TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES1
2
Justin D. Radolf, M.D.1, Allan Pillay, Ph.D.2, and David L...
TAXONOMY1
The recognition of spirochetes as human host-associated organisms with distinctive morphology2
and motility is b...
macromolecular phenotypic traits have been examined in attempts to establish taxonomic1
hierarchies among the spirochetes....
sequenced, is the most complex and, by any standard, the most unusual, consisting of a 1 MB1
linear plasmid and 22 linear ...
denticola appears to have acquired numerous genes from non-spirochete commensals in a1
polymicrobial host microenvironment...
the T. pallidum repeat (tpr) gene family and the acidic repeat protein (arp) gene1
(62,136,226,395) which have been used t...
(31). Two Brachyspira species, B. aalborgi and B. pilosicoli, have been identified as causes of1
human intestinal spiroche...
replication has been achieved by co-cultivation with mammalian cells (78,299). Rabbits are the1
animals of choice for stud...
as candidate outer membrane proteins postulated to contribute to immune evasion by forming a1
system for surface antigenic...
disease (206). In vitro studies and the genomic sequence have revealed that T. denticola possesses a1
substantial repertoi...
(362). Compared to B. aalborgi, isolates of B. pilosicoli are longer (4-12 µm), more coiled, and1
have more pointed ends (...
syphilis rates began to rise with peaks (all well below pre-penicillin levels) occurring approximately1
every 10 years. In...
increases in rates of primary and secondary syphilis among women (58). In 2007, 11,466 cases of1
primary and secondary syp...
spirochetes of the Nichols strain. The similarity between this figure and the three- to four-week1
mean incubation period ...
development of long-acting penicillin preparations in the early 1950s, the WHO, in close1
collaboration with UNICEF, launc...
associated consistently with increased occurrence of gingivitis; conversely, comprehensive oral1
hygiene programs have bee...
It is believed that the incidence rates of spirochetes in human feces were universally high at the1
beginning of the 20th ...
PCR to assess spirochetal burdens in blood samples from rabbits inoculated intratesticularly with1
the Nichols strain (363...
poses to practitioners in all specialties. Fig. 4 illustrates the natural history of untreated syphilis,1
emphasizing the ...
has been noted in studies in which the features of lesions positive by darkfield (DF) microscopy1
were carefully documente...
(4,190,193,313). Frank granulomatous reactions also are well recognized (4,195,313).1
Constitutional symptoms are common b...
death in 26% of individuals (349). Neurosyphilis is traditionally divided into asymptomatic,1
meningeal, meningovascular, ...
Centers for Disease Control and Prevention (the Syphilis and HIV Study) found, however, that1
HIV infection had only a min...
1
Endemic treponematoses2
Clinical feature of the endemic treponematoses are summarized in Table 1. Primary yaws3
(framboe...
without associated lymphadenopathy. The papular lesion is frequently localized on exposed1
areas of the lower limbs, face,...
conditions. The confusion and controversy over the clinical significance of HIS have not abated1
over the years despite ex...
(DFA-TP) or PCR, while touch preparations or tissue impressions can also be used for DFA-TP.1
CSF is used in the VDRL-CSF ...
required for testing, either serum separator tubes should be used or blood can be collected1
without anticoagulant and lef...
Diagnostics, Murrieta, CA). Subsequently press and roll the swab along the side of the tube to1
express the excess fluid a...
sections can be sent at ambient temperature for sectioning and staining. Lesion exudates that1
have been air-dried on micr...
1
T. denticola and other oral treponemes2
Specimen collection for detection, isolation, or identification of T. denticola ...
colon or rectum can serve as material for culture, PCR, or histological examination by light or1
TEM (45,210,267,360). The...
Touch preparations of lesion exudates (81,168) or tissue impressions (68) can serve as samples1
for DFA-TP. DFA-TP identif...
involves deparaffinizing tissue sections and placing slides in uranyl nitrate solution followed by1
silver nitrate solutio...
(28,33,51,52,123,191,233,250,251,262,308,312,329,348) genes have been the most commonly1
used. Although PCR can be perform...
assay for detection of T. pallidum, H. ducreyi, and HSV described by Mackay et al. (233). The1
PCR primers and probes and ...
(5’TGCGCGTGTGCGAATGGTGTGGTC 3’) and R11
(5’CACAGTGCTCAAAAACGCCTGCACG3’) using PCR conditions described by Liu et al.2
(225...
polyclonal antibody derived from an uncharacterized intestinal spirochete (210) or anti-T.1
pallidum and –M. bovis antibod...
frequently by RIT but infectivity testing of serum, blood, and amniotic fluid also has been1
reported (161,230,265,290,291...
appears as a thin film or as discrete, pinpoint colonies on trypticase soy agar medium after 5 to1
14 days (37,210,243). B...
The molecular epidemiology of syphilis is poorly understood, in part, because there has been no1
means to differentiate “s...
Prevention at the CDC, will be introduced to further discriminate among strains (327). The1
subtyping component involves P...
strains from intestinal spirochetosis with the same PFGE pattern in human and dogs suggests1
zoonotic transmission may occ...
other laboratory costs, however, has prompted the development of a plethora of automatable1
enzyme immunoassays (EIAs) mos...
microscope. Compared to the VDRL test, the RPR test has the additional advantage of1
employing a more stable antigen that ...
results are read microscopically at 100X, the highest titer causing flocculation being the1
endpoint. The VDRL test also i...
with equal sensitivity and specificity (53). Given the potential for RPR testing to simplify1
management of neurosyphilis ...
test’s specificity, cross-reactive antibodies were removed by absorption with extracts from the1
non-pathogenic Treponema ...
fluorescence. Standardized controls which produce negative, 1+ and 4+ fluorescence readings,1
must be included in each ass...
and the antigen matrix (332). Because there is no separate absorption step, the TP-PA is simpler1
to set up than the MHA-T...
IgM antibodies captured by immobilized anti-human IgM. The second format, referred to as the1
sandwich method, employs rec...
