAATATATTAACGAGTGATA AAATGTAAAAATAAAATGAAAATTAATAATACCTTATGAATATTATAGTG AATAAAATAGCGAACGTAAATCGTGTCGATTGGTATTGTATACGTCTCGG TTAAACGTACTCGTTTTCCAAATACGAAACGAAACACGTGTTCCTTCCAT TGTATTTATATACGTATAGACTAAACGTAGTCGGTTTTCGAACACGGAAC GGGACGGACGTATTCCTTTCCGCTCTCTCGATAAAAATTTTATCGATATA CGATATATTAATATTAAAATATAAATAATTGTTAAATAAATAAAATATGG AAGTGTAAGAATATCGAGTGTAATCATCATTAATACGTAAATCGATAAAA AGAAGAATTAAATATTTATCGAATACGAGGATAAAATGAAGAACGAAACG AGCCGAAACGTAAAAAAAAATAATCCTTTAACCGATAAATACTTAGAAAT TAAAAAAAAATAATATAATAATTAAAATCGATAAATAAAATAAAAAATTC GAATTATTCGATTCTTTTCTTTTATTTCATTTTCAATTTACATATATTTT TTCTTTTTCTCTTACATTTTAAATATTAAAATATGTATTATCGTATTAAA
  9. 9. From Genomes to Organisms
  10. 10. Fixed Simple structure Vegetative reproduction Immortal Motile Complex nervous system Complex sensory structures Sexual reproduction Short lifespan
  11. 11. ` One per hive Long-lived Reproductive Thousands per hive Short-lived Non-reproductive
  12. 12. ● These epigenetic changes are induced by environmental clues ● ● link between genome and environment Epigenetic regulations are context dependent interpretations of the genome: ● conditional phenotypes
  13. 13. A Wide Variety of Roles ● Cellular differentiation during development ● Differentiation between morphs ● Many medical implications – Cancer ● ● – Silencing of DNA repair and apoptosis genes Activation of “proliferation” genes Other complex diseases ● Diabetes, obesity
  14. 14. Epigenomics DNA methylation Histone modifications
  15. 15. DNA Methylation
  16. 16. DNA Methylation ● Addition of a methylgroup onto a cytosine ● Typically in the context C pG) CG ( ● Sometimes in CHH or CHG contexts (especially in plants)
  17. 17. DNA Methylases Some environmental / developmental signal Cellular integration of the signal Methylation of target sequences DNMT3 (de novo methylase)
  18. 18. Symmetrically methylated DNA A T C G T C T A T A G C A G A T
  19. 19. Symmetrically methylated DNA A T C G T C T A T A G C A G A T Replication A T C G T C T A T A G C A G A T Hemi-methylated DNA A T C G T C T A T A G C A G A T
  20. 20. Symmetrically methylated DNA A T C G T C T A T A G C A G A T Replication A T C G T C T A T A G C A G A T Hemi-methylated DNA A T C G T C T A T A G C A G A T DNMT1 (maintenance methylase) A T C G T C T A T A G C A G A T Symmetrically methylated DNA A T C G T C T A T A G C A G A T
  21. 21. x x Maintenance RNA De-Novo
  22. 22. A Computational Approach
  23. 23. Methylation and Genome Composition M CpG CpG TpG Methylation results in CpG under-representation
  24. 24. GpG observed CpG Bias= CpG expected n ATGC ×nCpG = nC ×nG
  25. 25. Microarray Meta-Analysis: Presence / Absence Calls
  26. 26. Presence / Absence in Body Parts
  27. 27. Acropora millepora
  28. 28. Credits: Eldon Ball
  29. 29. ● ● ● ● Stage-specific libraries Mapping onto genome Counts per transcript Tissue-specificity index – N: Number of conditions – Xi: Counts in condition i – Xmax: Max count
  30. 30. Ubiquitous Specific
  31. 31. DNA Methylation: Molecular Methods
  32. 32. Capture-Based Methods ● ● ● MeDIP:MethylatedDNA Immuno- recipitation P MethylCap: uses Methyl- inding Domain B (MBD) of the MeCP2protein Followed by – – Tiling array Sequencing (MeDIP-seq, MethylCap-seq)
  33. 33. Bisulfite Convertion Methylation Bisulfite Conversion
  34. 34. M A T C A T C T C A C G A T C G A T Sodium Bisulfite A T T A T T T T A C G A T T G A T
  35. 35. Array-Based Methods ● Illumina Infinium
  36. 36. Array-Based Methods ● Illumina Infinium – Pros ● ● – Cheap “Small” data size (~ ½ million CpGs) Cons ● ● ● Only covers a small proportion of all CpGs Focuses mainly on CpG Islands Only exists for Human
  37. 37. Bock et al, Nature Biotechnologies, 2010
  38. 38. Bisulfite Sequencing
  39. 39. M A T C A T C T C A C G A T C G A T Sodium Bisulfite A T T A T T T T A C G A T T G A T
  40. 40. Whole Genome Bisulfite Sequencing ● ● Bisulfite conversion directly followed by sequencing Large amount of data: – – Single base pair resolution Single strand resolution A T A C G T A A T A T G C A T T Methylated A T A C G T A A T A T G C A T T Hemi-methylated
