Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Sponsors
Gold tier Silver tier
Platinum tier
Bronze tier
PETER MOORE
General Manager, APAC Public Sector
WORLDWIDE PUBLIC SECTOR
AMAZON WEB SERVICES
A Quick Update on
the AWS Business…
$16B REVENUE RUN RATE
(Trailing 12 months, as of Q2 2017)
42% YoY GROWTH
(Q2 2016 vs Q2 2017)
*Gartner,	Magic	Quadrant	for	Cloud	Infrastructure	as	a	Service,	Worldwide,	Leong,	Lydia,	Petri,	Gregor,	Gill,	Bob,	Dorosh,...
Millions of Active
Customers Per Month
Largest Number Of Startup Customers
Largest Number Of Enterprise Customers
International Rice Research Institute
ASEAN Customers
Public Sector Customers Around The World
Public Sector Customers In APAC
九州
⼯業
⼤学
静岡県
九州先端科学技術研究所
豊中市
Why Does The Cloud Matter to
Public Sector Customers?
Why Does The Cloud Matter To Public Sector?
Pave the Way for Disruptive
Innovation
Make the World A
Better Place
• Disruptive innovation
• Agility
• Capability
• Cost savings
Paving The Way
What Do Public Sector Customers Need?
• A safe place to raise our children
• The ability to respond to natural disasters
• A way to protect ourselves from terro...
D e f i n i t i o n
Evolution Of Cloud Adoption In Government
S e c u r i t y & C o m p l i a n c e
A c q u i s i t i o n
S k i l l s a n d C u l t u r e
B r o a d A d o p t i o n
P o ...
Progress In Singapore’s Public Sector?
Education Government
AWS Pace Of Innovation: New Capabilities Daily
There Has Never Been A Better Time To Build
Introducing Amazon Glacier
Now Generally Available in Singapore
Secure, durable and extremely low-cost cloud storage
for r...
Flexible Data
Access
Three retrieval options
from minutes to hours
Durable
11 9s of durability (5 orders of
magnitude bett...
THANK YOU
谢谢
Terima Kasih
நன்றி
MARK SCHWARTZ
ENTERPRISE STRATEGIST
AMAZON WEB SERVICES
FORMER CIO
DEPARTMENT OF
HOMELAND SECURITY
THANK YOU
谢谢
Terima Kasih
நன்றி
MARK RYLAND
CHIEF ARCHITECT
WORLDWIDE PUBLIC SECTOR
AMAZON WEB SERVICES
With AWS, It Can Feel Like You Have Been Given
SUPER POWERS
Our Public Sector Customers are Superheroes
GOVERNMENT
STORAGE
SOLUTIONS
STORAGE
SOLUTIONS
DIGITAL
Government
Tan Eng Pheng
Senior Director, Clusters Group
GovTech Singapore
Copyright of GovTech ©
Transforming Hosting of
Government Websites
MR TAN ENG PHENG
SENIOR DIRECTOR
CLUSTERS GROUP
GOVTECH...
Copyright of GovTech ©
Smart	Nation	and	Digital	Government	Office	(SNDGO)
Smart	Nation	and	Digital	Government	Group	(SNDGG...
Copyright of GovTech ©
KEY AREAS:
Transformational
Applications
Platforms for value-
creation
Deepening
Digital Capabiliti...
Copyright of GovTech ©
“I think personally that
for all our pushing,
we really are not going
as fast we ought to.”
Prime M...
Copyright of GovTech ©
Economies of Scale
More Convenient
Less Resources
Faster Service Delivery
One-stop and secure hosti...
42 Copyright of GovTech ©
Standardised Architecture
Efficient Operations
Integrated Security
Copyright of GovTech ©
Self Managed by Agencies Centrally Managed
Network
Storage
Servers
Virtualization
O/S
Middleware
Ru...
44 Copyright of GovTech ©
Self-Service Portals
WordPressSitefinity
SwiiitSiteCore
SharePoint
Suite of Offered CMS
For stor...
45 Copyright of GovTech ©
Standardised Architecture
Efficient Operations
Integrated Security
46 Copyright of GovTech ©
Register Account
Subscribe
Website and
Services
Deploy Code
and Database
Verify Security
Finding...
47 Copyright of GovTech ©
19 October
• Created
Account
• Submitted
Provisioning
Request
20 October
• Provisioned Staging
a...
48 Copyright of GovTech ©
INSTANCE INSTANCE
4. SPAWNED
INSTANCE
Auto Capacity
Scaling
S3
BUCKET
CLOUDWATCH
METRICS
1. WEB ...
49 Copyright of GovTech ©
POST
MAINTENANCE
MAINTENANCE
SECURITY
PATCHES
RELEASED
UNPATCHEDPATCHEDUNPATCHED
“USE AND THROW”...
50 Copyright of GovTech ©
Standardised Architecture
Integrated Security
Efficient Operations
51 Copyright of GovTech ©
Defence in Depth through Integrated Security
Virtual Private Cloud
Protect cloud resources
Web A...
52 Copyright of GovTech ©
A Case in Point
1.5 million unpatched WordPress websites
worldwide defaced following vulnerabili...
53 Copyright of GovTech ©
WHERE
ARE WE
NOW?
WHAT IS
NEXT?
54 Copyright of GovTech ©
Hosting of Content
Websites
Enabling More Vibrant
Web Services Delivery
Enabling Mobile Svcs
Del...
55 Copyright of GovTech ©
Testimonials
More Convenient More Secure Faster Service Delivery Less Resources
Thank you
www.tech.gov.sg
@GovTechSG
Facebook.com/GovTechSG
Ask_CTMO@tech.gov.sg
login.cwp.gov.sg
cwpsupport@xtremax.com
6...
Tan Eng Pheng
Senior Director, Clusters Group
GovTech Singapore
STORAGE
SOLUTIONS
DIGITAL
Government
COMPLIANT
WORKLOADS
STORAGE
SOLUTIONS
DIGITAL
Government
GLACIER
VAULT LOCK
& SEC RULE
17A-4(F)
SOC 1
SOC 2
SOC 3
GLOBAL SECURITY ACCREDITATIONS
Multi Tier Cloud Security Standard
MTCS - SS583 : 2017
Level 3 (CSP) Certification
This certification gives organizations ...
- Alastair MacGibbon,
Cyber Security Special Adviser
Department of the Prime Minister and Cabinet
Australia
“Innovation is...
COMPLIANT
WORKLOADS
STORAGE
SOLUTIONS
DATA-DRIVEN
DECISIONS
DIGITAL
Government
Ng Siau Yong
Director, GeoSpatial & Data Division
Singapore Land Authority
DRIVING
INNOVATIONS
THROUGH GEOSPATIAL
AWS Public Sector Summit in Singapore, 4 October 2017
Ng Siau Yong
Director, GeoSpa...
