PCR

3,485 views

Published on

Published in: Technology
0 Comments
3 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
3,485
On SlideShare
0
From Embeds
0
Number of Embeds
8
Actions
Shares
0
Downloads
303
Comments
0
Likes
3
Embeds 0
No embeds

No notes for slide

PCR

  1. 1. LECTURE 5 Polymerase Chain Reaction
  2. 2. Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR)  The polymerase chain reaction, PCR, can produce many copies of a specific target segment of DNA  A three-step cycle—heating, cooling, and replication—brings about a chain reaction that produces an exponentially growing population of identical DNA molecules
  3. 3. Polymerase chain reaction  a.k.a. DNA amplification  in vitro method to specifically amplify nucleic acid sequences  A most important and versatile technique     Very sensitive Quick Easy robust http://highered.mcgraw-hill.com/sites/0073031208/
  4. 4. Amplification by replicating a specific sequence of DNA many times From one… …to billions of copies Brock Biology of the Microorganism
  5. 5. Fig. 20-8 5 TECHNIQUE 3 Target sequence 3 Genomic DNA 5 5 3 3 1 Denaturation 5 2 Annealing Cycle 1 yields 2 molecules Primers 3 Extension New nucleotides Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence
  6. 6. Fig. 20-8a 5 TECHNIQUE 3 Target sequence Genomic DNA 3 5
  7. 7. Fig. 20-8b 5 3 3 1 Denaturation 5 2 Annealing Cycle 1 yields 2 molecules Primers 3 Extension New nucleotides
  8. 8. Fig. 20-8c Cycle 2 yields 4 molecules
  9. 9. Fig. 20-8d Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence
  10. 10. DNA Amplification = DNA replication Same requirements ! Double helix must unwind Primers Deoxynucleotides (dNTPs) Polymerase Brock Biology of the Microorganism
  11. 11. allserv.rug.ac.be/~avierstr/ principles/pcr.html
  12. 12. http://oceanexplorer.noaa.gov/explorations/04etta/background/dna/dna_1_220.jpg
  13. 13. Brock Biology of the Microorganism
  14. 14. http://www.agen.ufl.edu/~chyn/age2062/lect/lect_09/lect_09.htm
  15. 15. Important to understand :  PCR is specific  because of the primers  we design the primers to anneal to specific sequences  That means, we must know what we want to amplify  The sequence between the two primers is amplified  other parts of the DNA will not be amplified  Amplification is exponential  the newly synthesised DNA served as templates for further rounds of amplification
  16. 16. The power of PCR  e.g. detection of viral /bacterial pathogens  Current technology     - - culture the pathogen Run biochemical/ immunological test Time consuming Some viruses & bacteria cannot yet be cultured Delay diagnosis, wrong diagnosis, or not specific enough e.g. SARS, bird flu
  17. 17. With PCR  Go straight for the DNA  No need to culture, biochemical test etc.  e.g Bacillus anthracis  First, we must be able to identify a gene/DNA sequence that is unique to the anthrax bacteria  This gene or sequence must be present only in the B.anthracis DNA, and not the DNA of any other organism, virus etc.
  18. 18.  Then, we need to know a bit of the DNA sequence of this anthrax gene (the ‘target’)  So that we can design specific primers that only anneals to the target anthrax DNA  and not any other DNA
  19. 19. Then we do a PCR using these anthrax-specific primers and DNA extracted from patient’s blood Only a very small amount of blood is required < 0.1 ml http://nobelprize.org/chemistry/laureates/1993/illpres/pcr.gif
  20. 20. +ve sample Primers anneal to target DNA anthrax gene is amplified -ve sample No amplification Because primers cannot anneal with any other DNA
  21. 21. Check for amplification products using a gel
  22. 22. PCR offers many advantages :  no need to isolate/culture the pathogens – extract DNA from soil and     other samples Very sensitive – amplify from only one copy of target (well, in theory), so requires very little sample Highly specific – can even identify different species or strains accurately Fast – a few hours Allows for diagnosis before disease develops  This is only one of the many applications of PCR, we will discuss may more later
  23. 23. What I need ? How to do a PCR ?
  24. 24. PCR reaction requires  Target DNA – a tiny bit will do  Specific primers - most crucial   Must know sequence Must be correctly designed  DNA polymerase - heat stable  Thermocycler - machine to heat and cool  dNTPs – building blocks for new DNA synthesis  Buffer – to provide correct conditions for the enzyme to work
  25. 25.  Typical reaction mix  Buffer + MgCl2  dNTPs – dATP,dCTP,dTTP,dGTP  Primers - forward and reverse  Polymerase  DNA sample  Thermocycling  Denaturation 94C  Annealing 55 C  Extension 72C
  26. 26. Buffer & MgCl2  Always use buffer that comes with enzyme (unless you’re one of those who knows better!)  MgCl2 - affects specificity and yield  usually about 2 mM  High [MgCl] - more product but less specific  Low [MgCl] – less product but more specific  Optimise !
  27. 27. dNTPs  premade & premix – just buy them  Use 50 to 500 mM each  50 mM enough to make 6 ug of products
  28. 28. Primers     Most crucial Primers are designed by you and synthesized on a machine Occasionally primers fail for apparently no reason, so don’t feel bad Ensure quality of primers – get a good supplier Guidelines  Check orientation of primers  20 to 30 base pair long  Go for 40 to 50% GC content  Avoid internal structure  Avoid complimentarity between primers, esp at 3’ end  Avoid extensive GC’s at 3’ end