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES
Upcoming SlideShare
Loading in...5
×

TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES

421

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
421
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
3
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Transcript of "TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES"

  1. 1. TREPONEMA AND BRACHYSPIRA, HUMAN HOST-ASSOCIATED SPIROCHETES1 2 Justin D. Radolf, M.D.1, Allan Pillay, Ph.D.2, and David L. Cox, Ph.D.33 4 1Departments of Medicine and of Genetics and Developmental Biology5 University of Connecticut Health Center6 Farmington, CT 060307 8 2Division of STD Prevention, Laboratory Reference and Research Branch9 Centers for Disease Control and Prevention10 Atlanta, GA 3033311 12 3Treponema Immunobiology and Syphilis Serology Activities13 Division of STD Prevention, Laboratory Reference and Research Branch14 Centers for Disease Control and Prevention15 Atlanta, GA 3033316 17 Corresponding author:18 Dr. Justin D. Radolf19 University of Connecticut Health Center20 263 Farmington Avenue21 Farmington, CT 06030-371522 email: JRadolf@up.uchc.edu23 Phone: 860.679.848024 FAX: 860.679.135825
  2. 2. TAXONOMY1 The recognition of spirochetes as human host-associated organisms with distinctive morphology2 and motility is believed to date from the dawn of microscopy, nearly 400 years ago, when Van3 Leeuwenhoek described spiral, nimble “animalcules” in human oral plaque (162).4 Improvements in microscopic methodologies in the twentieth century, particularly the5 development of transmission electron microscopy (TEM), reinforced the notion that spirochetes6 are phylogenetically related by revealing shared ultrastructural features: an outer and7 cytoplasmic membrane surrounding a helical or spiral protoplasmic cylinder and, most8 importantly, the feature that sets them apart from all other prokaryotes, flagellar filaments9 (organelles of motility) running for variable lengths within periplasmic space from the insertions10 points near the cell ends (Fig. 1). Biochemical characteristics, such as resistance to rifampin and11 the presence of ornithine as the diamino acid in the peptidoglycan layer of most, though not all12 (e.g., leptospires), further supported the concept that the phylogenetic relatedness of spirochetes13 is evident from their morphology (320,438). Increasingly sophisticated ultrastructural studies14 during the 1950s and 1960s revealed extensive variation in morphologic features among15 spirochetes consonant with an increased appreciation of their biodiversity (162). These16 pioneering studies laid the foundation for the contemporary viewpoint that spirochetes have17 successfully exploited a basic ultrastructural plan, still largely undefined at the genetic level, to18 accommodate a wide spectrum of physiological activities and lifestyles, both free-living and19 host-associated (184,185,211,284).20 Determination of taxonomic relationships among spirochetes has been complicated by the21 fastidious nature of these bacteria and the refractoriness of many to cultivation in artificial22 medium. As extensively reviewed by Olsen et al. (305), numerous biochemical and23
  3. 3. macromolecular phenotypic traits have been examined in attempts to establish taxonomic1 hierarchies among the spirochetes. Though informative, none of the classification schemes2 covers the entire taxonomic spectrum of spirochetes. In a landmark study, Paster et al. (320)3 demonstrated using 16S ribosomal RNA (rRNA) sequences that spirochetes can be grouped into4 a cohesive phylum comprised of five phylogenetic clusters, Treponema, Spirochaeta¸ Borrelia,5 Serpula (now Brachyspira) and Leptospira (a sixth genus, the bivalve-associated Cristispira,6 was not studied). The degree of relatedness among members of individual clusters varied7 considerably. For example, the interspecies similarities among borrelia were greater than 97%,8 suggesting a relatively recent evolutionary divergence. In contrast, the approximate 10%9 sequence differences among treponemes, a level of dissimilarity often found between members10 of different genera, pointed towards divergence over a much greater evolutionary time frame.11 Interestingly, two free-living spirochetes, S. stenostrepta and S. zuelzerae, were found to be more12 closely related to members of the genus Treponema; the authors speculated that these13 “misclassified” Spirochaeta species may be descendants of the primordial free-living bacterium14 from which host-associated treponemes emerged. Particularly impressive was the depth of15 branching of the phylogenetic tree as a whole. Indeed, the finding that some spirochetes were as16 similar to E. coli as to other spirochetes challenged the monophyletic theory of spirochetal17 origin. Paster and co-workers resolved this dilemma in favor of the monophyletic theory by18 identifying spirochete-specific base signatures in the 16S rRNA sequences, and, ultimately, by19 falling back on ultrastructure as a unifying phenotypic trait.20 The availability of complete genomic sequences has deepened as much as clarified the21 enigmas surrounding the taxonomic and evolutionary relationships among spirochetes (see (303)22 for a comparative analysis of spirochete genomes). The B. burgdorferi genome, the first23
  4. 4. sequenced, is the most complex and, by any standard, the most unusual, consisting of a 1 MB1 linear plasmid and 22 linear and circular plasmids comprising approximately 0.6 MB of coding2 capacity (49,116). Partial genomic sequences of other Lyme disease spirochetes suggest that the3 chromosomes of all Borrelia species have highly similar gene orders (130); the extent of4 variability among the plasmid complements remains undetermined. The 1.14 MB circular5 chromosome of T. pallidum (Nichols strain) is the smallest of the spirochete genomes and the6 most GC rich (52.8%) (117,253). The T. denticola genome also is a circular chromosome but,7 compared to that of T. pallidum, is considerably larger (2.84 MB), has markedly lower G + C8 content (37.9%) and little conservation of gene order (117,378). Amazingly, 1700 coding9 sequences comprising 60% of the T. denticola genome have no orthologs in T. pallidum, while T.10 pallidum contains only 162 genes without matches in T. denticola. Leptospires are unique11 among spirochetes in that they not only possess two circular chromosomes of greatly disparate12 size (4MB and 300 kB) but also utilize a complete tricarboxylic acid cycle and oxidative13 phosphorylation for energy generation. Brachyspira, like leptospires, have extensive14 biosynthetic capacity, including the ability to produce LPS, but are anaerobic and fermentative15 (31). Strikingly, 36% and 15% of the B. hyodysenteriae genome have their best matches with16 proteins from Escherichia and Clostridia, respectively, as opposed to only about 6% best17 matches with other spirochetes (31). Based on these vast differences in genome architectures18 and contents, Norris and Weinstock (303) speculated that the divergence from a common19 spirochete ancestor to the present-day plethora of species may have occurred on the order of a20 billion years ago, truly justifying the designation of spirochetes as ancient. Separation of T.21 pallidum and T. denticola is believed to predate the divergence of E. coli and Salmonella enteric22 subsp. typhimurium approximately 140 million years ago. During this period, the forebear of T.23
  5. 5. denticola appears to have acquired numerous genes from non-spirochete commensals in a1 polymicrobial host microenvironment, while the ancestor of T. pallidum underwent extensive2 genome reduction with limited concomitant gene acquisition, presumably reflecting residence in3 a host niche with a sparse microbiome (303).4 At one time, many investigators believed that, because of their presumptive isolation5 from syphilitic lesions and their morphologic similarity and antigenic cross-reactivity to the6 syphilis spirochete, the cultivatable treponemes were closely related, nonpathogenic forms of T.7 pallidum (89,347,437). In their ground-breaking DNA reassociation kinetics studies, Miao and8 Fieldsteel (263,264) dispelled this idea by demonstrating that T. pallidum DNA shared less than9 5% homology with DNAs of cultivatable treponemes (control salmon sperm DNA showed 2%10 homology) but was indistinguishable from the DNA of a T. pertenue (yaws) strain. Consistent11 with the sRNA sequence data above (320), they also were unable to detect cross-hybridization12 between DNAs from many of the cultivatable treponemal species. The outcome of these13 investigations was the reclassification of the agents of venereal syphilis, endemic syphilis, and14 yaws as subspecies of T. pallidum (subsp. pallidum, endemicum, and pertenue, respectively)15 (387). T. carateum, the cause of the skin disease pinta, retained its status as a distinct treponemal16 species principally because no isolates were available for study (still the case today). For years,17 no means existed to genetically or immunologically differentiate the pathogenic treponemal18 strains and subspecies (16,25,172,297). In 1998, Centurion-Lara et al. (60) described a genetic19 signature, a single base pair change in the 5’ flanking region of the 15-kDA lipoprotein gene20 tpN15) that could be used to distinguish T. pallidum subsp. pallidum from the other pathogenic21 subspecies and from T. paraluiscuniculi, the cause of rabbit venereal spirochetosis. Shortly22 thereafter followed the discovery of hypervariable loci in the T. pallidum genome, most notably23