GIST as an Enabler to Support Evidence-based
Decision-making
Geospatial Database Management
Geospatial Modelling & Analysi...
©	Singapore	Land	Authority	2017 67
Inkwood
Research (2016):
Expected CAGR
for geospatial
analytics market
is 17.06%
Geospa...
Taxi Booking Food Delivery Dating
Disruptive GeoSpatial Innovations
©	Singapore	Land	Authority	2017 68
More than
of data generated every day!
2,500,000,000,000,000,000
©	Singapore	Land	Authority	2017 69
bytes
Granularity
Localisation
Common
Platform
Detailed &
authoritative map
information
Services & content
customised to
Singapo...
Value-added Services of New OneMap
Map Customisation Find Nearby Walking Routes Variety of APIs
©	Singapore	Land	Authority...
myResponderOneService Police@SG
Disruptive Government Apps Using New OneMap
©	Singapore	Land	Authority	2017 72
High
Scalability
Greater
Flexibility
Asset
Light
Benefits of Cloud Technologies
Increased
Reliability
©	Singapore	Land	Aut...
Proliferate GeoSpatial Within Communities
©	Singapore	Land	Authority	2017 74
Strengthening the GeoSpatial Ecosystem
Industry
Partnership
Innovation
Catalyst
Capacity
Building
©	Singapore	Land	Authori...
Ng Siau Yong
Director, GeoSpatial & Data Division
Singapore Land Authority
NONPROFITS & NGOs
SERVERLESS
COMPUTING
ARTIFICIAL
INTELLIGENCE
SERVERLESS
COMPUTING
Artificial Intelligence in
the Public Sector
S E R V I C E S
P L AT F O R M S
Chat
Amazon Lex
Speech
Amazon Polly
Vision
Amazon Rekognition
E N G I N E S
I N F R A S T...
Amazon
Rekognition
Image Recognition And
Analysis Powered By
Deep Learning
Amazon
Polly
Text To Speech
Powered By Deep
Lea...
Early detection of
diabetic complications
Artificial Intelligence and Machine
Learning On AWS Today
ARTIFICIAL
INTELLIGENCE
SERVERLESS
COMPUTING
PRECISION
MEDICINE
ARTIFICIAL
INTELLIGENCE
SERVERLESS
COMPUTING
PRECISION
MEDICINE
DATA
ANALYTICS
Partners – Programs – Research
Broadest Community Of System Integrators:
Premier Consulting Partners
Broadest Ecosystem Of ISVs
PUBLIC
DATASETS
THOUGHT
LEADERSHIP
AWS CLOUD
CREDITS FOR
RESEARCH
CLOUD
INNOVATION
CENTERS
Global Programs
Swaine Chen
The Genome Institute Of Singapore
© 2017, Amazon Web Services, Inc. or its Affiliates, All rights reserved.
AWS and the Genome Institute of Singapore
Accele...
The Genome Institute of Singapore:
A Centre for Genomic Discovery
What is genomics?
SARS, 2003
Genomics helps track and manage outbreaks
GBS, 2015
Genes and your DNA impact health
3,000,000,000 bp
How can genomics improve health?
BRCA1, BRCA2
17 years
10,000,000 bp
5,000 bp
4 years
AGCTTTTCATTCTGACTGC...
How can genomics improve health?
How can we accelerate a 21 year process?
17 years
4 years
3,000,000,000 bp
10,000,000 bp
...
How can we accelerate a 21 year process?
Sequencing (Data)
Hyper-Moore
scaling
Analytics
Biology-aware
genomics
Data is getting solved (in the usual way)
Genomics
Moore’s law
Analytics is getting unsolved (in an unusual way)
Genomics
Moore’s law
Hyper-Moore
gap
How can we accelerate a 21 year process?
Data
Hyper-Moore
scaling
Analytics
Biology-aware
genomics
How can we accelerate a 21 year process?
Data
Hyper-Moore
scaling
Analytics
Biology-aware
genomics
Infrastructure
Continuo...
Immediate impact of AWS’s arbitrary elasticity
Problem
Share 60TB with the US
Before AWS:
Snail mail physical HDs
2 months...
What if we could ignore infrastructure entirely?
Data AnalyticsInfrastructure
What if we could ignore infrastructure entirely?
Data
Hyper-Moore
scaling
Analytics
Biology-aware
genomics
What if we could ignore infrastructure entirely?
What if we could ignore infrastructure entirely?
We might accelerate insight
GIS + Lambda
AWS Lambda removes infrastructure burden
1
10
100
1000
10000
100000
Run own servers GIS + Lambda
Genomes per ...
Genomics will transform our lives
GIS’s current focus
Precision health care
Genomics will transform our lives
MANY	SMART	IDEAS
ONE	SMART	NATION
ENABLED	BY	GENOMICS
Maggie Leong
Vincent Quah
Adrian White
Julian Lau
Mark Ryland
Andreas Wilm
Shih Chih Chuan
Liew Jun Xian
Ng Huck Hui
Pauli...
Swaine Chen
The Genome Institute Of Singapore
EDUCATION
AGILITY &
SAVINGS
SECURITY
INNOVATION
STUDENT
EXPERIENCE
STUDENT
OUTCOMES
1000+
Educational
Institutions
Top 10
Global Computer
Science &
Information
Systems Institutions
QS World University Ranki...
AWS Educate APAC Institutions
AWS Educate helps us power
a robust 15 unit, 4 course
cloud curriculum that offers
industry-relevant training to
our stude...
DDD Video if you
want it – mp4 in WD
In Conclusion…
AWS Is Powering Digital Transformation For
Government, Education, And Nonprofits
AWS Pace Of Innovation: New Capabilities Daily
There Has Never Been A Better Time To Build
Go Build!
Full Keynote Session- AWS Public Sector Summit Singapore 2017
Full Keynote Session- AWS Public Sector Summit Singapore 2017
Full Keynote Session- AWS Public Sector Summit Singapore 2017
Full Keynote Session- AWS Public Sector Summit Singapore 2017
Full Keynote Session- AWS Public Sector Summit Singapore 2017
Full Keynote Session- AWS Public Sector Summit Singapore 2017
Full Keynote Session- AWS Public Sector Summit Singapore 2017
Full Keynote Session- AWS Public Sector Summit Singapore 2017
Full Keynote Session- AWS Public Sector Summit Singapore 2017
Full Keynote Session- AWS Public Sector Summit Singapore 2017
Upcoming SlideShare
Loading in …5
×

