Recombinant Attenuated Salmonella
Vaccines: New Technologies for
Inducing Cross-Protective and Cellular
Immunities
Roy Cur...
Objectives for Orally Delivered Live
Salmonella Vectored Vaccines
• Maximize invasiveness to and colonization of
internal ...
Why Salmonella as a vaccine vector?
Mucosally-delivered Salmonella enterica Serotypes
efficiently attach to and invade muc...
asd
(4.121-4.122 Mb)
araE
(3.018-3.020 Mb)
araBAD
(0.118-0.122 Mb)
crp
(4.197-4.198 Mb)
relA::lacI
(2.994-2.996 Mb)
tviABC...
Focus on Vaccines for Neonates
and Infants
Our goal is to design, construct and evaluate novel
innovative low-cost recombi...
1. Regulated delayed in vivo expression of attenuating phenotype
2. Regulated delayed in vivo expression of codon-optimize...
We achieve our objectives by genetically
engineering Salmonella to exhibit (cont’d):
4. Constitutive expression of a highl...
Regulated delayed in vivo expression of the
attenuating phenotype is achieved by:
1. Turning off ability to synthesize LPS...
Turn off ability to synthesize LPS O-antigen
in vivo to confer complete attenuation
∆pmi mutants synthesize LPS O-antigen ...
Regulation of ∆PwaaL::TT araC PBAD
waaL
L-arabinose absent in vivo
AraC dimer
No transcription
O-antigen not
synthesized o...
Regulated delayed in vivo expression of the
attenuating phenotype is achieved by:
1. Turning off ability to synthesize LPS...
Regulation of ∆Pfur::TT araC PBAD
fur
L-arabinose absent in
vivo
AraC dimer
No transcription
Fur
IROMPs, etc,
synthesized
...
Regulation of ∆Pcrp70::TT araC PBAD
crp-70
L-arabinose absent in vivo
AraC dimer
No transcription
Crp-70
Total absence
of ...
melR adiA adiY
Ty2 adi locus
PadiA
adiC
PadiY PadiC
adiA terminator
pmrC
Chromosomal cassettes for regulated expression of...
• One of our objectives is to construct a safe,
efficacious Salmonella vaccine vector system
that will enable repetitive u...
To induce cross-protective immunity, we use
the ∆Pfur33::TT araC PBAD fur and ∆PmntR22::TT araC
PBAD mntR regulated delaye...
A. Vaccine strain at time of vaccination
LPS O-antigen
∆∆pmi-2426pmi-2426 ∆∆waaLwaaL ∆∆PPwaaLwaaL::TT::TT araCaraC PPBADBA...
B. Vaccine strain in lymphoid tissuesB. Vaccine strain in lymphoid tissues
No LPS O-antigen
IROMPs
MnROMPs
∆∆pmi-2426pmi-2...
Balanced-Lethal Host-Vector Systems
asd Foreign
ss-genX
Asd+
SS-GenX+
DAP+
∆asd
DAP-
Regulated delayed antigen synthesis
with LacI
The regulated delayed antigen synthesis (RDAS) system is used in
recombinant...
In Salmonella
∆relA::araC PBAD lacI TT
+ Arabinose
No Arabinose
In vivo
Asd+
Ptrc SS-GenX+
DAP+
Asd+
Ptrc SS-GenX+
Antigen Delivery Strategies by Recombinant
Attenuated Salmonella Vaccines (RASVs)
• within cytoplasm of Salmonella vaccine...
New Anti-Pneumococcal Vaccine
for Infants
Our goal is to design, construct and evaluate novel
innovative low-cost recombin...
Survivors/
total
Inoculating
Dose (CFU)
Age of
Mice
Genotype*Strain
Safety of orally administered S. Typhimurium UK-1 χ955...
Summary of results with S. Typhimurium χ9558 having same
genotype as 1st
generation S. Typhi strains
• Completely safe in ...