  6. 6. the T. pallidum repeat (tpr) gene family and the acidic repeat protein (arp) gene1 (62,136,226,395) which have been used to develop molecular typing schemes to distinguish so-2 called “street strains” of syphilis spirochetes (described below) (419) (273,402). Sequence3 variation within the arp gene also has been used to distinguish T. pallidum subsp. pallidum from4 the other pallidum subspecies and T. paraluiscuniculi (146).5 While T. denticola has long been considered the prototype oral treponeme, culture-6 independent investigations revealed that it represents only a small fraction of the resident7 treponemal species in patients with gingivitis and periodontitis (318). In their now classic8 studies PCR-based studies, Paster and colleagues (318,319) identified 76 species of treponemes9 in subgingival samples, 57 of which were uncultivated “phylotypes”. Culture-independent10 investigations have established further that uncultivated treponemal phylotypes are commensals11 of mucosal sites in a wide variety of animal hosts and can be associated with veterinary disease12 states (319). Lesions of papillomatous digital dermatitis, a destructive, polymicrobial infection13 of the feet of cattle and sheep, contain treponemes falling into three separate phylogenetic groups14 that cluster respectively with T. denticola, T. phagedenis, and T. medium/T. vincentii (298,397).15 Numerous morphologically diverse, largely uncultivated treponemal species, distantly related to16 treponemes identified in mammalian sources, reside in the midguts of termites where their17 byproducts are essential nutrients for their insect hosts (34).18 In 1997, all of the Serpulina species were reclassified as Brachyspira based on19 phenotypic and biochemical characteristics, SDS-PAGE protein profiles, DNA hybridization,20 and rRNA sequences (304). B. hyodysenteriae (formerly Treponema hyodysenteriae and21 Serpulina hyodysenteriae), the etiologic agent of swine dysentery, an economically important22 form of mucohemorrhagic colitis in pigs (404), is the best characterized member of the genus23
  7. 7. (31). Two Brachyspira species, B. aalborgi and B. pilosicoli, have been identified as causes of1 human intestinal spirochetosis (HIS) (44,266).2 3 DESCRIPTION OF AGENTS4 Treponema pallidum subspecies5 Four members of the genus Treponema cause the infectious disorders of humans collectively6 referred to as the treponematoses: venereal syphilis, endemic syphilis, yaws, and pinta. These7 organisms, all obligate mammalian parasites, are morphologically identical at both the light and8 electron microscopic levels (172,429) and, despite advances in molecular differentiation (see9 above), are distinguished primarily by differences in geographic distribution, epidemiology,10 clinical manifestations and host range in experimental animals (see Table 1 for a summary of11 salient and distinguishing features of the human treponematoses) (16,260,366). T. pallidum12 subsp. pallidum is the only one routinely transmitted by sexual contact and by vertical13 transmission from a pregnant woman to her fetus (16,260,340). It also is the only subspecies that14 regularly breaches the blood-brain barrier during early infection and that causes central nervous15 system manifestations in a substantial percentage of untreated individuals with late infection16 (246,261). In contrast, congenital transmission of the nonvenereal treponemes does not occur,17 while late sequelae are usually limited to skin, bone, cartilage, and mucosal surfaces (16,260).18 The most extensively studied T. pallidum subsp. pallidum strain (Nichols) was isolated in 191219 from the cerebrospinal fluid of an individual with secondary syphilis (295) and has been20 propagated since by intratesticular inoculation of rabbits (231). Neither this strain nor any other21 strain or subspecies of T. pallidum has been cultivated continuously in vitro, although limited22
  8. 8. replication has been achieved by co-cultivation with mammalian cells (78,299). Rabbits are the1 animals of choice for studying syphilitic infection (376) and have been used to recover strains2 from a variety of clinical specimens by rabbit infectivity testing (RIT) (230,265,352,364,418).3 Although usually described as spiral or helical in shape, Cox (77) and Sequeira (377)4 reported that T. pallidum actually consists of segments of flat waves in multiple planes, a finding5 recently confirmed by Izard et al. (185). T. pallidum are thin (approximately 0.2 m in diameter),6 have tapering ends, and range in length from 6 to 20 m (Fig. 1). Cells typically consist of 6 to 147 waves of varying regularity with a wavelength of 1.1 m and amplitude of ~0.3 m (Fig. 1).8 Because of their small diameter, pathogenic treponemes cannot be visualized by standard bright9 field microscopy, nor do they take up gram stain; they are best visualized by dark-field (in clinical10 settings) or phase-contrast microscopy.11 T. pallidum grows slowly (doubling time of 30 to 33h in rabbits) and poorly tolerates12 desiccation, elevated temperatures, and high oxygen tensions (128,234,302,419). Once classified as13 an anaerobe, it has been re-classified as a microaerophile based on the finding that it replicates best14 in vitro in ambient oxygen concentrations of 3% to 5% (79,302). T. pallidum relies entirely upon15 glycolysis for energy production and is unable to synthesize fatty acids, nucleotides, enzyme16 cofactors, and most amino acids (117). T. pallidum often is stated to be a gram-negative bacterium17 because of its double-membrane ultrastructure. The molecular architecture and composition of its18 cell envelope differ markedly, however, from those of gram-negative bacteria (47,185,339). In19 addition to lacking lipopolysaccharide (117), the outer membrane contains an extraordinarily low20 density of integral membrane proteins, none of which has been unambiguously identified (47). The21 members of the T. pallidum repeat (Tpr) protein family, believed to have arisen from a series of22 gene duplication and homologous recombination events (136), have generated considerable interest23
  9. 9. as candidate outer membrane proteins postulated to contribute to immune evasion by forming a1 system for surface antigenic variation (47,213). Many of the bacterium’s dominant immunogens2 are lipid-modified, periplasmic proteins (47,339) involved in transport of nutrients across the3 cytoplasmic membrane (86-88,90,221,232).4 5 Host-AssociatedSpirochetes6 Treponemes7 Oral treponemes are anaerobic, spiral-shaped organisms ranging from 0.15 to 0.30 µm in diameter8 and from 5 to 16 m in length (with variable lengths within each species) (217). Though not easily9 distinguishable on morphologic grounds, they can be differentiated based on genotypic10 characteristics and biochemical parameters, such as growth requirements, carbohydrate11 fermentation, and enzymatic activities (387). T. denticola, the most intensely studied of the oral12 treponemes, has been identified in specimens from healthy patients as well as in individuals with13 advanced periodontal disease (164,280,281). T. phagedenis, T. refringens, and T. minutum inhabit14 the smegma (sebaceous secretions and desquamated epithelial cells) found beneath the prepuce and15 in other epithelial folds of the genital region. T. phagedenis and T. refringens are 0.20 to 0.25 m in16 diameter, whereas T. minutum tends to be smaller in diameter (0.15 to 0.20 m) (171,217).17 T. denticola not only binds to host cells and extracellular matrix components (84,85,103) but18 also co-aggregates with other bacteria (Porphyromonas gingivalis and Fusobacterium nucleatum)19 found in periodontal pockets (205). Biofilm formation and coaggregation with non-treponemes in20 the periodontal pocket is likely a shared property of the oral treponemes that cause periodontal21
  10. 10. disease (206). In vitro studies and the genomic sequence have revealed that T. denticola possesses a1 substantial repertoire of potential virulence determinants that could contribute to biofilm formation,2 tissue destruction, and other host-pathogen interactions. These include adhesins for epithelial cells3 and extracellular matrix, matrix and tissue-degrading proteases, peptidases, hydrolases, and4 proinflammatory constituents (102,164,375,378). T. denticola contains eight probable ABC-type5 uptake systems for iron chelates or siderophores, suggesting that iron is essential for its metabolic6 activities (378). Although far less invasive than T. pallidum, T. denticola forms abscesses and7 demonstrates a limited degree of hematogenous dissemination in a SCID mouse model of8 endodontic infection (114).9 10 Brachyspira11 B. aalborgi was first described in 1982 following its isolation from rectal biopsy specimens12 obtained from patients with a HIS (173). Because of the difficulty in isolating this extremely13 fastidious anaerobe and the lack of experimental animal models (411), it remains poorly14 characterized and without a means for strain differentiation. The type strain is comma-shaped or15 helical, 2-6 µm long, approximately 0.2 µm in width, with tapered ends and four flagella at each end16 (173). Isolation requires weeks of incubation under anaerobic conditions (107). B. aalborgi has not17 been isolated from animals, although PCR amplification indicates that it may colonize the intestine18 of macaques (94). It is believed to have low pathogenic potential (38). B. pilosicoli, the other19 species associated with HIS, colonizes the large intestine of a number of animal species, causes20 intestinal spirochetosis in pigs, and is thought to have greater pathogenic potential for humans21 (38,220,266). Human strains of B. pilosicoli will colonize chickens (414), pigs (412), and mice22