of

Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 1 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 2 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 3 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 4 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 5 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 6 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 7 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 8 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 9 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 10 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 11 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 12 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 13 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 14 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 15 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 16 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 17 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 18 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 19 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 20 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 21 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 22 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 23 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 24 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 25 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 26 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 27 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 28 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 29 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 30 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 31 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 32 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 33 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 34 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 35 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 36 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 37 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 38 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 39 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 40 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 41 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 42 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 43 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 44 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 45 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 46 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 47 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 48 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 49 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 50 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 51 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 52 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 53 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 54 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 55 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 56 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 57 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 58 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 59 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 60 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 61 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 62 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 63 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 64 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 65 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 66 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 67 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 68 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 69 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 70 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 71 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 72 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 73 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 74 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 75 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 76 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 77 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 78 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 79 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 80 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 81 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 82 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 83 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 84 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 85 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 86 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 87 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 88 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 89 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 90 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 91 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 92 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 93 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 94 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 95 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 96 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 97 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 98 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 99 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 100 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 101 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 102 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 103 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 104 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 105 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 106 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 107 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 108 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 109 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 110 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 111 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 112 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 113 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 114 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 115 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 116 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 117 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 118 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 119 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 120 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 121 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 122 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 123 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 124 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 125 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 126 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 127 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 128 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 129 Full Keynote Session- AWS Public Sector Summit Singapore 2017 Slide 130
Upcoming SlideShare
What to Upload to SlideShare
Next

5 Likes

Share

Full Keynote Session- AWS Public Sector Summit Singapore 2017

The 2017 AWS Public Sector Summit in Singapore was opened by a Keynote address delivered by a line up of credible speakers from the Public Sector.
- Peter Moore, Regional Managing Director, Worldwide Public Sector, Asia Pacific and Japan, Amazon Web Services
- Mark Ryland, Director, Public Sector Solutions Architect, Amazon Web Services
- Mark Schwartz, Enterprise Strategist, Amazon Web Services
- Tan Eng Pheng, Senior Director, Clusters Group, GovTech Singapore
- Ng Siau Yong, Director, GeoSpatial and Data Division, Singapore Land Authority
- Swaine Chen, Senior Research Scientist, Genome Institute of Singapore

