Anis2 Gp Tonini

817 views

Published on

Published in: Health & Medicine, Technology
  • Be the first to comment

  • Be the first to like this

Anis2 Gp Tonini

  1. 1. Micro and nanotechnologies in cancer diagnostics and therapy<br />Alp Nano Bio International School 2January 11-15, 2010, <br />Sterzing (Bolzano, Italy)<br />OMICS profiling and prognostic significance in cancer<br />Gian Paolo Tonini<br />Translational Pediatric Oncology, <br />National Cancer Research Institute, Genoa, Italy<br />
  2. 2. Outline<br /><ul><li>Microarraytechnology
  3. 3. Genome copy numbervariation
  4. 4. Gene expressionprofiling
  5. 5. From single gene to the genome and prognostic value
  6. 6. Gene expressionprofileasprognosticmarker
  7. 7. Genome-transcriptomeintegration
  8. 8. miRNAsignature and miRNA-mRNAintegrationassociatedtopoorpatientsurvival</li></li></ul><li>Microarray Technology <br />
  9. 9. Target preparation<br />Probe preparation<br />Data analysis<br />GENERAL DNA MICROARRAY PROCEDURE <br />
  10. 10. SPOT<br />TARGET<br />ARRAY<br />ARRAY SET<br />PROBES<br />ROWS<br />COLUMNS<br />NOMENCLATURE FOR MICROARRAYS<br />
  11. 11. Non-Target<br />Nucleic Acid<br />TAAGCGTTGAG<br />Target<br />Nucleic Acid<br />A<br />C<br />G<br />T<br />T<br />C<br />C<br />G<br />A<br />A<br />T<br />GCAAGGCTT<br />A<br />C<br />G<br />T<br />T<br />C<br />C<br />G<br />A<br />A<br />A<br />C<br />G<br />T<br />T<br />C<br />C<br />G<br />A<br />A<br />Spot 1<br />Spot 2<br />DNA MICROARRAY: THE PRINCIPLE <br />Double strand complementarity<br />Each spot<br />
  12. 12. DNA MICROARRAY FABRICATION<br /><ul><li> Mechanical printing technologies
  13. 13. In situ synthesis technologies (oligonucleotides)</li></li></ul><li>MECHANICAL PRINTING<br />MICROARRAY PRINTING TECHNOLOGIES <br />
  14. 14. Probe solution<br />Robotic printing<br />Printed array<br />MECHANICAL PRINTING<br />
  15. 15. MECHANICAL PRINTING TECHNOLOGIES (1)<br />CONTACT DISPENSING: direct contact between the printing mechanism and the solid support<br />- Microspotting pins (TeleChem International)<br />- Tweezer pins<br />- Split pins<br />- PIN- and RINGTM technique (Genetic MicroSystems)<br />
  16. 16. Reservoir<br />Siringe<br />Solenoid valve<br />Piezoelectric crystal<br />Pressure<br />Glass capillary<br />Piezoelectric printing technology<br />Syringe-solenoid printing technology<br />MECHANICAL PRINTING TECHNOLOGIES (2)<br />NONCONTACTINK-JETDISPENSING: ejection of drops from a dispenser onto the surface<br />
  17. 17. HIGH-DENSITY MICROARRAYS<br />&gt; 200.000 probe/slide<br />
  18. 18. PROBE IN SITU SYNTHESIS (1)<br />Photolithography technology (Affymetrix technology)<br />
  19. 19. mRNA reference sequence<br />5’3’<br />…ATGGTGGGAATGGGTCAGAAGGACTCCTATGTGGGTGACG…<br /> TTACCCAGTCTTCCTGAGGATACACCCAC<br /> TTACCCAGTCTTGCTGAGGATACACCCAC<br />Perfect Match Oligo<br />Mismatch Oligo<br />25 mer<br />Perfect match probe cells<br />Fluorescence intensity Image<br />Mismatch probe cells<br />- To control the hybridization specificity <br />- To subtract non-specific hybridization<br />GENECHIP® PROBE ARRAY DESIGN<br />
  20. 20. Affymetrix chips<br />Total RNA<br />5’<br /> AAAAA 3’<br />3’ TTTTT -<br /> AAAAA 3’<br /> TTTTT -<br />1.FIRST STRAND cDNA SYNTHESIS: <br />SuperScript cDNA Synthesis kit (Gibco BRL Life Technology) using a high quality HPLC-purified T7-(dT)24<br />5’<br />5’<br />10. IMAGE ANALYSIS<br />5’<br />2.SECOND STRAND cDNA SYNTHESIS<br />3’<br />3. CLEANUP OF DOUBLE-STRANDED cDNA:<br />phenol/chloroform/isoamyl alcohol extraction, using Phase Lock GelTM (Eppendorf)<br /> AAAAA <br /> TTTTT - <br />5’<br />9. IMAGE ACQUISITION<br />5’<br />3’<br />3’<br /> U<br />Biotinylated<br />ribonucleotides<br />4.BIOTIN LABELING ANTISENSE COPY RNA (cRNA) BioArrayTM HighYieldTM RNA Transcript labeling kit (Enzo Diagnostics). The in vitro transcription reaction is performed by T7 RNA polymerase with biotin-labeled nucleotides<br /> C<br />3’<br />UUUUU 5’<br />8. PROBE ARRAY STAINING<br />5. CLEANUP OF BIOTYNILATED cRNA: RNeasy Mini Kit (Qiagen)<br />7. HYBRIDIZATION<br />6. FRAGMENTATION<br />Tris-acetate, pH 8.1, KOAc and MgOAc<br />RNA<br />Biotyn<br />T7 primer<br />DNA<br />