  11. 11. (362). Compared to B. aalborgi, isolates of B. pilosicoli are longer (4-12 µm), more coiled, and1 have more pointed ends (416). On blood agar plates, isolates of B. pilosicoli display two distinct2 weakly β-hemolytic colony types containing morphologically indistinguishable cells by light and3 electron microscopy (410).4 Intestinal spirochetes can be found in all regions of the colon but show increasing rates of5 colonization from cecum to rectum (207). They reside in the brush border surrounded by microvilli6 with their proximal tips embedded in invaginations of the host cell membrane (Fig. 3). Because of7 their high density and orientation perpendicular to the mucosal surface, in light micrographs stained8 with hematoxylin and eosin, they form a characteristic basophilic fringe often described as a “false9 brush border” (Fig. 3A) (207). Though generally non-invasive and minimally inflammatory, they10 have been observed within colonic epithelial cells, subepithelial cells, and Schwann cells (310) as11 well as causing crypt abscesses, ulceration and necrosis (208). Spirochetemia has been reported in a12 small number of critically ill patients with multiple organ failure (207,413).13 14 EPIDEMIOLOGY AND TRANSMISSION15 Venereal syphilis16 The incidence of primary and secondary syphilis in the United States fell precipitously in the late17 1940s (Fig. 2A) following the introduction of penicillin and the discovery shortly thereafter of its18 high degree of potency, fortunately undiminished after decades of use (393), against all strains of T.19 pallidum (98,293). The development of depot formulations, which enable administration of20 curative doses of penicillin with a single injection (346,439), also must be credited with contributing21 to the disease’s steep post World War II decline. After reaching a nadir in the 1950s, however,22
  12. 12. syphilis rates began to rise with peaks (all well below pre-penicillin levels) occurring approximately1 every 10 years. In a controversial study based on mathematical modeling, Grassly et al. (135),2 contended that the oscillating nature of syphilis epidemics can be explained by waxing and waning3 levels of immunity in at-risk populations and that public health interventions actually set the stage4 for future epidemics by curtailing the spread of herd immunity. Fenton et al. (109) argued5 forcefully against this thesis, maintaining, instead, that epidemiologic determinants are the major6 drivers of syphilis transmission in developed countries and that the syphilis epidemics of 1982 and7 1990, along with the current upsurge which began in 2001 (Fig. 2B) (32,322), involved8 geographically and demographically distinct subpopulations. Indeed, abundant epidemiologic data9 support their position. For example, the peak in the 1960s had a male:female ratio of approximately10 1, reflecting the loosening of sexual mores during that period (i.e., the Sexual Revolution), whereas11 the epidemic of the early 1980s had a clear male predominance and was associated with the massive12 wave of HIV transmission and onslaught of AIDS among men who have sex with men (MSM). It13 was during this epidemic that genital ulceration caused by syphilis first came to be recognized as a14 major co-factor for the transmission of HIV (431). By contrast, the epidemic of the early 1990s15 (Fig. 2B) occurred largely among black heterosexuals in urban areas and the rural South and, in16 urban areas was fueled by the use of crack cocaine and the exchange of sex for drugs (351,353).17 The steep rise in the incidence of congenital syphilis during this period is further evidence for the18 predominance of heterosexual transmission (3). After steady declines throughout most of the 1990s19 to historically low levels (Fig. 2B), and despite the launching of the National Plan to Eliminate20 Syphilis in the United States in 1999, rates of syphilis have increased annually since 200121 (32,58,322). These trends, mirrored throughout Western Europe (241,427), reflect the resurgence of22 risky sexual behaviors among MSM (Fig. 2B) (152) but also, though to a lesser extent, significant23
  13. 13. increases in rates of primary and secondary syphilis among women (58). In 2007, 11,466 cases of1 primary and secondary syphilis were reported to the CDC, a 17.5% increase from 2006 (58).2 Currently, more than 60% of new syphilis infections are estimated to occur in MSM (152).3 Hispanics and African Americans, particularly those in the Southeastern United States, continue to4 be disproportionately affected by the disease, reflecting disparities in socioeconomic status and5 access to quality health care (133,166,322). A recent serosurvey found the prevalence of6 seropositivity for syphilis among all adults aged 18 to 49 years to be 0.71% but 4.3% among non-7 Hispanic blacks (133).8 Syphilis also poses a considerable and escalating threat to global public health. In 1999, the9 World Health Organization (WHO) estimated that 12 million persons acquire syphilitic infection10 each year worldwide (167). The majority of these cases occur in underdeveloped countries,11 particularly Sub-Saharan Africa and South Asia. Eastern Europe and Russia reported dramatic12 increases in the incidence of syphilis with the fall of Communism and the introduction of more13 liberated, “Western” lifestyles (132,212). Alarming increases in syphilis rates in China, attributed to14 the enormous societal and economic changes in that country during the past two decades unleashed15 by the rapid expansion of a free market system, also have been noted (73).16 Transmission of syphilis occurs as a consequence of contact with primary- and secondary-17 stage lesions; numerous treponemes are often present in the ulcers of primary syphilis and the moist18 intertriginous and mucosal lesions of secondary syphilis (Table 1 and Fig. 4). Because microscopic19 abrasions created during sexual activity may contain infectious organisms, persons with early20 syphilis may be infectious even if they lack open lesions. In their human inoculation studies21 conducted at Sing Sing Prison, Magnuson and co-workers (235) observed mean incubation22 periods of 24 days for normal volunteers inoculated intracutaneously with either 10 or 10023
  14. 14. spirochetes of the Nichols strain. The similarity between this figure and the three- to four-week1 mean incubation period (range 10 to 90 days) observed clinically (122,228,392) suggests that2 inocula delivered via sexual activity often are in the vicinity of the ID50 of 57 organisms3 determined by these investigators (235). Although transmission typically occurs during4 intercourse, syphilis outbreaks among MSM have served as a reminder of the importance of5 unprotected oral sex as a means of transmission (55). Estimates of the risk of sexual6 transmission vary greatly, from 10% to 80% (12,276,369,371,384) with the 30% transmission7 rate reported by Schroeter et al (371) a commonly quoted figure. Nonsexual contact with8 mucocutaneous lesions, mainly through kissing, also can transmit the disease (399). Because of9 blood bank serologic screening, transfusion-acquired syphilis has ceased to be of epidemiologic10 importance in developed countries (309,368).11 Vertical transmission of syphilis has been recognized for several centuries (379). The12 presence of spirochetes in the placenta and umbilical cord, along with histopathologic changes13 consistent with syphilis (338,382), supports transplacental invasion as the major route of fetal14 infection. The risk of congenital syphilis ranges from thirty to eighty percent in pregnant15 females with primary or secondary syphilis and decreases as the interval between infection and16 pregnancy lengthens (161,180,311,372). Neonates also may become infected as a result of17 exposure to lesional exudate or infected maternal blood during passage through the birth canal18 (93,399).19 20 Endemic treponematoses21 According to World Health Organization (WHO) estimates, as many as 200 million persons were22 exposed to the endemic treponematoses during their lifetimes in the late 1940s. Exploiting the23
  15. 15. development of long-acting penicillin preparations in the early 1950s, the WHO, in close1 collaboration with UNICEF, launched an extremely successful global program to control the2 endemic treponematoses that decreased disease prevalence by more than 95% over an approximate3 10 year period (16,260). Unfortunately, because of the failure of local health services to maintain4 the momentum established by this initiative, these diseases have staged a comeback with low level5 transmission now occurring in many formerly endemic areas (18). In 1998, the WHO estimated a6 worldwide total of 2.5 million cases, approximately 500,000 of which are infectious and 400,000 of7 which are in Africa (16,260). In contrast to yaws and pinta, which occur in moist tropical regions,8 endemic syphilis is a disease of hot, dry countries; major foci of endemic syphilis still exist in the9 Sahelian region of Africa (Table 1) (260). Pinta is now confined to remote native populations in10 central and South America (Table 1) (260).11 In contrast to venereal syphilis, the agents of yaws and pinta are transmitted by direct12 non-sexual contact with open lesions during childhood or early adolescence (Table 1).13 Transmission of endemic syphilis occurs via infectious lesions on the skin and mucous14 membranes or via shared use of drinking and eating utensils (16,260).15 16 Oral treponemes: gingivitis, periodontal disease, and atherosclerosis17 The epidemiologic importance of T. denticola and other oral treponemes arises from their18 occurrence as components of the polymicrobial consortium that causes gingivitis, a reversible19 inflammation of the soft tissues, and periodontis, which leads to attachment tooth loss20 (163,164,271). Gingivitis is ubiquitous globally in children and adults; more than half of the adult21 population in the United States is estimated to have gingival bleeding, a sentinel indicator (9). Poor22 oral hygiene, leading to accumulation of dental plaque (bacteria in subgingival biofilms), has been23