  41. 41. Conversion Breaks Complementarity Watson (+) Crick (-) A C A C G T G A T G T G C A C T Bisulfite Conversion (+) A T A C G T G A (-) T G T G C A T T (++) A T A C G T G A T A T G C A C T (+-) (--) (-+) A C T G C A A T T G T G C A T T
  42. 42. Mapping ● Convert genome (C to T) – – ● Convert reads – – ● ● Genome Reverse complement Forward reads (++ and -+ strands): C to T Reverse reads (+- and – strands): G to A Map (three letter space) Convert the alignments back to the original sequences
  43. 43. Calling Methylated Bases ● ● Bisulfite conversion is only a partial reaction (between 99% and 99.9%) With large amount of data, small artifacts can become highly significant
  44. 44. Calling Methylated Bases Homo sapiens CpGs 30,000,000 mCpGs 25,000,000 Cs 1,000,000,000 (both strands) Conversion rate 99.9% Coverage per strand 10 Change of spurious mC 1% Inferred mC 20,000,000
  45. 45. Calling Methylated Bases Apis mellifera CpGs 5,000,000 mCpGs 50,000 Cs 50,000,000 (both strands) Conversion rate 99.9%5 Coverage per strand 10 Change of spurious mC 1% Inferred mC 500,000
  46. 46. The Null Hypothesis 0.1% C C 99.9% T
  47. 47. The Null Hypothesis 0.1% C C 99.9% T Bernoulli process with probability “p” N Bernoulli trials: Binomial process (N, p)
  48. 48. The Null Hypothesis 0.1% C C 99.9% T Bernoulli process with probability “p” N Bernoulli trials: Binomial process (N, p) Many p-values: adjust for multiple testing
  49. 49. ubiquitous specific Forêt et al, 2009
  50. 50. CpG depleted methylated ubiquitous normal CpG content non-methylated condition-specific Lyko, Forêt et al, 2010
  51. 51. Invertebrates Vertebrates Feng et al, PNAS, 2010
  52. 52. Position-Dependent Effect Portela and Esteller, Nature Biotechnologies, 2010
  53. 53. Summary ● Probable ancestral animal methylation landscape ● ● ● ● Gene body (introns and exons), transposons Dense methylation landscapes are a vertebrate innovation Honey bee: lack of transposon methylation and scarce intronic methylation are also apomorphic Despite these differences in methylation levels, the targets of gene body methylation are broadly conserved
  54. 54. Other Important Topics ● Differential methylation ● Dealing with complex samples
  55. 55. Concluding Thoughts
  56. 56. Major Transitions in Evolution ● Cavalier-Smith and Szathmary (1995)
  57. 57. 1) from replicating molecules to populations of molecules in compartments (protocells); 2) from independent genes to chromosomes; 3) from RNA as both an information carrier and enzyme to DNA the carrier of information and proteins as the enzymes; 4) from prokaryotes to eukaryotes; 5) from asexual clones to sexual populations; 6) from single-cell eukaryotes to multicellular organisms with differentiated cells; 7) from solitary individuals to colonies with non- reproductive castes
  58. 58. Major Transitions in Evolution ● Cavalier-Smith and Szathmary (1995) – Focussed on genetic elements
  59. 59. Major Transitions in Evolution ● Cavalier-Smith and Szathmary (1995) – ● Focussed on genetic elements Other non-genetic heritable changes (Jablonka (1994 Jablonka & Lamb (2006)) – Membranes – Prions – Self-sustaining metabolic cycles – Modified DNA bases – Other molecular marks attached to DNA
  60. 60. Role of non-genetic heritable changes ● Emergence of cells / chromosomes. – Transmission of epigenetic memory from the pare to the daughter cells / chromosomes to put these i a state suitable for the environment.
  61. 61. Role of non-genetic heritable changes ● Transition to multicellularity. – – Co-option of mechanisms to transmit information about structure, state, and activity to daughter cell In order to maintain a coherent organism: ● ● Prevent de-differentiation Early segregation of germ line
  62. 62. Role of non-genetic heritable changes ● Transition to social / colonial systems with division of labour or polyphenism – – Phenotypic differentiation at the level of the whole organism Co-option of epigenetic mechanisms involved in cellular differentiation

×