Your SlideShare is downloading. ×
  • Like
Michael 2011 japan
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Now you can save presentations on your phone or tablet

Available for both IPhone and Android

Text the download link to your phone

Standard text messaging rates apply

Michael 2011 japan

  • 1,561 views
Published

 

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
1,561
On SlideShare
0
From Embeds
0
Number of Embeds
1

Actions

Shares
Downloads
2
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. A Grammar of Graphics for Genomics The ggbio Package Michael Lawrence Genentech August 29, 2012Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 1 / 18
  • 2. Outline1 Motivation2 High-level Plots3 Grammar Components Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 2 / 18
  • 3. Outline1 Motivation2 High-level Plots3 Grammar Components Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 3 / 18
  • 4. Data on the Genome • Comes in two flavors: • Annotations (genes, TF binding sites, ...) • Experimental measurements (sequence reads) • Both types are tied to genomic coordinates, providing a common axis that permits cross-dataset comparison and inference • Typically stored as a table, with the range as a fundamental variable type, plus metadata Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 4 / 18
  • 5. Data on the Genome • Comes in two flavors: • Annotations (genes, TF binding sites, ...) • Experimental measurements (sequence reads) • Both types are tied to genomic coordinates, providing a common axis that permits cross-dataset comparison and inference • Typically stored as a table, with the range as a fundamental variable type, plus metadata 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 4 / 18
  • 6. Data on the Genome • Comes in two flavors: • Annotations (genes, TF binding sites, ...) • Experimental measurements (sequence reads) • Both types are tied to genomic coordinates, providing a common axis that permits cross-dataset comparison and inference • Typically stored as a table, with the range as a fundamental variable type, plus metadata 60 50 40 30 20 10 0 120928000 120930000 120932000 120934000 120936000 120938000 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 4 / 18
  • 7. Data on the Genome • Comes in two flavors: • Annotations (genes, TF binding sites, ...) • Experimental measurements (sequence reads) • Both types are tied to genomic coordinates, providing a common axis that permits cross-dataset comparison and inference • Typically stored as a table, with the range as a fundamental variable type, plus metadata 60 50 40 30 20 10 0 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 4 / 18
  • 8. Data on the Genome • Comes in two flavors: • Annotations (genes, TF binding sites, ...) • Experimental measurements (sequence reads) • Both types are tied to genomic coordinates, providing a common axis that permits cross-dataset comparison and inference • Typically stored as a table, with the range as a fundamental variable type, plus metadata seqnames start end strand exon id tx id 10 120927215 120928045 - 129230 14886,14887 10 120928689 120928854 - 129229 14886,14887 10 120931894 120931997 - 129228 14886,14887 10 120933249 120933384 - 129227 14886,14887 10 120933963 120934069 - 129226 14886 10 120933963 120934104 - 119757 14887 10 120936533 120936665 - 119756 14887 10 120936552 120936665 - 129225 14886 10 120938267 120938345 - 129224 14886,14887 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 4 / 18
  • 9. ChallengesBig data, wide spaces • Need summaries that are efficiently computed, communicate more with less and expose the most interesting aspects of the data • Need different ways of viewing the data, depending on the density and scale, from whole genome to single basepair Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 5 / 18
  • 10. ChallengesBig data, wide spaces 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb • Need summaries that are efficiently computed, communicate more with less and expose the most interesting aspects of the data • Need different ways of viewing the data, depending on the density and scale, from whole genome to single basepair Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 5 / 18
  • 11. ChallengesBig data, wide spaces 60 50 40 30 20 10 0 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb • Need summaries that are efficiently computed, communicate more with less and expose the most interesting aspects of the data • Need different ways of viewing the data, depending on the density and scale, from whole genome to single basepair Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 5 / 18
  • 12. ChallengesBig data, wide spaces 300000 250000 200000 150000 100000 50000 0 0 Mb 50 Mb 100 Mb • Need summaries that are efficiently computed, communicate more with less and expose the most interesting aspects of the data • Need different ways of viewing the data, depending on the density and scale, from whole genome to single basepair Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 5 / 18
  • 13. Existing ToolsUCSC IGB IGV Circos GViz Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 6 / 18
  • 14. Existing ToolsUCSC IGB IGV Circos GViz Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 6 / 18
  • 15. Existing ToolsUCSC IGB IGV Circos GViz Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 6 / 18
  • 16. Existing ToolsUCSC IGB IGV Circos GViz Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 6 / 18
  • 17. Existing ToolsUCSC IGB IGV Circos GViz Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 6 / 18
  • 18. Existing ToolsUCSC IGB IGV Circos GViz Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 6 / 18