  21. 21. Resistor Off<br />Resistor On<br />Resistor Off<br />Liquid<br />Vaporizes<br />Fill<br />Reservoir<br />Gas<br />Expands<br />Drop<br />Breaks Off<br />Reservoir<br />Refills<br />&lt; 1 msec<br />A<br />C<br />G<br />G<br />A<br />T<br />G<br />G<br />A<br />T<br />C<br />C<br />G<br />A<br />T<br />T<br />C<br />C<br />A<br />A<br />T<br />T<br />C<br />G<br />PROBE IN SITU SYNTHESIS (2)<br />Phosphoamidite / Ink-Jet process (Agilent Technologies)<br />
  22. 22. Procedure for chip analysis<br />(Agilent Technology) <br />
  23. 23. Cy3<br />Cy5<br />Tumor cells<br />Normal cells<br />TARGET LABELLING (2)<br />Emission spectra of some CyDye fluors<br />2-COLOR ASSAYS:<br />- Fluorophores<br />
  24. 24. Glass slide with sample<br />Replicate slides<br />Image analysis<br />Discard spots with poor quality values<br />Calculate ratios<br />Average data <br />Examine variation of ratio between replicates<br />Visualize data<br />Data report<br />Store data in a database<br />MICROARRAY DATA ANALYSIS<br />
  25. 25. Hybridization efficiency:<br /><ul><li>Diffusion
  26. 26. Kinetics</li></ul>Amount of target in hybridization reaction<br />Length of labelled target molecules<br />Hybridization conditions:<br /><ul><li>Buffer
  27. 27. Time
  28. 28. Stringency</li></ul>Number of target molecules<br />Detection set up:<br /><ul><li>Cy3 vs Cy5
  29. 29. Lasers efficiency</li></ul>FACTOR INFLUENCING THE ARRAY QUALITY <br />Environmental control:<br /><ul><li>Humidity
  30. 30. Temperature
  31. 31. Dust</li></li></ul><li>Genome copy number variation<br />
  32. 32. METAPHASE COMPARATIVE GENOMIC HYBRIDIZATION (CGH)<br />(in our lab since 1998)<br />by Raffaella Defferrari<br />-Whole-genome screeningcapability;<br />- Theresolutionis no less than ~ 10 Mb for loss and gains;<br />- Analysisrequires experienced cytogenetics to determine regions of imbalances<br />
  33. 33. METAPHASE COMPARATIVE GENOMIC HYBRIDIZATION (CGH)<br />(in our lab since 1998)<br />-Whole-genome screeningcapability;<br />- Theresolutionis no less than ~ 10 Mb for loss and gains;<br />- Analysisrequires experienced cytogenetics to determine regions of imbalances<br />
  34. 34. METAPHASE CGH<br />ARRAY CGH<br />(in our lab since 2001)<br />ARRAY CGH PLATFORMS<br />Bacterial Artificial Chromosomes (BACs)<br />Yeast Artificial Chromosomes (YACs) <br />Plasmid Artificial Chromosomes (PACs) <br />Cosmids<br />Matrix CGH<br />1 Mb<br />300 Kb – 2 Mb<br />cDNA<br />&lt; 200 kb<br />cDNA aCGH<br />0.5 – 2 Kb<br />-Whole-genome screeningcapability;<br />- Theresolutionis no less than ~ 10 Mb for loss and gains;<br />- Analysisrequires experienced cytogenetics to determine regions of imbalances<br />Oligonucleotides<br />-This system significantlyincreases resolutionfor localizing regions of imbalance;<br />- Just as with expression microarray screening,analysis is straightforward and automatic<br />Oligonucleotide<br />aCGH<br />(in our lab since 2005)<br />&lt; 6 kb<br />30 – 70 bp<br />Probe length<br />Resolution<br />
  35. 35. Gene view<br />Chromosome view<br />Genome view<br />View of the feature of probe data and annotations<br />CGH Analytics software (Agilent Technologies)<br />
  36. 36. 11q14.1-qter loss <br />Loss:<br />2p25.3-pter:SH3YL - MTCBP-1(9.8 Mb)<br />2p25.1:TAF1B - HPCAL1(0.5 Mb)<br />2p24.3:NAG - FAM49A(1.8 Mb)<br />2p23.3-p23.2:UBXD4 - EMILIN1(5.6 Mb)<br />2p23.1:LYCAT - BIRC6(1.9 Mb)<br />2p22.2:STRN - CDC42EP3(0.7 Mb)<br />2p21-p16.3:THADA - ALF(5.3 Mb)<br />
  37. 37.