Related Books

Free with a 30 day trial from Scribd

See all

Related Audiobooks

Free with a 30 day trial from Scribd

See all

Full Keynote Session- AWS Public Sector Summit Singapore 2017

  1. 1. Sponsors Gold tier Silver tier Platinum tier Bronze tier
  2. 2. PETER MOORE General Manager, APAC Public Sector WORLDWIDE PUBLIC SECTOR AMAZON WEB SERVICES
  3. 3. A Quick Update on the AWS Business…
  4. 4. $16B REVENUE RUN RATE (Trailing 12 months, as of Q2 2017) 42% YoY GROWTH (Q2 2016 vs Q2 2017)
  5. 5. *Gartner, Magic Quadrant for Cloud Infrastructure as a Service, Worldwide, Leong, Lydia, Petri, Gregor, Gill, Bob, Dorosh, Mike, August 32016 This graphic was published by Gartner, Inc. as part of a larger research document and should be evaluated in the context of the entire document. The Gartner document is available upon request from AWS : http://www.gartner.com/doc/reprints?id=1-2G2O5FC&ct=150519&st=sb Gartner does not endorse any vendor, product or service depicted in its research publications, and does not advise technology users to select only those vendors with the highest ratings or other designation. Gartner research publications consist of the opinions of Gartner's research organization and should not be construed as statements of fact. Gartner disclaims all warranties, expressed or implied, with respect to this research, including any warranties of merchantability or fitness for a particular purpose. AWS is positioned highest in execution and furthest in vision within the Leaders Quadrant AWS Positioned as a Leader in the Gartner Magic Quadrant for Cloud Infrastructure as a Service, Worldwide
  6. 6. Millions of Active Customers Per Month
  7. 7. Largest Number Of Startup Customers
  8. 8. Largest Number Of Enterprise Customers
  9. 9. International Rice Research Institute ASEAN Customers
  10. 10. Public Sector Customers Around The World
  11. 11. Public Sector Customers In APAC 九州 ⼯業 ⼤学 静岡県 九州先端科学技術研究所 豊中市
  12. 12. Why Does The Cloud Matter to Public Sector Customers?
  13. 13. Why Does The Cloud Matter To Public Sector? Pave the Way for Disruptive Innovation Make the World A Better Place
  14. 14. • Disruptive innovation • Agility • Capability • Cost savings Paving The Way What Do Public Sector Customers Need?
  15. 15. • A safe place to raise our children • The ability to respond to natural disasters • A way to protect ourselves from terrorism • Educating students so they are a valuable contribution to the future workforce • Healthy life expectancy through quality and affordable healthcare systems Making The World A Better Place What does the world need?
  16. 16. D e f i n i t i o n Evolution Of Cloud Adoption In Government
  17. 17. S e c u r i t y & C o m p l i a n c e A c q u i s i t i o n S k i l l s a n d C u l t u r e B r o a d A d o p t i o n P o l i c y Evolution Of Cloud Adoption In Government D e f i n i t i o n
  18. 18. Progress In Singapore’s Public Sector? Education Government
  19. 19. AWS Pace Of Innovation: New Capabilities Daily There Has Never Been A Better Time To Build
  20. 20. Introducing Amazon Glacier Now Generally Available in Singapore Secure, durable and extremely low-cost cloud storage for regulatory and compliance data, healthcare information, scientific research, media assets, and magnetic tape replacements
  21. 21. Flexible Data Access Three retrieval options from minutes to hours Durable 11 9s of durability (5 orders of magnitude better than 2 copies on tape) Management Features Lifecycle Policies, VaultLock, Retrieval Policies, CloudTrail Cost-Effective $0.005 per GB per month Secure All data encrypted at rest Scalable From gigabytes to exabytes Amazon Glacier
  22. 22. THANK YOU 谢谢 Terima Kasih நன்றி
  23. 23. MARK SCHWARTZ ENTERPRISE STRATEGIST AMAZON WEB SERVICES
  24. 24. FORMER CIO DEPARTMENT OF HOMELAND SECURITY
  25. 25. THANK YOU 谢谢 Terima Kasih நன்றி
  26. 26. MARK RYLAND CHIEF ARCHITECT WORLDWIDE PUBLIC SECTOR AMAZON WEB SERVICES
  27. 27. With AWS, It Can Feel Like You Have Been Given SUPER POWERS
  28. 28. Our Public Sector Customers are Superheroes
  29. 29. GOVERNMENT
  30. 30. STORAGE SOLUTIONS
  31. 31. STORAGE SOLUTIONS DIGITAL Government
  32. 32. Tan Eng Pheng Senior Director, Clusters Group GovTech Singapore
  33. 33. Copyright of GovTech © Transforming Hosting of Government Websites MR TAN ENG PHENG SENIOR DIRECTOR CLUSTERS GROUP GOVTECH SINGAPORE 4 OCT 2017
  34. 34. Copyright of GovTech © Smart Nation and Digital Government Office (SNDGO) Smart Nation and Digital Government Group (SNDGG) SNDGG Ministerial Committee GovTech A Part of the Smart Nation and Digital Government Group 38 Copyright of GovTech ©