  • 19. Existing ToolsUCSC IGB IGV Circos GVizLimitations • Limited to one type of view (linear or circular) • Not tightly integrated with an analysis environment through standard, abstract data structures (except GViz) • No low-level toolkit for prototyping new types of graphics Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 6 / 18
  • 20. Grammars of Graphics • A grammar of graphics is a language for expressing plots • Graphics are constructed through the combination of various types of primitives; like legos for graphics • The most prominent grammar was introduced by Wilkinson’s book The Grammar of Graphics • Wilkinson’s grammar was extended by Wickham and the ggplot2 package Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 7 / 18
  • 21. Grammars of Graphics • A grammar of graphics is a language for expressing plots • Graphics are constructed through the combination of various types of primitives; like legos for graphics • The most prominent grammar was introduced by Wilkinson’s book The Grammar of Graphics • Wilkinson’s grammar was extended by Wickham and the ggplot2 package Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 7 / 18
  • 22. Grammars of Graphics • A grammar of graphics is a language for expressing plots • Graphics are constructed through the combination of various types of primitives; like legos for graphics • The most prominent grammar was introduced by Wilkinson’s book The Grammar of Graphics • Wilkinson’s grammar was extended by Wickham and the ggplot2 package Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 7 / 18
  • 23. Grammars of Graphics • A grammar of graphics is a language for expressing plots • Graphics are constructed through the combination of various types of primitives; like legos for graphics • The most prominent grammar was introduced by Wilkinson’s book The Grammar of Graphics • Wilkinson’s grammar was extended by Wickham and the ggplot2 package Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 7 / 18
  • 24. The ggbio Package • An R/Bioconductor package that extends the Wilkinson/Wickham grammar for applications in genomics • Integrated with Bioconductor • Operates on standard, abstract genomic data structures • Leverages efficient range-based algorithms • Programming interface has two levels of abstraction: autoplot Maps Bioconductor data structures to plots grammar Mix and match to create custom plots Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 8 / 18
  • 25. Outline1 Motivation2 High-level Plots3 Grammar Components Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 9 / 18
  • 26. Basic PlotsGene Structures Read Alignments Sequence Multiple Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 10 / 18
  • 27. Basic PlotsGene Structures Read Alignments Sequence Multiple 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 10 / 18
  • 28. Basic PlotsGene Structures Read Alignments Sequence Multiple 60 50 40 30 20 10 0 120928000 120930000 120932000 120934000 120936000 120938000 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 10 / 18
  • 29. Basic PlotsGene Structures Read Alignments Sequence Multiple A C G T 120928700 120928750 120928800 120928850 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 10 / 18
  • 30. Basic PlotsGene Structures Read Alignments Sequence Multiple CGTAGGAGAATCCGGTGTCCAGTTCGCTGGGCAGACTTCTCCATGTGTTT 120928690 120928700 120928710 120928720 120928730 120928740 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 10 / 18
  • 31. Basic PlotsGene Structures Read Alignments Sequence Multiple 60 50 40 30 20 10 0 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 10 / 18
  • 32. Overview PlotsGrand Linear Karyogram Circular Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 11 / 18
  • 33. Overview PlotsGrand Linear Karyogram Circular Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 11 / 18
  • 34. Overview PlotsGrand Linear Karyogram Circular 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X seqReg Exon Intron Other 5.0e+07 1.0e+08 1.5e+08 2.0e+08 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 11 / 18
  • 35. Overview PlotsGrand Linear Karyogram Circular 21 22 1 20 50M 50M 0M 0M 100M 0M 150M 50M 19 200M 0M M 50 0M 0M 18 2 M 50 M 50 0M 10 0M 0M 15 q 17 0M 20 M 50 q q 0M q 0M q 16 M 50M 50 3 q 0M 100M q 100M q 150M rearrangements 15 50M q q interchromosomal q q q q 0M intrachromosomal 0M 50M 100M tumreads 4 q 4 14 q 50M 100M 0M 150M q 6 q q 8 q 100M 0M q 10 13 q q 12 50M 50M 0M q 100M 5 q q 15 0M 10 0M 50 q 12 M 0M 0M 50 M q 10 0M 10 6 M 0 15 50 0M M 11 0M 0M 50 10 M 100M 0M 50M 150M 7 0M 0M 10 50M 100M 100M 50M 0M 9 8 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 11 / 18
  • 36. Specialized PlotsMismatch summary + VCF Edge-linked Intervals Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 12 / 18
  • 37. Specialized PlotsMismatch summary + VCF Edge-linked Intervals 15 10 read mismatch A Counts C G T 5 0 snp T referenceA T T A A G A A A G T A C C G T G T G A C A T C A C A G G C T G G G A G C T T G A G A G 25235720 25235725 25235730 25235735 25235740 25235745 25235750 25235755 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 12 / 18
  • 38. Specialized PlotsMismatch summary + VCF Edge-linked Intervals 1000 800 Expression group 600 GM12878 400 K562 200 0 uc002raw.2 uc010yjh.1 uc002rav.2 uc010yjg.1 uc002rau.2 10930000 10940000 10950000 10960000 10970000 10980000 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 12 / 18
  • 39. Outline1 Motivation2 High-level Plots3 Grammar Components Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 13 / 18
  • 40. The Wilkinson/Wickham Grammar of Graphics Geom The shape used for drawing the data Stat Transforms the data before plotting Scale Maps data to geom aesthetics, guides like legends and axes Coord Maps from geom space to device space Facet Small multiples of data subsets (trellis) Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 14 / 18