Regulated delayed in vivo expression of the
attenuating phenotype is achieved by:
1. Turning off ability to synthesize LPS...
Biological Containment
of Vaccine Strains by In Vivo Lysis
Achieved by regulated expression of essential
genes for synthes...
cspE pagP dcuC
cspE lpxE Ptrc dcuC
χ3761
∆pagP88::Plpp lpxE
Salmonella ∆pagP88::Ptrc lpxE (codon optimized) mutant
LpxE
χ3...
Regulated Lysis Vector pYA3681
Ptrc promoter region sequence
Ptrc
ATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGT
GGAATT...
DAP-less and Muramic-less Death in
Host Strain with Regulated Lysis System Vector
χ11283
χ11283
(pYA3681)
LB Agar LB Agar
...
RASV-M. tuberculosis Vaccines
Goal: To deliver protein antigens of M. tuberculosis to the
cytoplasm of eukaryotic cells in...
Mycobacterium tuberculosis Antigens for
Vaccine Development
ESAT-6ESAT-6 esxAesxA Early secreted antigenic target ofEarly ...
Plasmids specifying synthesis of M. tuberculosis
antigens in χ11021
SopENt80-ESAT-6-ESAT-6-CFP-10-BlaSS-Ag85A-BlaCT:
pYA48...
Anti-Ag85AIgG
P<0.001 P<0.01
pYA3681 – vector control, pYA4891 (p15A ori) encoding SopENt80-ESAT-6-ESAT-6-CFP-10-Blass-
Ag...
Protection against M. tuberculosis Challenge
P<0.05
Protection against M. tuberculosis aerosol infection (100 CFU) 4 weeks...
Summary
• Live recombinant attenuated Salmonella vaccine
(RASV) strains with regulated delayed lysis in vivo
produce, secr...
Improved RASV-M. tuberculosis
χ12259: ΔPmurA25::TT araC PBAD murA ΔasdA27::TT
araC PBAD c2 Δ(wza-wcaM)-8 Δpmi-2426 ∆PhilA:...
Electron micrograph of avian influenza H5N1 virus
particles
Courtesy of R. Fleck, National Institute of Biological Standar...
Experimental Overview
Strain & Plasmid-Encoded Antigens
χ11791: ΔPmurA25::TT araC PBAD murA ΔasdA27::TT
araC PBAD c2 Δ(wza...
T Cell Response Post-Challenge
Oral Delivery
pBR pSC101p15A
Peripheral
Blood
Lung
Antigen-Specific CD8+
T Cell Response to
Influenza Challenge (Day 8 post-challenge)
NP antigen codon optimized for high le...
Weight Loss and Mortality
NP antigen codon optimized for high level expression by
oral Salmonella vaccine
Weight Loss Mort...
Final RASV-Influenza Vaccine
(based on ability to induce 100% protective immunity to influenza
challenge in mice by indivi...
This research is supported in part by grants from:
Bill and Melinda Gates Foundation
United States Department of Agricult...
Tiana Golding
Qingke Kong
Maria Dolores
Juarez-Rodriguez
Jiseon Yang
Shifeng
Wang
Wei Kong
Amanda GonzalesSoo-Young Wanda
...
Aeras Roy Curtiss talk 5 12-14
Aeras Roy Curtiss talk 5 12-14
Upcoming SlideShare
Loading in …5
×

Aeras Roy Curtiss talk 5 12-14

875 views

Published on

Published in: Health & Medicine, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
875
On SlideShare
0
From Embeds
0
Number of Embeds
233
Actions
Shares
0
Downloads
26
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide
  • This virus was responsible for the outbreaks in Vietnam and Thailand in 2004. The virus was grown in eggs in a BSL4 containment facility and inactivated with beta-propiolactone. Virus particles were stained with sodium silicotungstate and viewed by transmission electron microscopy. Magnification is x240,000.
  • I made a change in title
  • Green on white not so visible. Maybe % in different color so stands our more.