  38. 38.
  39. 39. Gene expression profiling<br />
  40. 40. Test RNA<br />Reference RNA<br />Up-regulated gene expression<br />Down-regulated gene expression <br />GENE EXPRESSION PROFILING<br />Quantitate mRNA levels to compare which genes are turned off and on in specific cell states (e.g. tumor vs. normal cell)<br />
  41. 41. The length of the branch is inversely proportional to the degree of similarity<br />Shades of red indicate increased relative expression<br />Shades of green indicate decreased relative expression<br />HIERARCHICAL CLUSTERING ALGORITHM<br />- Provides measures of distance between multiple possible grouping of genes<br />- Sorts all genes, such that similar genes appear near each other.<br />This is shown as a DENDROGRAM<br />
  42. 42. Tumor 1<br />Tumor 2<br />min<br />max<br />HIERARCHICAL CLUSTERING DENDROGRAM OF EXPRESSION DATA <br />Each color patch represents the expression level of the associated gene (ROWS) in each sample (COLUMNS), with a continuum of expression levels from dark green (lowest) to bright red (highest). <br />The Tumor 1 and Tumor 2 are placed on a different trunk<br />65 Genes more highly expressed in Tumor 1 samples than in Tumor 2<br />Cluster 1<br />56 genes more intensely expressed in Tumor 2 tumors than in Tumor 1 ones<br />Cluster 2<br />Bioconductor software <br />(www.bioconductor.org)<br />Cluster method: average linkage<br />Distance metric: euclidean<br />
  43. 43. From single gene to the genome and prognostic valuean example of pediatric cancer<br />
  44. 44. Neuroblastoma: a pediatrictumorofperipheralnervous system<br />5 MARZO 2009<br />
  45. 45. Neuroblastoma onset as a localized or a disseminated tumor<br />Localized tumor: <br />favourable prognosis<br />Metastatic tumor: <br />unvafourable prognosis<br />Primary <br />Tumor<br />
  46. 46. %<br /><ul><li>It is the most common extracranial solid tumor in infancy (comprise 15% of all childhood cancer deaths)</li></ul> 650 new cases / year in the US<br /> 110 new cases / year in Italy<br />localized<br />disseminated<br />STAGING<br />(n=2216, 1979-2005)<br />
  47. 47. C + C - A B <br />Southern blot<br />Double colour FISH analysis <br />on interphase nuclei<br />Detection Of MYCN gene amplification<br />by Katia Mazzocco<br />
  48. 48.
  49. 49. Age at diagnosis<br />INSS stage <br />MYCN status<br />DNA index<br />Shimada histopathology<br />OUTCOME BASED ON RISK FACTORS<br />Maris JM, CurrOpinPediatr 2005, 17:7-13<br />
  50. 50. MOLECULAR PROGNOSTIC FACTORS EVALUATION IN THERAPEUTIC PROTOCOLS <br />1995 - 1999<br />
  51. 51. <ul><li>MYCN gene amplification
  52. 52. Chromosome 1p36 deletion
  53. 53. Chromosome 17q gain
  54. 54. Chromosome 3p, 9p, 11q, 14q deletion</li></ul>GENETIC ABNORMALITIES OF NEUROBLASTOMA SUGGESTED TO PERFORM A PANGENOMIC ANALYSIS BY MICROARRAY<br />
  55. 55.