  35. 35. Copyright of GovTech © KEY AREAS: Transformational Applications Platforms for value- creation Deepening Digital Capabilities National Digital Platform Digital Governance R&D Support Industry Capabilities Talent and Manpower Better Living More Opportunities Stronger Communities Urban Mobility Homes & Environment Improved Ops and Service Delivery Health & Ageing Competitive Economy Smart Nation Framework 39
  36. 36. Copyright of GovTech © “I think personally that for all our pushing, we really are not going as fast we ought to.” Prime Minister Lee Hsien Loong 24 Feb 2017 Image credit: FacebookCopyright of GovTech ©40
  37. 37. Copyright of GovTech © Economies of Scale More Convenient Less Resources Faster Service Delivery One-stop and secure hosting solution for unclassified Government websites, centrally managed and operated on the public cloud v Simplified base offerings with service bundling v Managed web CMS solutions v Leveraging pooled IT resources/ expertise v Save manpower in procurement and operations v Direct purchase in one-stop shop v Automated service provisioning, deployment and maintenance v Standardisation and consolidation v 20% to 60% savings in web hosting and security costs More Secure v Bundled defence-in-depth security v Efficient patch management with automation Content Websites Platform 41
  38. 38. 42 Copyright of GovTech © Standardised Architecture Efficient Operations Integrated Security
  39. 39. Copyright of GovTech © Self Managed by Agencies Centrally Managed Network Storage Servers Virtualization O/S Middleware Runtime Services Websites Traditional Data Centre Private Cloud Network Storage Servers Virtualization O/S Middleware Runtime Services Websites Network Storage Servers Virtualization O/S Middleware Runtime Services Websites Months Months or Weeks Weeks or Days Standardised Architecture 43 Copyright of GovTech ©
  40. 40. 44 Copyright of GovTech © Self-Service Portals WordPressSitefinity SwiiitSiteCore SharePoint Suite of Offered CMS For storing classified “Restricted” contents Service Portal Subscribe to website and services Deployment Portal Deploy code and database Form Services Create WYSIWYG forms Service Desk Portal Make enquiries, log and track issues Operations Portal Check website health and inspect logs User Manager Assign user roles and access control Security Portal Schedule security activities and holds security reports Utilisation Portal Determine website storage, page views and data transfer usage Architectural Components Virtual Private Cloud Isolated cloud resources Web Application Firewall Filter malicious web traffic End Point Protection Anti-virus Certificate Manager Provision and manage SSL/TSL certificates Defacement Monitor Select web pages to monitor Content Delivery Network Caching and Load Distribution Network Intrusion PS Examine network traffic flows to block exploits CyberWatch Centre Capture and process security alerts Bundled Security Simple Queue Service Fully managed message queues Lambda Serverless compute service CloudTrail Track user activity and API usage CloudWatch Monitor resources and applications Simple Storage Service Storage for the Internet Elastic Load Balancing Application or network traffic distribution Supporting AWS Services
  41. 41. 45 Copyright of GovTech © Standardised Architecture Efficient Operations Integrated Security
  42. 42. 46 Copyright of GovTech © Register Account Subscribe Website and Services Deploy Code and Database Verify Security Findings and Remediate Conduct Vulnerability and Pen Tests W E B S I T E P R O V I S I O N I N G Perform and Sign-off UAT 1. Account Registration 2. Website Subscription, Deployment and UAT 3. Security Testing 4. Going Live Efficient Operations Copyright of GovTech ©46
  43. 43. 47 Copyright of GovTech © 19 October • Created Account • Submitted Provisioning Request 20 October • Provisioned Staging and Production Environment • Deployed Website to Staging and Production • Completed UAT • Submitted Request for VA/PT • Started VA/PT 21 October • Completed VA/PT • Sent VA/PT Report • 1 Med + 2 Low Findings 25 October • Remediated Vulnerabilities • Submitted Security Declaration • Submitted Request to Go ‘Live’ (Change DNS) on 28 October 28 October • ‘Live’ Vital Website Running on CWP Case: Website Provisioning VITAL.ORG’S CORPORATE WEBSITE WENT ‘LIVE’ ON CWP IN JUST 7 WORKING DAYS Includes Procurement, User Acceptance & Security Tests, and Deployment Copyright of GovTech ©47