    TG: Changed colors, increased font
  • TG: Added subtitle concerning codon optimization. How do you feel about the title change? Changing it allowed me to simplify the graph titles, but this may not be what you want. Increased fonts, etc. on graphs.
  • TG: Increased all fonts, line weights, etc. Added note about codon optimization. Graphs now share a legend (bottom).
  • Aeras Roy Curtiss talk 5 12-14

    1. 1. Recombinant Attenuated Salmonella Vaccines: New Technologies for Inducing Cross-Protective and Cellular Immunities Roy Curtiss III Professor of Life Sciences, School of Life Science and Director, Center for Infectious Diseases and Vaccinology and Center for Microbial Genetic Engineering Arizona State University Scott J. Thaler Lecture May 12, 2014
    2. 2. Objectives for Orally Delivered Live Salmonella Vectored Vaccines • Maximize invasiveness to and colonization of internal effector lymphoid tissues • Recruit innate immune responses without being over reactogenic to cause distress or disease symptoms • Maximize induction of mucosal, systemic and cellular immunities • Be safe for newborn, pregnant, malnourished and immunocompromised individuals • Exhibit biological containment
    3. 3. Why Salmonella as a vaccine vector? Mucosally-delivered Salmonella enterica Serotypes efficiently attach to and invade mucosal associated lymphoid tissues (MALT, GALT, NALT, BALT, etc.) in mice and humans before colonizing internal lymph nodes, liver and spleen. They can also be delivered parenterally. All routes of delivery result in induction of mucosal, systemic and cellular immune responses with induction of long-term protective immunity. Attenuated pathogens that are not invasive or only invasive to mucosal tissues seldom induce long-lasting immunity. We know a great deal about the pathogenicity, physiology, genetics and genomics of Salmonella serotypes and Salmonella can be genetically manipulated with ease.
    4. 4. asd (4.121-4.122 Mb) araE (3.018-3.020 Mb) araBAD (0.118-0.122 Mb) crp (4.197-4.198 Mb) relA::lacI (2.994-2.996 Mb) tviABCDE (4.5-4.508 Mb) wza-wcaM (0.843-0.866 Mb) pmi (manA) (1.395-1.396 Mb) sopB (sigD) (1.890-1.892 Mb) rpoS (2.901-2.902 Mb) hilA (iagA) (2.857-2.859 Mb) Mutations in Salmonella Typhimurium & Typhi vaccines Need to add adiAC & gad and more to come agfC-agfG (1.84-1.841 Mb) pagP::lpxE (2.303-2.304 Mb) murA (3.315-3.316 Mb) origin (3.75 Mb) terminus (1.54 Mb) rfc (1.278-1.279 Mb) fur (2.248 Mb) galE (2.174-2.175 Mb) endA (3.096-3.097 Mb) sifA (1.76-1.761 Mb) cysG::spvABCD (4.186-4.185 Mb) mntR (2.113-2.114 Mb) rfaH (3.421-3.422 Mb) fliC (1.013-1.015 Mb) purA (4.568-4.569 Mb) sseL (0.651-0.652 Mb) tar (1.045-1.046 Mb)
    5. 5. Focus on Vaccines for Neonates and Infants Our goal is to design, construct and evaluate novel innovative low-cost recombinant Salmonella vaccines to prevent infections caused by: Enteric bacterial pathogens causing diarrhea Streptococcus pneumoniae of all serotypes Influenza viruses of all types Mycobacterium tuberculosis (and hopefully M. leprae) RASVs will induce after one or two oral needle-free immunizations protective immunity. The vaccine designs are based on many newly developed technologies.