  56. 56.
  57. 57. Life threatening <br />symptoms <br />NO RANDOMIZATION<br />LINES (Low Intermediate NB European Study)<br />Low Risk Study L2 Patients<br />MYCN single copy<br />L2 &lt; 18 <br />months<br />L2 &lt; 18 <br />months<br />Wide-genome <br />analyses<br />No life threatening <br />symptoms <br />No <br />symptoms<br />Symptoms<br />Genomic type 2<br />Type<br />1 <br />Type<br />2<br />Genomic type 2<br />Genomic type 1<br />Type<br />2<br />Type<br />1<br />Genomic type 1<br />structural<br />changes<br />no <br />structural<br />changes<br />structural<br />changes<br />no <br />structural<br />changes<br />structural<br />changes<br />structural<br />changes<br />no <br />structural<br />changes<br />no <br />structural<br />changes<br />RANDOMIZE<br />NO RANDOMIZATION<br />RANDOMIZE<br />NO RANDOMIZATION<br />Observational<br />nterventional<br />VP/Carbo2<br />-<br />4<br />2<br />-<br />4 VP/<br />Carbo<br />to<br />resolve<br />2<br />-<br />4 VP/<br />Carbo<br />to<br />resolve<br />2<br />-<br />4 VP/<br />Carbo<br />to<br />resolve<br />2<br />-<br />4 VP/<br />Carbo<br />to<br />resolve<br />Interventional<br />2-4 VP/Carbo<br />Observational<br />Co2<br />-<br />4, VP/Carbo2<br />-<br />4<br />LTS<br />LTS<br />LTS<br />LTS<br />2-4 CO, 2-4 VP/Carbo <br />Treatment <br />group<br />a <br />Treatment <br />group<br />b<br />Treatment <br />group<br />c <br />Treatment <br />group<br />c<br />Treatment <br />group<br />c<br />Surgical<br />resection<br />1 <br />year<br />Surgical<br />resection<br />1 <br />year<br />Aim<br />for<br />surgical<br />resection<br />Aim<br />for<br />surgical<br />resection<br />Aim<br />for<br />surgical<br />resection<br />Aim<br />for<br />surgical<br />resection<br />Aim<br />for<br />surgical<br />resection<br />Aim<br />for<br />surgical<br />resection<br />Aim<br />for<br />surgical<br />resection<br />Aim<br />for<br />surgical<br />resection<br />from<br />diagnosis<br />if<br />IDRF <br />from<br />diagnosis<br />if<br />IDRF <br />when<br />IDRF negative<br />when<br />IDRF negative<br />when<br />IDRF negative<br />when<br />IDRF negative<br />when<br />IDRF negative<br />when<br />IDRF negative<br />when<br />IDRF negative<br />when<br />IDRF negative<br />negative<br />negative<br />Study<br />A/I<br />Study<br />A/I<br />Study<br />C/III<br />Study<br />C/III <br />Study<br />B/II<br />Study<br />A/I<br />Study<br />A/I<br />Study<br />C/III<br />Study<br />C/III <br />Study<br />B/II<br />
  58. 58. Gene expression profile as prognostic marker<br />
  59. 59. courtesy of Vermeulen J, ANR 2008<br /><ul><li>update clinical data
  60. 60. predictionanalysisofmicroarray (PAM): a statisticsalmethod</li></ul>forclasspredictionfrom gene expression data<br />
  61. 61. Unbiased amplification of total RNA by Ribo-SPIA® RNA Amplification<br />20 ng RNA<br />High quality RNA<br />Quantification of the 59-gene signature by qPCR <br />PROSPECTIVE STUDY WITHIN CLINICAL PROTOCOL <br />Detection of inhibitors by SPUD assay <br />(Nolan et al., 2006) <br />
  62. 62. Genome-transcriptome integration<br />