  44. 44. 48 Copyright of GovTech © INSTANCE INSTANCE 4. SPAWNED INSTANCE Auto Capacity Scaling S3 BUCKET CLOUDWATCH METRICS 1. WEB TRAFFIC SURGE 2. RESOURCE UTILISATION ABOVE LIMITS! 3. MONITOR & ALERTED 5. DRAW SOURCE & CONFIG 6. ATTACH TO LOAD BALANCER Auto-Scalable Instances on CWP: a) Public Load Balancer b) Network Intrusion Prevention c) Web Application Firewall d) Reverse Proxy e) App Servers (Content Mgmt Systems) Private Cloud v Buy more bandwidth v Vertical scale in advance v Buy more instances v Subscribe to additional page views and data transfer v Temporal spikes are handled automatically at $0 cost How web traffic surges are handled on different environments: v Upgrade website tier with 0 downtime
  45. 45. 49 Copyright of GovTech © POST MAINTENANCE MAINTENANCE SECURITY PATCHES RELEASED UNPATCHEDPATCHEDUNPATCHED “USE AND THROW” CONCEPT Software Update & Security Patching 1 hour to patch 1 instance 30 mins of intermittent downtime Private Cloud 7 mins to patch 1 instance 0 downtime 850% More Efficient
  46. 46. 50 Copyright of GovTech © Standardised Architecture Integrated Security Efficient Operations
  47. 47. 51 Copyright of GovTech © Defence in Depth through Integrated Security Virtual Private Cloud Protect cloud resources Web Application Firewall Filter malicious web traffic End Point Protection Protect VMs against viruses & malware Defacement Monitoring Monitor web pages against unauthorized changes Network Intrusion PS Examine network traffic flows to block exploits CyberWatch Centre Capture and process security alerts Penetration Testing Performed before website goes ‘live’ and once a year (automated and manual PT) Network and OS Vulnerability Assessment Performed every quarter Application Vulnerability Assessment Performed before website goes ‘live’ and once a year Cert Management Manage SSL/TLS certificates Patch Management Monitor & administer timely software patches, fixes & updates Content Delivery Network Cache and distribute load 51 Copyright of GovTech ©
  48. 48. 52 Copyright of GovTech © A Case in Point 1.5 million unpatched WordPress websites worldwide defaced following vulnerability disclosure in Jan 2017 Patched 85 websites Staging Env patched in 4 hours 0 DEFACEMENT 0 DOWNTIME Total elapse time: 23 hours Production Env patched in 5 hours Wordpress patch 4.7.2 fix for content-injection vulnerability https://wordpress.org/news/2017/01/wordpress-4-7-2-security- release/ Alerted to the availability of the critical WordPress Patch on its release on Fri, 27 Jan 4am (GMT+8) was successfully patched by Sat, 28 Jan 3am (GMT+8) Source: Threatpost.com on 10-Feb-2017 CWP Operations & Security Management Function Integrated Security
  49. 49. 53 Copyright of GovTech © WHERE ARE WE NOW? WHAT IS NEXT?
  50. 50. 54 Copyright of GovTech © Hosting of Content Websites Enabling More Vibrant Web Services Delivery Enabling Mobile Svcs Delivery (thru API hosting) is a fitting platform for Exploration, Trial and Delivery of Innovative Web Services Possibility of pay-as-you use SAAS solutions on subscription basis in future Native M-Apps that consume contents hosted on CWP thru web APIs Outlook and Mobile Calendar Synchronisation Solution CWP Application Marketplace
  51. 51. 55 Copyright of GovTech © Testimonials More Convenient More Secure Faster Service Delivery Less Resources
  52. 52. Thank you www.tech.gov.sg @GovTechSG Facebook.com/GovTechSG Ask_CTMO@tech.gov.sg login.cwp.gov.sg cwpsupport@xtremax.com 6778 4985 ext. 9 Copyright of GovTech ©
  53. 53. Tan Eng Pheng Senior Director, Clusters Group GovTech Singapore
  54. 54. STORAGE SOLUTIONS DIGITAL Government
  55. 55. COMPLIANT WORKLOADS STORAGE SOLUTIONS DIGITAL Government
  56. 56. GLACIER VAULT LOCK & SEC RULE 17A-4(F) SOC 1 SOC 2 SOC 3 GLOBAL SECURITY ACCREDITATIONS
  57. 57. Multi Tier Cloud Security Standard MTCS - SS583 : 2017 Level 3 (CSP) Certification This certification gives organizations clarity to utilize AWS to host and process their highly confidential data in Singapore
  58. 58. - Alastair MacGibbon, Cyber Security Special Adviser Department of the Prime Minister and Cabinet Australia “Innovation is good; cloud is good because it helps us move off legacy systems and our biggest risk when we look at things is indeed legacy systems” “Innovation and cloud help form the basis upon which will make the Australian Government more secure”
  59. 59. COMPLIANT WORKLOADS STORAGE SOLUTIONS DATA-DRIVEN DECISIONS DIGITAL Government
  60. 60. Ng Siau Yong Director, GeoSpatial & Data Division Singapore Land Authority
  61. 61. DRIVING INNOVATIONS THROUGH GEOSPATIAL AWS Public Sector Summit in Singapore, 4 October 2017 Ng Siau Yong Director, GeoSpatial & Data Division Singapore Land Authority © Singapore Land Authority 2017 65