  29. 29. Orientation of primers CTTATTAGTTTACTAT 5’CTTATTAGTTTACTATAAAGGAGTCGAAAGAGAAGTACCAAAGAT 3’ 3’GAATAATCAAATGATATTTCCTCAGCTTTCTCTTCATGGTTTCTA 5’ . CTCTTCATGGTTTCTA . Forward primer = 5’CTTATTAGTTTACTAT 3’ Reverse primer = 5’ATCTTTGGTACTTCTC 3’ 5’CTTATTAGTTTACTATAAAGGAGTCGAAAGAGAAGTACCAAAGAT 3’ 3’CTCTTCATGGTTTCTA 5’ 5’CTTATTAGTTTACTAT 3’ 3’GAATAATCAAATGATATTTCCTCAGCTTTCTCTTCATGGTTTCTA 5’
  30. 30.  Correct primers  amplification  One wrong primer  no amplification  Two wrong primers  no amplification
  31. 31. Things to avoid  Internal structures cattgccgacggcttaatcgta a g=c c=g c=g cattg=cttaatcgta  a ‘loop out’ Complementary 3’ ends 5’ cgtacgtactggttacctacgc 3’ ‘primer dimer’ | | | | | | | 3’ ggatgcgaattagactgacgc 5’
  32. 32. Polymerase  Taq polymerase from Thermus aquaticus  thermophilic - works at 72C  Others – Vent, Deepvent, TaKaRa, etc.
  33. 33. Polymerase makes error ! Brock Biology of the Microorganism
  34. 34.  Taq – no proof-reading activity – doesn’t correct error  Also add an extra base – A – at the ends  A  A  Error rate can be as high as one mistake in 1000  New generation of ‘proof reading enzymes’ –   e.g. Pfu, Pfx, Pwo has 3’exonuclease and proofreading activity  Extra A at the end – can be used in T/A cloning systems
  35. 35. Applications of PCR  Medical  Forensics (CSI)  Detection of infectious agents    Viral infections Bioweapons Difficult-to-culture organism or slow growing
  36. 36. Forensic Evidence and Genetic Profiles  An individual’s unique DNA sequence, or genetic profile, can be obtained by analysis of tissue or body fluids  Genetic profiles can be used to provide evidence in criminal and paternity cases and to identify human remains  Genetic profiles can be analyzed using RFLP analysis by Southern blotting
  37. 37.  Even more sensitive is the use of genetic markers called short tandem repeats (STRs), which are variations in the number of repeats of specific DNA sequences  PCR and gel electrophoresis are used to amplify and then identify STRs of different lengths  The probability that two people who are not identical twins have the same STR markers is exceptionally small
  38. 38. Fig. 20-24 (a) This photo shows Earl Washington just before his release in 2001, after 17 years in prison. Source of sample STR marker 1 STR marker 2 STR marker 3 Semen on victim 17, 19 13, 16 12, 12 Earl Washington 16, 18 14, 15 11, 12 Kenneth Tinsley 17, 19 13, 16 12, 12 (b) These and other STR data exonerated Washington and led Tinsley to plead guilty to the murder.
  39. 39. Time to watch a movie….
  40. 40. Reverse Transcriptase PCR for the detection of RNA viruses (almost all of the most nasty viruses have RNA genomes –Ebola, dengue, nipah, SARS – you name it) - before PCR – reverse transcribed viral RNA to cDNA first Brock Biology of the Microorganism
  41. 41. DNA fingerprinting
  42. 42. DNA fingerprinting using VNTRs http://homepages.strath.ac.uk/~dfs97113/BB310/Lect1603.html
  43. 43. VNTRs - variable number of tandem repeats – a.k.a minisatellites – natural polymorphisms in the human genome Different numbers of a short, repeated sequence Each repeat 15 – 100 bp long; Repeated in tandem arrays up to 40 kb long SSTR – simple sequence tandem repeats – a.k.a microsatellites Repeats of 2 to 4 nucleotides e.g. CAGCAGCAGCAGCAGCAGCAG daddy CAGCAGCAGCAG mommy daddy mommy VNTRs are hypervariable – can be very different between individuals
  44. 44. Many different types of VNTRs -can be found at many loci in the genome -two individual may have similar VNTRs at one loci -But the chances of two individuals having the same pattern of VNTRs at several loci is very small
  45. 45. The DNA sequences next to VNTRs are usually highly conserved (very similar in every individual) So we can design PCR primer to target these flanking sequences Using these primers, we can amplify the VNTR regions The VNTR amplification products will have different sizes, and can be separated on an agarose or polyacrylamide gel
  46. 46. By using PCR to amplify all three regions, a unique fingerprint can be generated for each individual
  47. 47. Fingerprinting by PCR of VNTR/STR
  48. 48. www-ermm.cbcu.cam.ac.uk/ 99000587h.htm
  49. 49. Family trees by DNA finger printing http://www.people.virginia.edu/~rjh9u/vntr1.html
  50. 50. DNA fingerprinting
  51. 51. DNA fingerprinting
  52. 52. Real time PCR – the next evolution  Monitoring of amplification reaction in real time  Quantitative  Rapid - results-as-you –wait  Close system – minimal cross contamination  Much more expensive…………..
  53. 53. Detection of GMO’s  Most genetically modified plants contain the 35S promoter of cauliflower mosaic virus (CaMV)  and the 3’ untranslated region (terminator) ofthe nopaline synthase (NOS) gene of Agrobacterium tumefaciens.  Can be detected using specific primers
  54. 54. Detection using SYBRO Green or fluorescence molecular beacons SYBRO Green fluoresces when bind to double stranded DNA only
  55. 55. Brock Biology of the Microorganism
  56. 56. Detection of GM soya and maize by RT PCR

×