    6. 6. 1. Regulated delayed in vivo expression of attenuating phenotype 2. Regulated delayed in vivo expression of codon-optimized sequences encoding protective antigens to be delivered by Type 2, 3 or 5 secretion systems and/or by regulated delayed lysis in vivo 3. Expression of arginine decarboxylase and/or glutamate decarboxylase at time of vaccine administration to neutralize stomach acidity to enable more vaccine cells to reach the ileum* These three features enable the vaccine strain at the time of oral vaccination to exhibit the same or better attributes than the wild- type parental strain to survive host-induced stresses to increase ability to colonize internal lymphoid tissues to maximize immunogenicity. We achieve our objectives by genetically engineering Salmonella to exhibit:
    7. 7. We achieve our objectives by genetically engineering Salmonella to exhibit (cont’d): 4. Constitutive expression of a highly invasive phenotype to enhance colonization of lymphoid tissues to induce maximal levels of protective immunity* This decreases dose of vaccine needed to induce protective immunity 5. Decreased ability to induce antibody responses to serotype- specific and immuno-dominant surface antigens This facilitates reuse of the vaccine vector for multiple vaccines 6. Decreased ability to suppress or modulate induction of immunity* These multiple alterations also act to increase induction of mucosal immunity, decrease inflammation of the intestinal tract and decrease ability to form biofilms and thus lessen persistence of vaccine cells in vivo
    8. 8. Regulated delayed in vivo expression of the attenuating phenotype is achieved by: 1. Turning off ability to synthesize LPS O-antigen (and/or parts of the LPS core) in vivo (5 means). 2. Replacing promoters for genes needed to display virulence with regulatable promoters (2 types) that will be on for vaccine strain growth and initial colonization of the GI tract and lymphoid tissues and then be turned off in vivo to preclude disease symptoms (8 means). 3. Using regulated delayed lysis in vivo as the ultimate means of attenuation with complete biological containment and no shedding of survivors (1 basic strategy with multiple modifications to alter timing).
    9. 9. Turn off ability to synthesize LPS O-antigen in vivo to confer complete attenuation ∆pmi mutants synthesize LPS O-antigen side chains when grown in the presence of mannose and cease to synthesize LPS O-antigen side chains in its absence. We also make WaaL synthesis (needed for addition of O- antigen on LPS core) dependent on growth in the presence of arabinose. O-antigen side chain ceases in vivo since free non- phosphorylated mannose and arabinose are unavailable.
    10. 10. Regulation of ∆PwaaL::TT araC PBAD waaL L-arabinose absent in vivo AraC dimer No transcription O-antigen not synthesized or assembled; LPS core exposed Transcription waaL Complete synthesis of LPS O-antigen + Arabinose waaL
    11. 11. Regulated delayed in vivo expression of the attenuating phenotype is achieved by: 1. Turning off ability to synthesize LPS O-antigen (and/or parts of the LPS core) in vivo (5 means). 2. Replacing promoters for genes needed to display virulence with regulatable promoters (2 types) that will be on for vaccine strain growth and initial colonization of the GI tract and lymphoid tissues and then be turned off in vivo to preclude disease symptoms (8 means). 3. Using regulated delayed lysis in vivo as the ultimate means of attenuation with complete biological containment and no shedding of survivors (1 basic strategy with multiple modifications to alter timing).
    12. 12. Regulation of ∆Pfur::TT araC PBAD fur L-arabinose absent in vivo AraC dimer No transcription Fur IROMPs, etc, synthesized and iron toxicity Transcription Fur Very low levels of IROMPs and iron-acquisition systems + Arabinose
    13. 13. Regulation of ∆Pcrp70::TT araC PBAD crp-70 L-arabinose absent in vivo AraC dimer No transcription Crp-70 Total absence of Crp-70 Transcription Crp-70 Production of catabolite- resistant (cAMP- insensitive) Crp + Arabinose
    14. 14. melR adiA adiY Ty2 adi locus PadiA adiC PadiY PadiC adiA terminator pmrC Chromosomal cassettes for regulated expression of adiAC and gadBC in Salmonella Typhi to cause acid tolerance χ11568: ∆PadiA276::TT rhaSR PrhaBAD adiA ∆(PadiY-adiY-PadiC)-119 adiC melR adiA PrhaBAD adiC pmrC PrhaSR rhaR T4 ip III terminator rhaS Arginine decarboxylase cysG Ty2 cysG locus PcysG PbigA nirC bigA XbaI XhoI nirC ∆cysG::TT araC PBAD gadBC PcysG gadB gadC ParaBAD gadC terminator ParaC araC T4 ip III terminator PgadC PbigA bigA Glutamate decarboxylase
    15. 15. • One of our objectives is to construct a safe, efficacious Salmonella vaccine vector system that will enable repetitive use of the vector system to develop multiple Recombinant Attenuated Salmonella Vaccines (RASVs) against a diversity of animal pathogens, yet would induce cross-protective immunity to diverse S. enterica serotypes and other pathogenic enteric bacteria colonizing chickens, other farm animals and humans.