  62. 62. GIST as an Enabler to Support Evidence-based Decision-making Geospatial Database Management Geospatial Modelling & Analysis GIS System/Application Management System/Application Design & Development Geospatial Data Management Remote Sensing Mapping Imagery Elevation Transportation Address Boundaries Water Features Survey Control Data Urban Planning Asset Management Environmental Management Defence & Security Business Services Social Services © Singapore Land Authority 2017 66
  63. 63. © Singapore Land Authority 2017 67 Inkwood Research (2016): Expected CAGR for geospatial analytics market is 17.06% Geospatial Industry CAGR: 8% - 17% from 2016 - 2023
  64. 64. Taxi Booking Food Delivery Dating Disruptive GeoSpatial Innovations © Singapore Land Authority 2017 68
  65. 65. More than of data generated every day! 2,500,000,000,000,000,000 © Singapore Land Authority 2017 69 bytes
  66. 66. Granularity Localisation Common Platform Detailed & authoritative map information Services & content customised to Singapore context Conduit for public agencies to provide information consistently New OneMap’s Unique Value Propositions © Singapore Land Authority 2017 70
  67. 67. Value-added Services of New OneMap Map Customisation Find Nearby Walking Routes Variety of APIs © Singapore Land Authority 2017 71
  68. 68. myResponderOneService Police@SG Disruptive Government Apps Using New OneMap © Singapore Land Authority 2017 72
  69. 69. High Scalability Greater Flexibility Asset Light Benefits of Cloud Technologies Increased Reliability © Singapore Land Authority 2017 73
  70. 70. Proliferate GeoSpatial Within Communities © Singapore Land Authority 2017 74
  71. 71. Strengthening the GeoSpatial Ecosystem Industry Partnership Innovation Catalyst Capacity Building © Singapore Land Authority 2017 75
  72. 72. Ng Siau Yong Director, GeoSpatial & Data Division Singapore Land Authority
  73. 73. NONPROFITS & NGOs
  74. 74. SERVERLESS COMPUTING
  75. 75. ARTIFICIAL INTELLIGENCE SERVERLESS COMPUTING
  76. 76. Artificial Intelligence in the Public Sector
  77. 77. S E R V I C E S P L AT F O R M S Chat Amazon Lex Speech Amazon Polly Vision Amazon Rekognition E N G I N E S I N F R A S T R U C T U R E Amazon ML Spark & EMR Kinesis Batch ECS GPU CPU IoT Mobile Apache MXNet Caffe 2 Theano PyTorch CNTKTensorFlow Machine Learning In The Hands Of Every Developer
  78. 78. Amazon Rekognition Image Recognition And Analysis Powered By Deep Learning Amazon Polly Text To Speech Powered By Deep Learning Amazon Lex Build Natural, Conversational Interactions In Voice & Text Artificial Intelligence-Powered Services
  79. 79. Early detection of diabetic complications
  80. 80. Artificial Intelligence and Machine Learning On AWS Today
  81. 81. ARTIFICIAL INTELLIGENCE SERVERLESS COMPUTING PRECISION MEDICINE
  82. 82. ARTIFICIAL INTELLIGENCE SERVERLESS COMPUTING PRECISION MEDICINE DATA ANALYTICS
  83. 83. Partners – Programs – Research
  84. 84. Broadest Community Of System Integrators: Premier Consulting Partners
  85. 85. Broadest Ecosystem Of ISVs
  86. 86. PUBLIC DATASETS THOUGHT LEADERSHIP AWS CLOUD CREDITS FOR RESEARCH CLOUD INNOVATION CENTERS Global Programs
  87. 87. Swaine Chen The Genome Institute Of Singapore
  88. 88. © 2017, Amazon Web Services, Inc. or its Affiliates, All rights reserved. AWS and the Genome Institute of Singapore Accelerating analytics for the future of genomics
  89. 89. The Genome Institute of Singapore: A Centre for Genomic Discovery
  90. 90. What is genomics?
  91. 91. SARS, 2003 Genomics helps track and manage outbreaks GBS, 2015
  92. 92. Genes and your DNA impact health
  93. 93. 3,000,000,000 bp How can genomics improve health? BRCA1, BRCA2 17 years 10,000,000 bp 5,000 bp 4 years AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAA TATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC ATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAG CCCGCACCTGACAGTGCGGGCTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAAG TTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGGGTTGCCGATATTCTGGAAAGCAATGCCA GGCAGGGGCAGGTGGCGACCGTCCTCTCTGCCCCCGCCAAAATTACCAACCATCTGGTAGCGATGATTGA AAAAACCATTAGCGGCCAAGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTCTG ACGGGACTCGCCGCCGCCCAGCCGGGATTTCCGCTGGCACAATTGAAAACTTTCGTCGACCAGGAATTTG CCCAAATAAAACATGTCCTGCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCT GATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTGTTAGAAGCGCGTGGTCACAACGTT ACCGTTATCGATCCGGTCGAAAAACTGCTTGCAGTGGGGCATTACCTCGAATCTACCGTTGATATTGCTG AGTCCACCCGCCGTATTGCGGCAAGCCGCATTCCGGCTGACCACATGGTGCTGATGGCTGGTTTCACTGC CGGTAATGAAAAAGGCGAGCTGGTGGTTCTGGGACGCAACGGTTCCGACTACTCCGCTGCGGTGCTGGCG GCCTGTTTACGCGCCGATTGTTGCGAGATCTGGACGGATGTTGACGGTGTTTATACCTGCGATCCGCGTC AGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTATCAGGAAGCGATGGAGCTTTCTTACTTCGGCGC TAAAGTTCTTCACCCCCGCACCATCACCCCCATCGCCCAGTTTCAGATCCCTTGCCTGATTAAAAATACC GGAAATCCTCAAGCTCCAGGTACGCTCATTGGTGCCAGCCGTGATGAAGACGAATTACCGGTCAAGGGCA TTTCCAATCTGAATAACATGGCAATGTTCAGCGTTTCCGGCCCGGGGATGAAAGGGATGGTTGGCATGGC GGCGCGCGTCTTTGCAGCGATGTCACGCGCCCGTATTTCCGTGGTGCTGATTACGCAATCATCTTCCGAA TACAGTATCAGTTTCTGCGTTCCGCAAAGCGACTGTGTGCGAGCTGAACGGGCAATGCAGGAAGAGTTCT ACCTGGAACTGAAAGAAGGCTTACTGGAGCCGTTGGCGGTGACGGAACGGCTGGCCATTATCTCGGTGGT AGGTGATGGTATGCGCACCTTACGTGGGATCTCGGCGAAATTCTTTGCCGCGCTGGCCCGCGCCAATATC AACATTGTCGCCATTGCTCAGGGATCTTCTGAACGCTCAATCTCTGTCGTGGTCAATAACGATGATGCGA CCACTGGCGTGCGCGTTACTCATCAGATGCTGTTCAATACCGATCAGGTTATCGAAGTGTTTGTGATTGG CGTCGGTGGCGTTGGCGGTGCGCTGCTGGAGCAACTGAAGCGTCAGCAAAGCTGGTTGAAGAATAAACAT ATCGACTTACGTGTCTGCGGTGTTGCTAACTCGAAGGCACTGCTCACCAATGTACATGGCCTTAATCTGG AAAACTGGCAGGAAGAACTGGCGCAAGCCAAAGAGCCGTTTAATCTCGGGCGCTTAATTCGCCTCGTGAA AGAATATCATCTGCTGAACCCGGTCATTGTTGACTGTACTTCCAGCCAGGCAGTGGCGGATCAATATGCC GACTTCCTGCGCGAAGGTTTCCACGTTGTTACGCCGAACAAAAAGGCCAACACCTCGTCGATGGATTACT G
  94. 94. How can genomics improve health? How can we accelerate a 21 year process? 17 years 4 years 3,000,000,000 bp 10,000,000 bp 5,000 bp
  95. 95. How can we accelerate a 21 year process? Sequencing (Data) Hyper-Moore scaling Analytics Biology-aware genomics
  96. 96. Data is getting solved (in the usual way) Genomics Moore’s law
  97. 97. Analytics is getting unsolved (in an unusual way) Genomics Moore’s law Hyper-Moore gap
  98. 98. How can we accelerate a 21 year process? Data Hyper-Moore scaling Analytics Biology-aware genomics
  99. 99. How can we accelerate a 21 year process? Data Hyper-Moore scaling Analytics Biology-aware genomics Infrastructure Continuous scaling
  100. 100. Immediate impact of AWS’s arbitrary elasticity Problem Share 60TB with the US Before AWS: Snail mail physical HDs 2 months, $3000+shipping With AWS: 2 weeks, $5000 Multiple collaborators
  101. 101. What if we could ignore infrastructure entirely? Data AnalyticsInfrastructure
  102. 102. What if we could ignore infrastructure entirely? Data Hyper-Moore scaling Analytics Biology-aware genomics
  103. 103. What if we could ignore infrastructure entirely?
  104. 104. What if we could ignore infrastructure entirely? We might accelerate insight
  105. 105. GIS + Lambda AWS Lambda removes infrastructure burden 1 10 100 1000 10000 100000 Run own servers GIS + Lambda Genomes per unit cost 1000×
  106. 106. Genomics will transform our lives GIS’s current focus Precision health care
  107. 107. Genomics will transform our lives
  108. 108. MANY SMART IDEAS ONE SMART NATION ENABLED BY GENOMICS
  109. 109. Maggie Leong Vincent Quah Adrian White Julian Lau Mark Ryland Andreas Wilm Shih Chih Chuan Liew Jun Xian Ng Huck Hui Pauline Ng Anders Skanderup National Precision Medicine Program
  110. 110. Swaine Chen The Genome Institute Of Singapore
  111. 111. EDUCATION
  112. 112. AGILITY & SAVINGS SECURITY INNOVATION STUDENT EXPERIENCE STUDENT OUTCOMES
  113. 113. 1000+ Educational Institutions Top 10 Global Computer Science & Information Systems Institutions QS World University Rankings by Subject 2016 - Computer Science & Information Systems
  114. 114. AWS Educate APAC Institutions
  115. 115. AWS Educate helps us power a robust 15 unit, 4 course cloud curriculum that offers industry-relevant training to our students. Patricia Ramos, Dean of Workforce and Economic Development, Santa Monica College
  116. 116. DDD Video if you want it – mp4 in WD
  117. 117. In Conclusion…
  118. 118. AWS Is Powering Digital Transformation For Government, Education, And Nonprofits
  119. 119. AWS Pace Of Innovation: New Capabilities Daily There Has Never Been A Better Time To Build
  120. 120. Go Build!
  • ShawnaseyLina

    Nov. 25, 2021
  • RonaldSoh1

    Feb. 14, 2018
  • JeeYeonJoyceKim

    Feb. 8, 2018
  • aliantotheng

    Oct. 18, 2017
  • kaverjody

    Oct. 17, 2017

The 2017 AWS Public Sector Summit in Singapore was opened by a Keynote address delivered by a line up of credible speakers from the Public Sector. - Peter Moore, Regional Managing Director, Worldwide Public Sector, Asia Pacific and Japan, Amazon Web Services - Mark Ryland, Director, Public Sector Solutions Architect, Amazon Web Services - Mark Schwartz, Enterprise Strategist, Amazon Web Services - Tan Eng Pheng, Senior Director, Clusters Group, GovTech Singapore - Ng Siau Yong, Director, GeoSpatial and Data Division, Singapore Land Authority - Swaine Chen, Senior Research Scientist, Genome Institute of Singapore

Views

Total views

1,766

On Slideshare

0

From embeds

0

Number of embeds

1

Actions

Downloads

0

Shares

0

Comments

0

Likes

5

×