  • 41. The Wilkinson/Wickham Grammar of Graphics Geom The shape used for drawing the data Stat Transforms the data before plotting Scale Maps data to geom aesthetics, guides like legends and axes Coord Maps from geom space to device space Facet Small multiples of data subsets (trellis) Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 14 / 18
  • 42. The Wilkinson/Wickham Grammar of Graphics Geom The shape used for drawing the data Stat Transforms the data before plotting Scale Maps data to geom aesthetics, guides like legends and axes Coord Maps from geom space to device space Facet Small multiples of data subsets (trellis) Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 14 / 18
  • 43. The Wilkinson/Wickham Grammar of Graphics Geom The shape used for drawing the data Stat Transforms the data before plotting Scale Maps data to geom aesthetics, guides like legends and axes Coord Maps from geom space to device space Facet Small multiples of data subsets (trellis) Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 14 / 18
  • 44. The Wilkinson/Wickham Grammar of Graphics Geom The shape used for drawing the data Stat Transforms the data before plotting Scale Maps data to geom aesthetics, guides like legends and axes Coord Maps from geom space to device space Facet Small multiples of data subsets (trellis) Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 14 / 18
  • 45. The Wilkinson/Wickham Grammar of Graphics Geom The shape used for drawing the data Stat Transforms the data before plotting Scale Maps data to geom aesthetics, guides like legends and axes Coord Maps from geom space to device space Facet Small multiples of data subsets (trellis) Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 14 / 18
  • 46. A Grammar of Graphics for GenomicsExtensions are marked in red geometric object: Y scale: discrete chevron geometric object: rect from stepping color scale: discrete 2 from strand strandstatistical transformation: +stepping − geometric object: 1 alignment 48.245 Mb 48.260 Mb 48.265 Mb 48.270 Mb X scale: sequence 48.250 Mb 48.255 Mb Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 15 / 18
  • 47. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 48. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet NM_014098(GeneID:10935) NM_006793(GeneID:10935) 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 49. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet NM_014098(GeneID:10935) NM_006793(GeneID:10935) 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 50. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet NM_014098(GeneID:10935) NM_006793(GeneID:10935) 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 51. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet NM_014098(GeneID:10935) NM_006793(GeneID:10935) 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 52. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet NM_014098(GeneID:10935) NM_006793(GeneID:10935) 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 53. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet original reduced 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 54. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet stepping 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 55. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet 60 50 40 Coverage 30 20 10 0 120928000 120930000 120932000 120934000 120936000 120938000 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 56. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet 60 50 40 A Counts 30 C G T 20 10 0 120928000 120930000 120932000 120934000 120936000 120938000 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 57. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet 60 50 40 A Counts C 30 G 20 T 10 0 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 58. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet original truncated Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 59. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet 2000 1500 normal 1000 500 0 score 2000 500 1000 1500 1500 novel tumor 1000 FALSE TRUE 500 0 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 60. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet 10 11 6e+05 Coverage 4e+05 2e+05 0e+00 0e+00 5e+07 1e+08 0e+00 5e+07 1e+08 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 61. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet 6e+05 Coverage 4e+05 2e+05 0e+00 10 11 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 62. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet 200 150 value Features 5000 100 0 −5000 50 1 2 3 4 5 6 Samples Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 63. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet chr10 chr10 chr10 Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 64. Components of the Genomic Grammar Geom: alignment chevron arch arrow arrowrect Stat: gene reduce stepping coverage mismatch table Scale: sequence genome fold-change giemsa Coord: truncate-gaps Layout: tracks range-facet chr10 chr10 chr10 60 50 40 A Counts C 30 G 20 T 10 0 120.928 Mb 120.93 Mb 120.932 Mb 120.934 Mb 120.936 Mb 120.938 Mb Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 16 / 18
  • 65. Summary • The ggbio package is a toolkit for plotting genomic data and annotations • Available as part of the Bioconductor project • Easy to use and flexible enough to handle the diverse use cases encountered in genomics • Useful plots are automatically generated from Bioconductor data structures using reasonable defaults • New types of plots can be constructed from grammar primitives specially designed for genomics Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 17 / 18
  • 66. AcknowledgementsTengfei YinDi CookRobert Gentleman Michael Lawrence (Genentech) A Grammar of Graphics for Genomics August 29, 2012 18 / 18