  63. 63. Genome analysis of metastatic neuroblastoma<br />By a-CGH using high resolution oligonucleotide Human Genome CGH 44K (Agilent Technologies).<br />Group 1 (49 cases) <br />patients 4S, <br />NMYC normal<br />Group 2(37 cases) <br />patients stage 4;<br />&lt; 18 months; <br />MYCN normal; <br />3 years EFS<br />Group 3(cases 47) <br />patients stage 4; <br />&gt; 19 months;<br />Any case dead for disease.<br />The trend of average number of numerical changes tends to decrease: <br />from Group 1 to Group 3<br />On the contrary<br />The trend of average number of segmental changes tends to increase: <br />From Group 1 to Group 3<br />
  64. 64. Genome analysis of metastatic neuroblastoma<br />By a-CGH using high resolution oligonucleotide Human Genome CGH 44K (Agilent Technologies).<br />Numerical aberrations<br />Structural aberrations<br />The frequency of significant structural changes tends to increase<br />From Group 1 to Group 3<br />The frequency of significant numerical changes tends to decrease<br />From Group 1 to Group 3<br />
  65. 65. Transcriptome analysis of metastatic neuroblastoma<br />Gene expression analysis was performed 11K oligonucleotide microarray (10,163 probes for 8,155 Unigene transcrits)<br />Group 1 vs. Group 2 <br />Group 2 vs. Group 3 <br />30<br />9<br />Group 1 (49 cases) <br />patients 4S, <br />NMYC normal<br />Group 2(37 cases) <br />patients stage 4;<br />&lt; 18 months; <br />MYCN normal; <br />3 years EFS<br />Group 3(cases 47) <br />patients stage 4; <br />&gt; 19 months;<br />Any case dead for disease.<br />4<br />66<br />2<br />109<br />240<br />1436<br />Group 1 vs. Group 3<br />
  66. 66. Cromosome <br />region<br />5’<br />3’<br />5’<br />3’<br />Probe Set<br />Genome and gene expression Intergration<br />Chromosome<br />region<br />Normalized gene<br />Expression data<br />#<br />Probe Set<br />#<br />Probe Set<br />OUTPUT<br />Significant differentially <br />expressed probe sets<br />#<br />Probe Set<br />Significant Analysis Microarray (SAM): a statistical method for finding<br />significant genes in a set of microarray experiments <br />FDR = 0.05<br />
  67. 67. chromosome regions<br />Group 1 vs Group 2 <br />Genes up<br />Gain<br />Minimal Common Regions<br />Genes down<br />Loss<br />
  68. 68. miRNA signature and miRNA-mRNA integration associated to poor patient survival<br />
  69. 69. Chen Y & Stallings RL. Cancer Res 2007<br />THE FUTURE……<br />microRNAs AND Neuroblastoma prognosis<br /><ul><li>Differential Patterns of microRNA Expression in Neuroblastoma Are Correlated with Prognosis (Chen Y & Stallings RL. Cancer Res 2007)
  70. 70. microRNA Signature Highly Correlated With MYCN Amplification (Schulte JH et al. Int. J. Cancer 2008)
  71. 71. microRNAs Are Diagnostic For Pediatric Tumors (Wei JS et al. Clin Cancer Res 2009)
  72. 72. microRNA Signature Associated with Prognosis in High-Risk Stage 4 Neuroblastoma Patients (Scaruffi P. et al., BMC Cancer, 2010)</li></li></ul><li>Survival &lt;30%<br />Can we Predict Outcome?<br /><ul><li>Investigation of miRNAs’s role as outcome predictors in patients with high risk-neuroblastoma
  73. 73. Joint expression analysis of microRNAs and of their target sequences at mRNA level</li></ul>“SHORT-SURVIVORS”: dead of disease within 36 months from diagnosis<br />“LONG-SURVIVORS”: alive with an overall survival time &gt; 36 months<br />