  16. 16. associated consistently with increased occurrence of gingivitis; conversely, comprehensive oral1 hygiene programs have been shown to be effective in preventing or reducing gingival inflammation2 in children and adults (10). Chronic periodontitis occurs in all age groups but is most common in3 adults and seniors and is more common with cigarette smoking, obesity, diabetes, and alcohol4 consumption (9,405). The National Survey of Employed Adults and Seniors (EAS) and the Third5 National Health and Nutrition Examination Survey (NHANES III) provided comprehensive6 surveillance data on the prevalence of periodontal disease in the United States. Using different7 evaluation criteria and methodologies, these two surveys collectively found evidence of periodontal8 disease in approximately 24% of employed adults and more than 60% of seniors (9,71).9 Periodontitis, therefore, may be one of the most overlooked public health problems in developed10 countries. Moreover, since the 1990s, accumulating evidence has linked periodontal disease with11 atherosclerosis, particularly coronary artery disease and ischemic stroke (17,151), although the12 magnitude of the increased risk is disputed and varies considerably among studies (287,321).13 Several plausible explanations for the association between periodontal disease and atherosclerosis14 have been proposed (151). One is that individuals with periodontitis often have conventional risk15 factors for atherosclerosis, such as smoking behaviors (11,178,179). Another is that the bacterial16 burden of periodontal disease potentiates atherosclerosis by stimulating systemic inflammation17 (124,287). Lastly, the presence of periodontal infection may lead to brief episodes of bacteremia18 with inoculation of atherosclerotic plaques by periodontal pathogens that locally stimulate arterial19 plaque formation (67,118,144). It is important to emphasize that a causal relationship between20 periodontal disease and atherosclerosis remains far from proven.21 22 Intestinal spirochetosis23
  17. 17. It is believed that the incidence rates of spirochetes in human feces were universally high at the1 beginning of the 20th century (207,360). The frequency of spirochetal colonization of the intestinal2 tract has declined dramatically, though is still appreciable, in developed countries and remains quite3 high in the developing world (207,243,268,421). These trends point to factors such as diet,4 sanitation, housing, and water quality as important determinants of transmission of intestinal5 spirochetes (38,207,283). B. aalborgi, lacking animal reservoirs, is probably transmitted via the6 fecal-oral route but spread via ingestion of food or water contaminated with human feces also is7 possible (38). Infection of humans with B. pilosicoli, which is zoonotic, likely occurs by ingestion8 of water contaminated by feces of birds, animals, or other infected humans, or by other forms of9 fecal-oral contact associated with living under poor hygienic conditions (38). In developed10 countries, the prevalence of HIS is greatest in MSM with or without HIV infection; among these11 individuals, the mode of spread is most likely oral-anal contact (104,203,410).12 13 CLINICAL SIGNIFICANCE14 Venereal syphilis15 Although the clinical consequences of syphilitic infection may be delayed for months to years16 (70,228,392,409), venereal syphilis typically commences with the appearance of one or more17 mucocutaneous lesions days to weeks following inoculation (Fig. 4) Microbiologic events,18 however, follow a different and particularly insidious course; during the pre-symptomatic19 incubation period (10 to 90 days), dissemination of spirochetes from the site of inoculation and20 draining lymphatics already is well underway. Studies with animal models in the early part of21 the twentieth century led investigators to conclude that syphilis is systemic almost from the time22 of inoculation (213,340). More recently, this conclusion has been buttressed by using real-time23
  18. 18. PCR to assess spirochetal burdens in blood samples from rabbits inoculated intratesticularly with1 the Nichols strain (363). Reports from the early twentieth century documenting transmission of2 spirochetes by the transfusion of blood from persons with incubating disease also support the3 notion that spirochetes begin to disseminate hematogenously well before the appearance of4 lesions (399). Repeated and probably increasingly intense bouts of dissemination occur during5 untreated primary and secondary disease, further establishing the substrate for the visceral and6 neurologic complications of early and late infection (Fig. 4) (261,399). Indeed, both RIT and7 PCR have demonstrated that viable T. pallidum is present in the cerebrospinal fluid (CSF) of a8 substantial percentage of neurologically asymptomatic patients with primary and secondary9 syphilis, indicating that central nervous system infection (“neuroinvasion”) occurs very early in the10 course of disease (230,261,352). The factors that determine whether CNS infection is cleared11 spontaneously or progresses to symptomatic disease (neurosyphilis) weeks, months, or years later12 are not understood. Many authorities believe that immunosuppression due to HIV infection can tip13 the balance against clearance of spirochetes from the CNS, even with appropriate therapy,14 facilitating the subsequent development of symptomatic neurosyphilis (196) (450,453).15 There are three principal mechanisms by which venereal syphilis can either cause or16 contribute to morbidity and mortality in at-risk populations: (i) damage to viscera, bones,17 cardiovascular structures, and central nervous system resulting from the local inflammatory18 response elicited by the bacterium; (ii) stillbirth and fetal/neonatal demise following fulminant,19 transplacental infection; and (iii) enhancement of bidirectional transmission of HIV across skin and20 mucosal barriers during sexual activity. It should not be surprising that a disease capable of21 inflicting harm to so many different organ systems and body sites would be legendary for its protean22 clinical manifestations (hence its nickname “the great impostor”) and the diagnostic challenges it23
  19. 19. poses to practitioners in all specialties. Fig. 4 illustrates the natural history of untreated syphilis,1 emphasizing the relationship between the stages of the disease, the presence of infectious2 treponemes, and reactivity in serological tests, while Table 2 describes the criteria required for3 diagnosis of the various stages of syphilis. For a comprehensive discussion of the manifestations of4 venereal syphilis, we refer the reader to several excellent chapters (228,392,409). Three general5 points deserve emphasis when considering the clinical features of syphilis from a diagnostic6 standpoint. First, timely diagnosis requires a solid understanding of the complex natural history of7 the disease, the distinction between infectious and non-infectious stages being of utmost public8 health importance, and the myriad ways in which it can present in affected individuals. Failure to9 think of syphilis is the root cause of most misdiagnoses in an era when the disease is far less10 commonplace than when Osler coined his famous aphorism that to know syphilis is to know11 medicine. Second, while demonstration of T. pallidum in clinical specimens is most readily12 accomplished in early syphilis patients with muco-cutaneous lesions, a microbiologic diagnosis13 often can be made in late syphilis. A recent case report describing a 35 year old male with14 longstanding gastric syphilis who underwent partial gastrectomy for presumptive gastric carcinoma15 illustrates both of these points (65). Lastly, serological tests are a critical adjunct for diagnosis in all16 stages of the disease and are the only means for detecting infection in asymptomatic patients with17 latent syphilis (Fig. 4).18 Primary syphilis occurs when spirochetes replicating at the site of inoculation induce a19 local inflammatory response sufficient to generate one or more papules which subsequently20 ulcerate, giving rise to one or more chancres, the defining lesion(s) of primary syphilis. The21 incubation period for this process is usually on the order of three weeks but can take as 90 days22 (Fig. 4). Although the classic chancre is single, indurated, and painless, considerable variability23
  20. 20. has been noted in studies in which the features of lesions positive by darkfield (DF) microscopy1 were carefully documented (63,169). The classic histologic picture of primary syphilis consists2 of proliferating small vessels (neovascularization) surrounded by spirochetes, macrophages,3 lymphocytes, and variable numbers of plasma cells (21,342,376). Tissue necrosis and ulceration4 are believed to result from the reduction of blood flow due to small vessel vasculitis (endarteritis5 obliterans) (21,300). Spontaneous healing of chancres occurs within three to eight weeks,6 coinciding with the influx of sensitized T cells and macrophages and the production of7 opsonizing antibodies (213,342).8 The clinical consequences of spirochete dissemination collectively referred to as9 secondary syphilis, become manifest 4 to 10 weeks after the chancre has appeared (Fig. 4).10 Because chancres often are not visible in women, women with early syphilis tend to present with11 secondary disease; a similar trends has been noted in MSM (450). Although mucocutaneous12 lesions (syphilids) are far and away the most common presentation, secondary syphilis can affect13 virtually any organ system (228,392,409). It is generally believed that the predominance of14 secondary skin lesions, as well as their characteristic distribution on palms and soles, reflects the15 spirochete’s predilection for below-core temperatures (419). Skin lesions may be macular,16 papular, follicular, papulosquamous, or pustular. So-called “nickel and dime” macular lesions on17 the palms of the hands, soles of the feet, and other locations are a common presentation. Raised18 lesions, called condylomata lata, may occur in moist intertriginous areas, and erosions called19 mucous patches may appear on oral and genital mucosa. Cutaneous histologic patterns in20 secondary syphilis have been extensively characterized. Infiltrates consisting of variable21 proportions of lymphocytes, macrophages, neutrophils, and plasma cells, often perivascular in22 distribution, are most intense in the papillary dermis but often extend into the reticular dermis23