    16. 16. To induce cross-protective immunity, we use the ∆Pfur33::TT araC PBAD fur and ∆PmntR22::TT araC PBAD mntR regulated delayed attenuating mutations to over-express IROMPS and MnROMPs in vivo to induce production of antibodies that react with IROMPs and MnROMPs made by all Salmonella serotypes and most other enteric pathogens. By using ∆pmi-2426 and ∆PwaaL::TT araC PBAD waaL mutations, vaccine strains cease O-antigen synthesis in vivo to induce antibodies to the LPS core that is identical in all Salmonella serotypes.
    17. 17. A. Vaccine strain at time of vaccination LPS O-antigen ∆∆pmi-2426pmi-2426 ∆∆waaLwaaL ∆∆PPwaaLwaaL::TT::TT araCaraC PPBADBAD waaLwaaL ∆∆PPfur33fur33::TT::TT araCaraC PPBADBAD furfur ∆∆PPmntR22mntR22::TT::TT araCaraC PPBADBAD mntRmntR ∆∆PPcrp70crp70::TT::TT araCaraC PPBADBAD crp-70crp-70 ∆∆araE25araE25 = LPS core No IROMP or MnROMP expression
    18. 18. B. Vaccine strain in lymphoid tissuesB. Vaccine strain in lymphoid tissues No LPS O-antigen IROMPs MnROMPs ∆∆pmi-2426pmi-2426 ∆∆waaLwaaL ∆∆PPwaaLwaaL::TT::TT araCaraC PPBADBAD waaLwaaL ∆∆PPfur33fur33::TT::TT araCaraC PPBADBAD furfur ∆∆PPmntR22mntR22::TT::TT araCaraC PPBADBAD mntRmntR ∆∆PPcrp70crp70::TT::TT araCaraC PPBADBAD crp-70crp-70 ∆∆araE25araE25 = LPS core Synthesis of protective IROMPs, MnROMPs and LPS core
    19. 19. Balanced-Lethal Host-Vector Systems asd Foreign ss-genX Asd+ SS-GenX+ DAP+ ∆asd DAP-
    20. 20. Regulated delayed antigen synthesis with LacI The regulated delayed antigen synthesis (RDAS) system is used in recombinant attenuated Salmonella vaccine (RASV) strains to enhance immune responses by reducing the adverse effects of high-level antigen synthesis at the time of vaccination. Chromosomal deletion map for ΔrelA198::araC PBAD lacI TT
    21. 21. In Salmonella ∆relA::araC PBAD lacI TT + Arabinose No Arabinose In vivo Asd+ Ptrc SS-GenX+ DAP+ Asd+ Ptrc SS-GenX+
    22. 22. Antigen Delivery Strategies by Recombinant Attenuated Salmonella Vaccines (RASVs) • within cytoplasm of Salmonella vaccine • by partial secretion using the Type 2 β-lactamase (or other) secretion signals and by enhancing production of outer membrane vesicles • by secretion/translocation via a Type 3 secretion system • by surface presentation using a Type 5 secretion system • release by lysis of Salmonella in vivo
    23. 23. New Anti-Pneumococcal Vaccine for Infants Our goal is to design, construct and evaluate novel innovative low-cost recombinant Salmonella vaccines expressing multiple protective Streptococcus pneumoniae surface protein antigens that are safe for fetuses, newborns, infants and immunocompromized or malnourished individuals and will induce after a single (hopefully) oral needle-free immunization protective immunity to diverse S. pneumoniae serotypes. The vaccine design is based on many newly developed technologies.