  74. 74. Short-survivors<br />Long-survivors<br />miRNAs signature<br />Human microRNA Microarray v.2 (Agilent Technologies) containing probes for 723 human microRNAs.<br />
  75. 75. mRNA SIGNATURE<br />Short-survivors<br />Long-survivors<br />Gene expression analysis was performed 11K oligonucleotide microarray (10,163 probes for 8,155 Unigene transcrits) Agilent Technology<br />
  76. 76. hsa-miR-877*<br />hsa-miR-383<br />hsa-miR-548d-5p<br />hsa-miR-939<br />Short-survivors<br />9<br />5.5<br />Long-survivors<br />6<br />4.0<br />8<br />5.0<br />4.5<br />5<br />3.5<br />7<br />4.0<br />6<br />3.0<br />4<br />3.5<br />5<br />2.5<br />3<br />3.0<br />4<br />2.0<br />2.5<br />2<br />3<br />0<br />1<br />0<br />1<br />0<br />1<br />0<br />1<br />P = 0.028<br />P = 0.020<br />P = 0.044<br />P = 0.028<br />NTRK1<br />FYN<br />CHD5<br />miRNAs<br />target mRNAs<br />&<br />
  77. 77. mRNA_1<br />mRNA_2<br />mRNA_4<br />mRNA_3<br />mRNA_5<br />mRNAome and miRNAome network<br />miRNA_1<br />miRNA_5<br />miRNA_3<br />miRNA_2<br />miRNA_6<br />miRNA_4<br />
  78. 78. NOW<br />MLPA<br />Translation of Omics to the Clinic<br />NEXT<br />mRNA/miRNA signature<br />Array CGH<br />Howwillchange the moleculardiagnosisofcancer<br />1990<br />Southern blot<br />FISH<br />LOH - PCR<br />
  79. 79. Flow chart for <br />OMICs patient risk prediction <br />in cancer<br />
  80. 80. DNA copy number<br />Numerical<br />Aberrations<br />Segmental<br />Aberrations<br />RNA expression profiling<br />Trisomies<br />Unfavorable<br />Signature<br />Favorable<br />Signature<br />Very low<br />Low<br />High<br />Intermediate<br />Risk for death<br />USING OMICS TO PREDICT PATIENT OUTCOME<br />A model<br />
  81. 81. CENTRALIZATION <br />Reference National Pathology Lab<br />Therapy<br />Surgical Room<br />≥60% Nb<br />10-20<br /> days<br /><ul><li> Standardized Procedures
  82. 82. Correct Storage Of Biological Samples</li></ul>Clinicians<br />SIOPEN-R-NET<br />Central Database<br />Reference National Lab For Biology Studies<br />MYCN, 1p36 FISH<br />MLPA/array CGH<br />... RT-qPCR<br />
  83. 83. Something more…<br />Identification of malignant and stromal cells gene signature<br />
  84. 84. Laser CaptureMicrodissectionof stromal and tumorcells<br />Stroma<br />Tumor<br />Tumor cells<br />Stromal cells<br />- Tumor cells mainly express genes associated with cell replication, DNA repair and antiapoptoticpathways;<br />- Stromal cells express genes of cell-cell communication and apoptosis.<br />Albino D. et al., CANCER, 2008, 113/6: 1412-22<br />
  85. 85. Isolation of tumor cells by laser microdissection<br />
  86. 86. Stromal cells<br />Tumor cells<br />
  87. 87. Intratumor homogeneity <br />of cells with similar phenotype<br />