  21. 21. (4,190,193,313). Frank granulomatous reactions also are well recognized (4,195,313).1 Constitutional symptoms are common but usually mild (64,159,228,392,399,409).2 Mucocutaneous lesions of secondary syphilis usually resolve spontaneously in approximately 33 to 12 weeks, leading to the “asymptomatic” (or “post-symptomatic”) stage referred to as latency.4 One of the most important findings of the famous Oslo Study of Untreated Syphilis from the5 early twentieth century is that approximately 25% of patients experience secondary relapses (70).6 Although the vast majority of relapses occur within the first year, they can occur as late as five7 years into the illness (70). How and where T. pallidum manages to persist during latency are still8 very much a mystery (213,342).9 According to the Oslo Study, approximately one-third of patients will develop tertiary10 syphilis (69). In the pre-penicillin ear, gummatous syphilis was the most common form of11 tertiary disease, followed by neurosyphilis and cardiovascular syphilis. In the post-antibiotic era,12 all forms of tertiary syphilis have decreased markedly in incidence, and there are no reliable13 figures on the relative frequency of late complications. Benign tertiary or gummatous syphilis is14 a proliferative or destructive granulomatous process usually of skin, bone, or mucous15 membranes, but occasionally involving viscera or CNS (228,392,399,409). Thoracic aortitis is16 the hallmark of cardiovascular syphilis (186,349). Organisms lodge within the vasa vasora, the17 nutrient blood vessels of the aortic adventitia, initiating inflammatory changes which eventually18 cause obliterative endarteritis, adventitial scarring, and patchy medial necrosis with destruction19 of elastic fibers. The resultant weakening of the aortic wall leads to dilatation of the aortic root20 and aneurysm formation. A recent necropsy study of 90 patients with syphilitic aortitis21 described universal, extensive involvement of the tubular portion of the ascending aorta and22 varying degrees of involvement of the aortic arch in 90% of patients; syphilis was the cause of23
  22. 22. death in 26% of individuals (349). Neurosyphilis is traditionally divided into asymptomatic,1 meningeal, meningovascular, and parenchymatous syndromes (131,165,246,261). In the absence2 of treatment, asymptomatic neurosyphilis either resolves spontaneously or progresses to3 symptomatic disease (275). Syphilitic meningitis, which usually occurs within the first two4 years of infection, results from vasculitis of the small vessels lining the meninges.5 Meningovascular syphilis, which typically develops five to ten years post-infection, denotes the6 various stroke syndromes caused by a proliferative endarteritis of small to medium-sized arteries7 that supply blood to CNS parenchyma. The parenchymatous forms of neurosyphilis, generalized8 paresis and tabes dorsalis, are the last in the temporal progression.9 A statistical association between HIV infection and syphilis became evident early in the10 AIDS epidemic (187). Since then, numerous studies have documented the high rate of HIV11 coinfection among syphilis patients (14,92,177,398). Although initially thought to merely reflect12 similar risk factors for acquisition or transmission of the two infections, it has become apparent13 over the years that there are complex epidemiologic and biologic relationships between these14 disorders (112,119,137,359,431). Chancres can facilitate HIV transmission either by increasing15 susceptibility or infectiousness (119). In addition to disrupting normal epithelia or mucosal16 barriers, early syphilis lesions contain infiltrates enriched in activated lymphocytes and17 macrophages, potential targets and donors for HIV (137,254,408,422,423).18 Whether HIV infection worsens the manifestations of early syphilis and/or accelerates the19 course of the disease has been highly controversial. Since the late 1980s, a number of case20 reports and small series have documented ophthalmologic and neurological complications, as21 well as unusual or highly destructive non-neurological syphilis syndromes, in HIV-infected22 patients (170,192,197,230,245,286,341,380). A multi-center prospective study sponsored by the23
  23. 23. Centers for Disease Control and Prevention (the Syphilis and HIV Study) found, however, that1 HIV infection had only a minimal effect on early syphilis (352,358). HIV-infected patients with2 primary syphilis tended to present with more genital ulcers, and genital ulcers were present more3 frequently in HIV-infected patients with secondary syphilis. Manifestations of disseminated4 infection, including neurological complications, however, were not worsened by concomitant5 HIV infection. A principal concern regarding this study is that it focused primarily on early HIV6 infection and may have been under-powered. Indeed, more recent reports do suggest that HIV-7 infected patients, particularly those with lower CD4 counts, may be at greater risk of developing8 symptomatic neurosyphilis (56,126).9 Early congenital syphilis is analogous to the secondary stage of acquired infection and10 can involve almost any fetal organ, with liver, kidneys, bone, pancreas, spleen, lungs, heart, and11 brain the most frequently afflicted (307). As with acquired syphilis, T. pallidum has a12 remarkable propensity to invade the CNS of infected neonates (139,364). In a recent prospective13 study, the spirochete was isolated from the CSFs of 22% of infants with untreated congenital14 syphilis and 60% of infants with abnormalities on physical examination consistent with15 congenital syphilis (265). Interestingly, clinically evident CNS involvement was not seen,16 implying that CNS invasion mainly poses a risk for the child’s subsequent neurological17 development (265). Two years of age is used to demarcate early from late congenital syphilis.18 Late congenital syphilis corresponds to tertiary syphilis in the adult. Late manifestations of19 congenital syphilis are the outcome of chronic, untreated infection and can result in multiple20 stigmata that may not be obvious until the second decade of life (379). The best known stigmata of21 late congenital syphilis are Hutchinson’s teeth, interstitial keratitis, saddle nose deformity, frontal22 bossing, and saber shins (379).23
  24. 24. 1 Endemic treponematoses2 Clinical feature of the endemic treponematoses are summarized in Table 1. Primary yaws3 (framboesia) is characterized by a raised papule at the site of inoculation that enlarges to form a4 hyperkeratotic papilloma (``mother yaw'') before eventually forming a shallow ulcer that can5 persist for months to years often accompanied by regional lymphadenopathy. Crops of highly6 infectious, papular, lobulated, and verrucous secondary lesions appear weeks to months after7 infection, frequently accompanied by painful periostitis; a characteristic feature of these lesions8 is exudation of highly infectious serous fluid (16,260). After one or more multiple infectious9 relapses which can occur up to five years post-inoculation, patients enter an asymptomatic late10 latent period. Approximately 10% of untreated patients progress to tertiary disease, which11 generally consists of solitary destructive lesions of bone or mucocutaneous surfaces. Though not12 part of the classical picture, some authorities maintain that ophthalmologic and neurologic13 complications may occur in late yaws (272,354).14 Endemic syphilis usually begins as a generalized infection in the absence of an obvious15 primary lesion (16,260). It is characterized by ulcerative lesions of the oropharyngeal mucosa16 (mucous patches), hoarseness, angular stomatitis and split papules at the corners of the mouth,17 intertrigial condylomata (similar to those of venereal syphilis), and painful periostitis. Skin18 lesions, such as disseminated papules, may occur but are less numerous than those of secondary19 venereal syphilis. Tertiary gummas, most commonly on the skin, in the nasopharynx, and in20 bone, may result in severe disfigurement. Pinta is unique among the spirochetal diseases in21 being limited to skin (16,260). The initial lesions of primary pinta, appearing after an incubation22 period of 1 week to 4 months, are small squamous papules, which may be single or multiple23