    24. 24. Survivors/ total Inoculating Dose (CFU) Age of Mice Genotype*Strain Safety of orally administered S. Typhimurium UK-1 χ9558 displaying regulated delayed attenuation in mice with decreasing ages All strains were grown in LB broth with 0.2% arabinose and 0.2% mannose. LD50 for wild-type S. Typhimurium UK-1 is 10 CFU in newborn mice. * Same genotype as S. Typhi strains evaluated in Phase I trial. ** Mother cannibalized two infants due to a large litter. ∆pmi-2426 ∆(gmd-fcl)-26 ∆Pfur81::TT araC PBAD fur ∆Pcrp527::TT araC PBAD crp ∆asdA27::TT araC PBAD c2 ∆araE25 ∆araBAD23 ∆relA198::araC PBAD lacI TT ∆sopB1925 ∆agfBAC811 containing pYA4088 specifying PspA χ9558 7 days 4 days 9.9 x 108 3.0 x 108 3.5 x 108 48/48 41/41 45/47**Day of birth 2 days 3.3 x 108 62/62
    25. 25. Summary of results with S. Typhimurium χ9558 having same genotype as 1st generation S. Typhi strains • Completely safe in newborn, pregnant, malnourished and immuno-compromised (multiple types) mice • Induces better immune responses and higher levels of protective immunity in mice born from mothers immunized prior to breeding with the same vaccine strain • Fusion of two PspA antigens and two PspC antigens from two different PspA and PspC families and with proline- rich domain induced highest levels of protective immunity to pneumococcal challenge by all challenge routes • S. Typhi derived RASVs were completely safe up to doses of 1010 CFU in human volunteers with no bacteremias and no shedding of vaccine cells in feces
    26. 26. Regulated delayed in vivo expression of the attenuating phenotype is achieved by: 1. Turning off ability to synthesize LPS O-antigen (and/or parts of the LPS core) in vivo (5 means). 2. Replacing promoters for genes needed to display virulence with regulatable promoters (2 types) that will be on for vaccine strain growth and initial colonization of the GI tract and lymphoid tissues and then be turned off in vivo to preclude disease symptoms (8 means). 3. Using regulated delayed lysis in vivo as the ultimate means of attenuation with complete biological containment and no shedding of survivors (1 basic strategy with multiple modifications to alter timing).
    27. 27. Biological Containment of Vaccine Strains by In Vivo Lysis Achieved by regulated expression of essential genes for synthesis of muramic acid and diaminopimelic acid (DAP) •Is a type of regulated delayed attenuation •Results in no vaccine strain persistence in vivo and no survivors if excreted •Can be used to deliver a bolus of protective antigen or a DNA vaccine vector
    28. 28. cspE pagP dcuC cspE lpxE Ptrc dcuC χ3761 ∆pagP88::Plpp lpxE Salmonella ∆pagP88::Ptrc lpxE (codon optimized) mutant LpxE χ3761 ∆pagP88::Pltrc lpxE ∆relA197::araC PBAD lacI TT regulatable Mono-phosphoryl lipid A
    29. 29. Regulated Lysis Vector pYA3681 Ptrc promoter region sequence Ptrc ATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGT GGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGGGAA TTCGCAATTCCCGGGGATCCGTCGACCTGCAGCCAAGCTCCCAAGCTT -35 -10 SD NcoI SmaI/XmaI trpA TT araC* PBAD 5ST1T2 Ptrc P22 PR SD-GTG murA SD-GTG asd rrfG TT pYA3681 5818 bp pBR ori χ11803: ∆asdA27::araC PBAD c2 ∆PmurA25::araC PBAD murA ∆(wza-wcaM)-8 ∆relA197::araC PBAD lacI TT ∆pmi-2426 ∆recF126 ∆pagP88::Ptrc lpxE