  88. 88. PMP2<br />UTS2<br />TSPAN8<br />CDH1<br />EGR3<br />AASS<br />MEOX2<br />SLC22A3<br />RABGAP1L<br />ASPA<br />TGFBR3<br />LAMA2<br />P2RY14<br />EDNRB<br />GPR126<br />CYP1B1<br />FYCO1<br />GPM6B<br />TRIM38<br />CXCL14<br />CFI<br />ASPM<br />ABCA8<br />CALCA<br />CXCL13<br />PLP1<br />TNNC1<br />ABCA6<br />CDH19<br />IL7<br />MYOT<br />CENTD1<br />DUSP22<br />NR4A2<br />FLJ22184<br />ANGPTL7<br />MATN2<br />TRIP6<br />GINS1<br />GPC3<br />CDC25A<br />CHL1<br />GDAP1L1<br />GPM6B<br />TOP2A<br />CALB1<br />FOXO1A<br />CENPF<br />TNRC9<br />SST<br />ELF1<br />MICA<br />AHNAK<br />EPHA2<br />LOC55565<br />PBK<br />ST6GALNAC2<br />CLU<br />CXXC4<br />CDH10<br />BIRC5<br />SDC4<br />CDC14B<br />CRYL1<br />SSPN<br />MLF1IP<br />NDRG2<br />MAL<br />BUB1B<br />ARHGAP15<br />SPAG5<br />MCM4<br />RRM2<br />SPTLC2<br />BACE2<br />GREB1<br />C4A<br />C4B<br />ITPR3<br />214046_at<br />HBEGF<br />CFLAR<br />STARD13<br />IGF2BP3<br />APOD<br />BACE2<br />EZH2<br />ITPR3<br />VASH2<br />HBEGF<br />C4B<br />ENDOD1<br />CFLAR<br />VASH2<br />ARHGAP15<br />STARD13<br />MCM4<br />APOD<br />IGF2BP3<br />C4A<br />214046_at<br />CDC14B<br />SPTLC2<br />SPEG<br />MMP12<br />FEV<br />TTK<br />MGC17330<br />ENDOD1<br />MYCN<br />PRC1<br />CCND3<br />POU4F2<br />NOL5A<br />GATA3<br />TMEM132A<br />HIST3H2A<br />KCTD12<br />DPYSL4<br />PHOX2A<br />MGC17330<br />HIST3H2A<br />RGL1<br />RGL1<br />PHOX2A<br />DPYSL4<br />NOL4<br />MGC39900<br />TMEM132A<br />PRC1<br />POU4F2<br />NOL5A<br />TOP2A<br />CYP1B1<br />INSM1<br />INSM1<br />CD59<br />CD59<br />FEV<br />CYP1B1<br />MYCN<br />GDAP1L1<br />CCND3<br />TNRC9<br />SPEG<br />FOXO1A<br />KCTD12<br />CDC25A<br />MGC39900<br />GINS1<br />TSPAN8<br />ELF1<br />UTS2<br />CXXC4<br />PMP2<br />MLF1IP<br />AHNAK<br />CDH1<br />EGR3<br />LOC55565<br />MYOT<br />NDRG2<br />ABCA6<br />FLJ22184<br />CDH19<br />MATN2<br />PLP1<br />BUB1B<br />TNNC1<br />DUSP22<br />IL7<br />BIRC5<br />CXCL13<br />TTK<br />ST6GALNAC2<br />CALCA<br />AASS<br />EZH2<br />MEOX2<br />SPAG5<br />MMP12<br />SLC22A3<br />RRM2<br />CHL1<br />PBK<br />EYA1<br />GPM6B<br />NHLH2<br />TRIM38<br />RP11-35N6.1<br />EDNRB<br />SOX4<br />TRIP6<br />TMSL8<br />SST<br />NBLA00301<br />GPC3<br />TFAP2B<br />MAB21L2<br />CALB1<br />MICA<br />GATA3<br />MAL<br />SLC17A6<br />SDC4<br />LOC157627<br />NOL4<br />EPHA2<br />SSPN<br />CLU<br />CDH10<br />CRYL1<br />GREB1<br />GPM6B<br />GPR126<br />FYCO1<br />CXCL14<br />LAMA2<br />CFI<br />CENPF<br />CYP1B1<br />MAL<br />P2RY14<br />PBK<br />CENTD1<br />CENPF<br />TGFBR3<br />GPC3<br />NR4A2<br />MICA<br />RABGAP1L<br />GPM6B<br />ASPA<br />CHL1<br />ABCA8<br />TRIM38<br />ANGPTL7<br />TRIP6<br />ASPM<br />NBLA00301<br />SST<br />EPHA2<br />TFAP2B<br />CALB1<br />MAB21L2<br />NHLH2<br />SSPN<br />SDC4<br />RP11-35N6.1<br />EYA1<br />CLU<br />CDH10<br />LOC157627<br />SLC17A6<br />CRYL1<br />SOX4<br />ENDOD1<br />TMSL8<br />GREB1<br />LAMA2<br />GPR126<br />CFI<br />CXCL14<br />FYCO1<br />GPM6B<br />ABCA8<br />ASPM<br />RABGAP1L<br />ASPA<br />CALCA<br />CYP1B1<br />P2RY14<br />TGFBR3<br />EDNRB<br />CENTD1<br />CXCL13<br />CDH19<br />10<br />TNNC1<br />PLP1<br />ABCA6<br />IL7<br />ANGPTL7<br />NR4A2<br />AASS<br />MEOX2<br />SLC22A3<br />PMP2<br />UTS2<br />EGR3<br />TSPAN8<br />CDH1<br />MYOT<br />PHOX2A<br />MYCN<br />RGL1<br />HIST3H2A<br />DPYSL4<br />MGC17330<br />FEV<br />PRC1<br />POU4F2<br />MGC39900<br />CDC25A<br />CXXC4<br />GDAP1L1<br />GINS1<br />DUSP22<br />FLJ22184<br />MATN2<br />8<br />NOL5A<br />TOP2A<br />SPEG<br />TNRC9<br />CD59<br />2182-LMA-2.CEL<br />INSM1<br />CCND3<br />TMEM132A<br />KCTD12<br />FOXO1A<br />CYP1B1<br />ELF1<br />MMP12<br />TTK<br />C4A<br />214046_at<br />EZH2<br />IGF2BP3<br />STARD13<br />APOD<br />C4B<br />CDC14B<br />CFLAR<br />SPTLC2<br />MCM4<br />VASH2<br />HBEGF<br />ITPR3<br />ARHGAP15<br />BACE2<br />SPAG5<br />RRM2<br />MLF1IP<br />6<br />NDRG2<br />BIRC5<br />BUB1B<br />AHNAK<br />LOC55565<br />ST6GALNAC2<br />EYA1<br />NHLH2<br />RP11-35N6.1<br />MAB21L2<br />TFAP2B<br />NBLA00301<br />LOC157627<br />SLC17A6<br />NOL4<br />GATA3<br />SOX4<br />TMSL8<br />4<br />10<br />8<br />6<br />4<br />4<br />6<br />8<br />10<br />4<br />6<br />8<br />10<br />Laser Microdissectionoftumorcells and dendogramof gene expressionprofiling<br />C<br />A<br />B<br />2182-LMA-1<br />2182-LMA-1<br />2182-LMA-2<br />2182-LMA-1<br />2182-LMA-3<br />F<br />D<br />E<br />2182-LMA-2<br />r=0.99<br />2182-LMA-2<br />2182-LMA-3<br />G<br />H<br />I<br />2182-LMA-3.CEL<br />r=0.99<br />r=0.99<br />2182-LMA-3<br />
  89. 89. A<br />B<br />PRC1<br />CXXC4<br />AASS<br />MCM4<br />RRM2<br />ABCA6<br />SPAG5<br />CDH10<br />LOC55565<br />MICA<br />BIRC5<br />EDNRB<br />TMEM132A<br />NOL5A<br />SOX4<br />RP11-35N6.1<br />MGC39900<br />CENTD1<br />SPEG<br />MYOT<br />FLJ22184<br />FYCO1<br />TRIM38<br />NBLA00301<br />MAB21L2<br />CALCA<br />POU4F2<br />EZH2<br />CALB1<br />GATA3<br />VASH2<br />MEOX2<br />TTK<br />CDH1<br />SLC17A6<br />GDAP1L1<br />TMSL8<br />MMP12<br />NOL4<br />CXCL13<br />MLF1IP<br />TOP2A<br />BUB1B<br />GINS1<br />INSM1<br />TFAP2B<br />NHLH2<br />TSPAN8<br />EYA1<br />DPYSL4<br />FEV<br />HIST3H2A<br />CRYL1<br />SPTLC2<br />CDC25A<br />EGR3<br />EPHA2<br />CXCL14<br />MYCN<br />PHOX2A<br />LOC157627<br />CFLAR<br />HBEGF<br />GPC3<br />TRIP6<br />RABGAP1L<br />ENDOD1<br />LAMA2<br />IGF2BP3<br />CENPF<br />ASPM<br />UTS2<br />214046_at<br />TNNC1<br />IL7<br />TNRC9<br />PBK<br />GREB1<br />SLC22A3<br />SST<br />ABCA8<br />PMP2<br />KCTD12<br />CYP1B1<br />GPM6B<br />CDH19<br />AHNAK<br />PLP1<br />MAL<br />ST6GALNAC2<br />APOD<br />RGL1<br />STARD13<br />MATN2<br />ARHGAP15<br />ASPA<br />CD59<br />C4A<br />TGFBR3<br />P2RY14<br />GPR126<br />CLU<br />ELF1<br />CDC14B<br />CFI<br />MGC17330<br />SDC4<br />NR4A2<br />ANGPTL7<br />C4B<br />SSPN<br />CYP1B1<br />CCND3<br />1761-LMA-1<br />GPM6B<br />DUSP22<br />FOXO1A<br />NDRG2<br />ITPR3<br />CHL1<br />1761-LMA-1<br />1761-LMA-2<br />BACE2<br />12<br />10<br />8<br />6<br />1761-LMA-2<br />r=0.97<br />D<br />C<br />4<br />4<br />6<br />8<br />10<br />12<br />Laser Microdissectionof stromal cells and dendogramof gene expressionprofiling<br />
  90. 90. THANKS TO.....<br />Paola Scaruffi<br />Simona Coco<br />Sara Stigliani<br />Francesca Valdora<br />Carla De Vecchi<br />Translational Paediatric Oncology <br />IST, Genoa, Italy<br />Stefano Bonassi<br />Clinical and Molecular Epidemiology <br />IRCCS San RaffaelePisana, <br />Roma, Italy<br />JessicaThieben<br />Andrè Oberthuer <br />Matthias Fischer<br />Barbara Hero<br />Frank Berthold <br />Paediatric Oncology Centre, Children’s Hospital, <br />Cologne, Germany<br />Stefano Moretti<br />Fabio Gallo<br />Molecular Epidemiology<br />IST, Genoa, Italy<br />FINANCIAL SUPPORT<br />Italian Neuroblastoma Foundation<br />Associazione Italiana per la Ricerca sul Cancro<br />Ministero dell’Università, Ricerca Scientifica e Tecnologica<br />

×