  25. 25. without associated lymphadenopathy. The papular lesion is frequently localized on exposed1 areas of the lower limbs, face, arms, and trunk. The primary papule can resemble a lichenoid,2 eczematoid, or psoriasiform lesion. Secondary lesions (pintids) usually appear two to six months3 after the initial lesion. Pintids are usually smaller, non-pruritic, dyschromic, and more4 morphologically uniform than the primary lesions. Subsequently they may become hyper- or5 hypopigmented and keratotic, particularly over bony prominences. Tertiary lesions are6 characterized by well-defined hyperchromic, hypochromic, achromic, or dyschromic patches of7 skin. Hyperchromic spots occur preferentially in sun-exposed skin areas, hypochromic spots in8 non-exposed areas. Achromic lesions appear mainly over bony prominences on the hands, feet,9 face, and extensor aspects of the extremities.10 11 Intestinal spirochetosis12 The recognition that spirochetes comprise part of the intestinal flora is not new. They were13 probably visualized in human feces by Van Leeuwenhoek in 1719 and were observed by14 microscopy at high rates in systematic surveys of purged or spontaneously evacuated stool samples15 conducted in the early part of the twentieth century (145,360). During this same period, some16 investigators reported localizing spirochetes mainly, though not exclusively, within the large17 intestine, particularly the cecum and ascending colon (360). In 1967, Harland and Lee (145) coined18 the term intestinal spirochetosis to describe a noninflammatory condition of the large bowel in19 which spirochetes attached end-on to the colonic epithelium in a dense, palisade-like arrangement,20 forming a basophilic “false brush border” that was easily overlooked on casual inspection.21 Although they identified spirochetes in 9 of 100 consecutive biopsies examined, they were unable to22 relate the finding to symptomatology because most of the patients had other gastrointestinal23
  26. 26. conditions. The confusion and controversy over the clinical significance of HIS have not abated1 over the years despite extensive phylogenetic and biochemical characterization of intestinal2 spirochetes (see above) and advances in methodologies for their isolation and/or detection (see3 below). Some investigators have reported an association of spirochetes with a variety of intestinal4 symptoms and disorders, such as abdominal pain, chronic diarrhea, rectal bleeding, colitis,5 appendicitis, and pseudoappendicitis, and, anecdotally, have noted improvement with antimicrobial6 therapy (usually metronidazole), whereas others have been unable to correlate the presence of7 intestinal spirochetes with gastrointestinal symptoms or demonstrate any improvement with therapy8 (207,421).9 10 COLLECTION, TRANSPORT, AND STORAGE OF SPECIMENS11 Treponema pallidum-Syphilis12 T. pallidum cannot be cultivated on routine culture media; therefore, the diagnosis of syphilis has13 to rely on the direct detection of the organism in clinical specimens in conjunction with14 serological tests. Due to the complex nature of syphilitic infection, there is no ideal test for the15 direct detection of T. pallidum; test selection is dependent upon the clinical presentation and type16 of specimen obtained (see Table 3 for a summary of specimen types and tests in different stages17 of disease). Polymerase chain reaction (PCR)-based tests are becoming increasingly utilized,18 especially for genital ulcer disease (GUD), because of its higher sensitivity and specificity19 compared to conventional tests (27,40,169,233,250,251,312). Serum, plasma and/or whole20 blood is used for serological testing and, to a limited extent, for PCR. T. pallidum can be21 detected in lesion exudate by DF microscopy, direct fluorescent antibody test for T. pallidum22
  27. 27. (DFA-TP) or PCR, while touch preparations or tissue impressions can also be used for DFA-TP.1 CSF is used in the VDRL-CSF and FTA-ABS-CSF antibody tests and, on occasion, for PCR in2 cases of suspected neurosyphilis in acquired (150,273) and congenital syphilis (139,161,364).3 Tissue biopsies are rarely performed on genital ulcers but are used for diagnosing non-genital4 manifestations of secondary and tertiary disease (29,41,65,278,435,454). PCR can be performed5 on either fixed or unfixed tissue, although unfixed tissue, if frozen immediately, is6 recommended. Other specimens such as lymph node aspirate (209,424) and amniotic fluid7 (139,161,161,364,433) although rarely obtained, can be used for DF, DFA-TP and PCR while8 placenta or cord tissue (125,217) can be used for silver staining, IHC, DFAT-TP, and PCR.9 Laboratory and health care workers should treat clinical specimens as being potentially10 infectious; universal precautions always should be followed when handling, processing and11 testing these specimens (1,2). Serum is the specimen of choice for conventional treponemal and12 non-treponemal serodiagnostic tests but whole blood and plasma also can be used in some13 assays. When screening for congenital syphilis, CDC recommends testing of the mother’s serum14 rather than cord blood. Studies comparing the reactivity of the mother's serum, cord blood, and15 infant's serum found that the maternal sample is the best indicator that a neonate is at risk of16 infection, followed by neonatal serum, with cord blood being the least reactive (66,345). Infant's17 serum is the specimen of choice for IgM specific tests since cord blood specimen can be18 contaminated by maternal blood. Plasma can be used for the RPR and TRUST assays but not for19 the VDRL test because heat inactivation of plasma enhances fibrin formation leading to false-20 positive results (50). Also, plasma should be tested within 24 hours to avoid false-positive test21 results (97,216). Whole blood, serum, or plasma can be used for rapid point-of-care (RPOC)22 treponemal tests although they are designed for in-field use with whole blood. If serum is23
  28. 28. required for testing, either serum separator tubes should be used or blood can be collected1 without anticoagulant and left to clot at room temperature for 2 hours. Blood collected in2 anticoagulant tubes can be centrifuged immediately at 1000 to 1200 x g for tests requiring3 plasma. The choice of blood collection tube used should adhere to the recommendation of the4 serology test manufacturer. Plasma can be retained in the original tube after centrifugation if5 testing will be done immediately; otherwise, it should be transferred to a fresh tube. Whole blood6 for PCR testing should be collected in tubes containing EDTA as anticoagulant.7 The order of sample collection from genital ulcers or moist lesions depends on the tests to8 be performed. Samples for DF should be collected first followed by DFA-TP and PCR. Ideally,9 the specimen for both DF and DFA-TP should be free of red blood cells, other microorganisms10 and tissue debris (217). Contamination of the ulcer exudate with erythrocytes can complicate11 interpretation of DF slides. A detailed procedure for collecting a specimen for DF examination12 has been described by Wheeler et al. (436). Briefly, to obtain a specimen from a genital lesion,13 gently cleanse and abrade the site with sterile gauze moistened with physiological saline until a14 serous fluid appears, collect the specimen directly onto a clean microscopy slide (touch15 preparation) and cover with a coverslip. A specimen for DFA-TP is collected in the same16 manner but left to air dry for 15 minutes. Specimens from cervical and vaginal lesions are17 collected as for genital lesions except the lesions are abraded by rubbing with a gauze pad held in18 a forceps and the exuding serous fluid collected with a sterile bacteriological loop or Pasteur19 pipette (217). A sterile dacron- or cotton-tipped should be used to collect a specimen for PCR by20 firmly pressing and rolling the swab along the base of the ulcer or lesion. The swab should be21 suspended in a cyrotube containing 1 to 2 ml of nucleic acid transport medium such as Genelock22 (Sierra Molecular Corporation, Sonora, CA) or Universal Transport Medium (UTM; Copan23
  29. 29. Diagnostics, Murrieta, CA). Subsequently press and roll the swab along the side of the tube to1 express the excess fluid and discard the swab in a biohazard receptacle. A CSF specimen is2 obtained by lumbar puncture and should not contain particulate matter that might interfere with3 reading of VDRL test results.4 Tissue or fine needle aspirates (e.g., lymph nodes) for silver staining, IHC or DFAT-TP5 should be fixed in 10% buffered formalin at room temperature immediately and sent to the6 laboratory for paraffin embedding and sectioning. To test products of conception for congenital7 syphilis, a 3 to 4 cm long section of umbilical cord that hasn’t been cleansed with soap or8 antimicrobial-containing solution should be obtained distal from the placenta. The specimen9 should be taken soon after delivery and fixed in formalin. If the tissue cannot be processed10 immediately, it should be refrigerated since placental tissue deteriorates less rapidly than most11 other tissues in the refrigerator (288).12 The transportation of whole blood to the laboratory for serological testing can be done at13 ambient temperature if testing is done on-site; otherwise, samples should be stored at 4oC and14 transported overnight with cool packs (4oC). Serum (including serum left in separator tubes) and15 plasma also should be shipped with cool packs. Previously frozen plasma or serum must be16 shipped on dry ice. If PCR testing is being done at an off-site facility, whole blood should be17 transported with cool packs overnight or on dry ice if previously frozen; anecdotal evidence,18 however, suggests that blood stored at 4oC yields better results by PCR than when frozen. CSF19 for serology can be transported at ambient temperature overnight or on cold packs if also being20 used for PCR testing. All tissue samples for silver staining, IHC, and DFAT-TP can be shipped21 in formalin at ambient temperature for embedding with paraffin; however, care should be taken22 to use leak-proof containers and specimen bags. Alternatively, paraffin-embedded blocks or thin23