    30. 30. DAP-less and Muramic-less Death in Host Strain with Regulated Lysis System Vector χ11283 χ11283 (pYA3681) LB Agar LB Agar + 0.2%Arabinose +50µg/ml DAP LB Agar + 0.2%Arabinose LB Agar Recombinant host-vector strain displaying arabinose-dependent growth and regulated cell lysis in the absence of arabinose. χ11803: ∆asdA27::araC PBAD c2 ∆PmurA25::araC PBAD murA ∆(wza-wcaM)-8 ∆relA197::araC PBAD lacI TT ∆pmi-2426 ∆recF126 ∆pagP88::Ptrc lpxE
    31. 31. RASV-M. tuberculosis Vaccines Goal: To deliver protein antigens of M. tuberculosis to the cytoplasm of eukaryotic cells in order to elicit a cell- mediated immune response. - M. tuberculosis protein antigens known to elicit protective T-cell responses (ESAT-6, CFP-10, Ag85A) were delivered by attenuated Salmonella vaccine strains by three mechanisms: (1)As fusion proteins with (a) Salmonella Type III Secretion System effector protein SopE2 and (b) Type II Secretion signal sequences from β-lactamase or OmpA. (2)By delivery of the antigens into the eukaryotic cell cytoplasm following escape from the endosome and regulated delayed lysis of the RASV strain.
    32. 32. Mycobacterium tuberculosis Antigens for Vaccine Development ESAT-6ESAT-6 esxAesxA Early secreted antigenic target ofEarly secreted antigenic target of M.M. tuberculosistuberculosis; immunodominant T cell antigen; immunodominant T cell antigen CFP-10CFP-10 esxBesxB Culture filtrate protein - 10 kDa; co-Culture filtrate protein - 10 kDa; co- transcribed withtranscribed with esxA;esxA; proteins probablyproteins probably secreted together; immunodominant T cellsecreted together; immunodominant T cell antigenantigen Ag85AAg85A fbpAfbpA Mycolyl transferase, involved in the synthesisMycolyl transferase, involved in the synthesis of trehalose dimycolate, one of the mycolicof trehalose dimycolate, one of the mycolic acidsacids
    33. 33. Plasmids specifying synthesis of M. tuberculosis antigens in χ11021 SopENt80-ESAT-6-ESAT-6-CFP-10-BlaSS-Ag85A-BlaCT: pYA4890 (pBR ori) pYA4891 (p15A ori) pYA4892 (pSC101 ori) OmpCss-ESAT-6-ESAT-6-CFP-10-BlaSS-Ag85A-BlaCT: pYA4893 (pBR ori) pYA4894 (p15A ori) χ11021 ∆asdA27::TT araC PBAD c2 ∆PmurA25::TT araC PBAD murA ∆(gmd-fcl)-26 ∆relA198::araC PBAD lacI TT ∆pmi- 2426 ∆(araC PBAD)-5::PR araBAD
    34. 34. Anti-Ag85AIgG P<0.001 P<0.01 pYA3681 – vector control, pYA4891 (p15A ori) encoding SopENt80-ESAT-6-ESAT-6-CFP-10-Blass- Ag85A-BlaNt χ11021 ΔPmurA25:TT araC PBAD murA ΔasdA27::TT araC PBAD c2 ΔaraBAD23 Δ(gmd-fcl)-26 Δpmi-242 ΔrelA198::TT araC PBAD lacI Total IgG responses (Endpoint titers) to Ag85A and ESAT-6 Total serum IgG responses to Ag85A and ESAT-6 from mice orally immunized at days 0, 7 and 49 with χ11021(pYA3681) or with χ11021(pYA4891) and in mice given only BSG. White bars - IgG levels prior to immunization. Black bars - IgG levels on day 77.
    35. 35. Protection against M. tuberculosis Challenge P<0.05 Protection against M. tuberculosis aerosol infection (100 CFU) 4 weeks after oral immunization with χ11021(pYA3681), χ11021(pYA4891) or BSG at days 0, 7 and 49. One group was immunized on day 0 by s.c. inoculation of 5 x 104 CFU of M. bovis BCG. Mice were euthanized 6 weeks later and titers of M. tuberculosis determined.
    36. 36. Summary • Live recombinant attenuated Salmonella vaccine (RASV) strains with regulated delayed lysis in vivo produce, secrete & release M. tuberculosis antigens. • RASV-M. tuberculosis vaccines elicit antigen-specific antibody and cytokine responses, suggestive of a Th1 immune response. • RASV-M. tuberculosis vaccines elicit protection in immunized mice against aerosol challenge with live M. tuberculosis H37Rv that is similar to or better than protection by M. bovis BCG vaccination. • We can now do much better with improved strains.
    37. 37. Improved RASV-M. tuberculosis χ12259: ΔPmurA25::TT araC PBAD murA ΔasdA27::TT araC PBAD c2 Δ(wza-wcaM)-8 Δpmi-2426 ∆PhilA::Ptrc ∆lacO888 hilA ΔpagP88::Ptrc lpxE ΔrelA197::araC PBAD lacI TT ΔsifA26 M. tuberculosis antigens to be evaluated: OmpCss-ESAT-6-ESAT-6-CFP-10-Ag85A
    38. 38. Electron micrograph of avian influenza H5N1 virus particles Courtesy of R. Fleck, National Institute of Biological Standards and Control, UK Influenza Virus Infection can lead to: pneumonia sinus/ear infection worsening of chronic conditions (asthma, diabetes, heart disease) Death Causative agent of influenza
    39. 39. Experimental Overview Strain & Plasmid-Encoded Antigens χ11791: ΔPmurA25::TT araC PBAD murA ΔasdA27::TT araC PBAD c2 Δ(wza-wcaM)-8 Δpmi-2426 ΔrelA198::araC PBAD lacI TT ΔsifA26 Plasmids with pBR ori, p15A ori and pSC101 ori NP NP-HA HA210-219 - 3aa linker - HA450-460 (24aa total C-terminal of NP)
    40. 40. T Cell Response Post-Challenge Oral Delivery pBR pSC101p15A Peripheral Blood Lung
    41. 41. Antigen-Specific CD8+ T Cell Response to Influenza Challenge (Day 8 post-challenge) NP antigen codon optimized for high level expression by oral Salmonella vaccine %NP147-155Tet+ ,CD44hi (oftotalCD8+Tcells) N aive C ontrol B SG pB R orip15A oripSC 101 ori 0 5 10 15 20 %NP147-155Tet+ ,CD44hi (oftotalCD8+Tcells) N aive C ontrol B SG pB R orip15A oripSC 101 ori 0 1 2 3 4 5 Lung Peripheral Blood
    42. 42. Weight Loss and Mortality NP antigen codon optimized for high level expression by oral Salmonella vaccine Weight Loss Mortality ori
    43. 43. Final RASV-Influenza Vaccine (based on ability to induce 100% protective immunity to influenza challenge in mice by individual delivery of M2e, NP and HA antigens) • Will deliver conserved M2e fused to WHV core by regulated delayed lysis in endosome •Will deliver conserved NP-HA epitope and NP- M1 fusion antigens after escape from the endosome into cytosol by regulated delayed lysis for class I MHC presentation •Will deliver DNA vaccine encoding variable HA antigens by regulated delayed lysis in the cytosol with targeting of synthesized protective antigens to proteosome
    44. 44. This research is supported in part by grants from: Bill and Melinda Gates Foundation United States Department of Agriculture National Institute of Food and Agriculture
    45. 45. Tiana Golding Qingke Kong Maria Dolores Juarez-Rodriguez Jiseon Yang Shifeng Wang Wei Kong Amanda GonzalesSoo-Young Wanda Bronwyn Gunn Josie Clark-Curtiss Blessing Okon Shamaila Ashraf

    ×