  30. 30. sections can be sent at ambient temperature for sectioning and staining. Lesion exudates that1 have been air-dried on microscope slides for DFA-TP staining can be sent to the laboratory at2 ambient temperature or on dry ice if slides were frozen after collection (217). Genital ulcer, skin3 or mucosal lesion samples collected in Genelock or UTM for PCR can be shipped at room temp4 or with cool packs overnight. Both paraffin-embedded and formalin fixed samples can be5 shipped at ambient temperature for PCR testing. Amniotic fluid should be transported to the6 laboratory within 15 minutes if DF is to be performed; amniotic fluids sent to outside labs for7 PCR testing can be sent with cool packs overnight. All specimens for PCR that have been8 previously frozen or unfixed tissue should be sent on dry ice.9 Ideally, specimens should be collected and tested immediately or within the10 recommended processing time; short-term storage, however, may be necessary. Whole blood for11 serology can be stored at 4oC for 48 to 72 hours if tubes are unopened after collection. Serum,12 plasma, and CSF for serology should be stored at 4oC if testing will be delayed by more than 413 hours and at -20oC or lower if testing will be done more than 5 days from collection. Blood for14 PCR can be stored at 4oC overnight or, if longer storage is required, at ≤-20oC; whenever15 possible, however, blood should be processed immediately for PCR testing. Slides containing16 air-dried lesion exudates and touch preparations for DFA-TP staining can be stored in a slide17 container at 4oC to 8oC or 23oC to 29oC for up to 2 weeks; otherwise, specimens should be fixed18 with acetone and stored at -20oC until testing. Paraffin-embedded samples for staining with19 conventional tests or extraction of DNA for PCR testing should be stored at room temperature.20 Formalin-fixed samples should be stored at room temperature until sectioning or DNA21 extraction. Samples of unfixed tissue, ulcer exudate, mucosal or skin lesions, CSF, and amniotic22 fluid should be stored at -70oC if PCR testing cannot be performed immediately.23
  31. 31. 1 T. denticola and other oral treponemes2 Specimen collection for detection, isolation, or identification of T. denticola and other3 treponemes is not normally performed in the routine clinical management of gingivitis or4 periodontitis; however, detailed methods and information for studying these organisms for5 research purposes are available elsewhere (101,108,280,318,385,387,442,443).6 7 Brachyspira-Intestinal spirochetosis8 Fecal samples for B. aalborgi and B. pilosicoli should be collected in sterile containers and9 transported at ambient temperature to the laboratory or overnight on ice if culture or DF will be10 performed off-site. Rectal swabs (407) can be collected and transported in Stuart’s medium11 (Becton Dickinson, Sparks, MD). Fecal samples and swabs should be processed for culture12 within 24 hours of collection (46,407). Swabs can be stored in Stuart’s medium at 4oC overnight13 (407). Several colonic or rectal biopsies should be taken. Fresh samples should be used for14 culture while samples for histological examination should be processed as described for T.15 pallidum. Biopsy samples placed in physiological saline have been successfully used to culture16 B. aalborgi (46). Samples for TEM should be deparaffinized before processing (210).17 B. aalborgi and B. pilosicoli are obligate anaerobes that grow in a variety of media18 containing blood (36,37,210,413). Fecal samples or rectal swabs can be used for isolation of19 strains (37,210,210) or examination by DF (360). Cultured spirochetes from solid- or broth-20 based media can be observed by phase contrast microscopy (37). Biopsies obtained from the21
  32. 32. colon or rectum can serve as material for culture, PCR, or histological examination by light or1 TEM (45,210,267,360). There are no commercial kits or serological tests for the detection of2 intestinal spirochetes.3 4 DIRECT DETECTION5 T. pallidum6 Darkfield microscopy7 Touch preparations of primary, secondary and early congenital syphilis lesions should be8 examined by DF. The test must be performed within 20 minutes since it relies on the observation9 of motile treponemes. The DF procedure has been described in detail by Wheeler et al. (436). A10 step-by-step instructional video can be obtained without charge from Dr. David Cox, Laboratory11 Reference and Research Branch, Division of STD Prevention, CDC (404-6393446;12 dlc6@cdc.gov). A microscope equipped with a DF condenser is required to observe T. pallidum13 due to the organism’s narrow width, which cannot be observed with an ordinary light14 microscope. T. pallidum cannot be distinguished from the other human pathogenic treponemes,15 T. pallidum subsp. endemicum, T. pallidum subsp. pertenue and T. carateum using DF (or any16 other currently available test). DF cannot be performed on oral or anal lesions since T. pallidum17 cannot be distinguished from other spirochetes in these sites.18 19 DFA-TP20
  33. 33. Touch preparations of lesion exudates (81,168) or tissue impressions (68) can serve as samples1 for DFA-TP. DFA-TP identifies T. pallidum based on antigen detection and morphology.2 Because motility is not required for interpretation of DFA-TP, slides can be stored and read at a3 later time. DFA-TP utilizes either a fluorescein isothiocyanate (FITC)-conjugated polyclonal or4 monoclonal antibody (Mab) for staining. Use of a Mab can distinguish T. pallidum from other5 commensal and human-associated spirochetes with the exception of the closely related T.6 pallidum subspecies (182). DFA-TP with a T. pallidum-specific Mab can be done on all7 cutaneous and mucous membrane lesions of primary and secondary lesions, including specimens8 from anal and oral sites. For polyclonal antibody staining, slides are stained with FITC-labeled9 anti-T. pallidum globulin prepared from sera of humans or rabbits with syphilis that have being10 pre-absorbed with T. phagedenis Reiter organisms; results with this reagent should be interpreted11 with caution since polyclonal antibodies are not specific for pathogenic treponemes. There is no12 FDA approved DFA-TP test in the United States; unabsorbed labeled polyclonal antibodies,13 however, are available commercially (Meridian Life Sciences, Saco, ME; ViroStat, Portland,14 ME).15 16 Silver staining/DFAT-TP/IHC17 Silver staining (373), DFAT-TP (176,182,183,373), and IHC (41,252,324) are conventional18 staining techniques often used to demonstrate T. pallidum in fixed tissue sections from patients19 with secondary, tertiary, or congenital syphilis. Silver staining with either the Warthin-Starry or20 the Steiner modification of the Dieterle method is used for examining paraffin-embedded21 samples (105,160,252). Briefly, the modified Steiner method (Sigma-Aldrich, St. Louis, MO)22
  34. 34. involves deparaffinizing tissue sections and placing slides in uranyl nitrate solution followed by1 silver nitrate solution. Slides subsequently are placed in a reducing solution consisting of gum2 mastic solution, hydroquinone solution, and alcohol combined with silver nitrate solution,3 incubated in a 45oC water bath and then allowed to stand at room temperature for approximately4 1 to 2 minutes until the desired degree of staining is obtained.5 DFAT-TP is a modification of the DFA-TP test that enables immunofluorescent labeling6 of treponemes in tissue samples (176,182,445). Tissue sections are deparaffinized with xylene7 and pretreated with ammonium hydroxide, trypsin, or heat (e.g., microwaving) prior to8 immunostaining in order to enhance epitope accessibility (65,218). Tissue subjected to IHC9 using a horsereadish peroxidase (HRP) conjugate must undergo pretreatment with hydrogen10 peroxide to remove endogenous peroxidase, which may lead to false-positive reactions when11 avidin-biotin immunoperoxidase is used to visualize bound antibodies. Unabsorbed polyclonal12 antibodies for IHC are available commercially (Biocare Medical,Concord, CA; ViroStat,13 Portland, ME). IHC is advantageous over DFAT-TP for two reasons: (i) it does not require a14 fluorescence microscope and (ii) use of hematoxylin counterstain allows tissue structure to be15 correlated with localization of treponemes (141,324).16 17 PCR18 PCR is not routinely used for syphilis testing and a commercial test is not available; however,19 since 1991, numerous studies have been published on the use of PCR for the detection of T.20 pallidum based on several different gene targets. Of these, the polA (tp0105)21 (33,65,204,223,242,250,251,329,333,402) and tpn47 (tp0574)22
  35. 35. (28,33,51,52,123,191,233,250,251,262,308,312,329,348) genes have been the most commonly1 used. Although PCR can be performed on many different samples types, the test appears to be2 most useful for the establishment of a diagnosis in individuals with genitual ulcers and other3 exudative lesions since these typically contain large numbers of treponemes and specimens can4 be collected non-invasively (123,251,308,312,402).5 Genomic DNA for PCR testing is usually extracted from 200 l of nucleic acid transport6 medium, containing a genital ulcer swab sample, using a commercial kit such as the QIAamp7 DNA mini kit (Qiagen Inc., Valenica, CA). Laboratories that have real-time PCR capability can8 use the TaqMan-based multiplex PCR assay that has been developed in the Laboratory9 Reference and Research Branch, Division of STD Prevention at the CDC for testing GUD10 samples. This assay can simultaneously detect T. pallidum, H. ducreyi, and herpes simplex11 viruses (HSV) 1 and 2, which are the major causative agents of GUD. The gene targets and12 concentrations of primers and probes for the assay are shown in Table 4. PCR amplification is13 performed in a 50 l reaction volume containing 1x PCR Buffer; 5 mM MgCl2; 200 M each14 dATP, dGTP, and dCTP, and 400 M dUTP; 10 U UNG; 1 U of AmpliTaq Gold DNA15 polymerase (all from Applied Biosystems), and 25 l of sample. . The addition of AmpErase16 uracyl-N-glycosylase (UNG) enzymatically cleaves any contaminating amplicons from previous17 reactions. The assay is run on a Rotor-Gene 3000 real-time PCR instrument (Qiagen, Inc.) with18 thermal cycling consisting of holds at 50°C for 2 min and 95°C for 10 min (for AmpERase)19 degradation of contaminating amplicons) followed by 50 cycles of denaturation at 95°C for 2020 sec. and annealing and extension at 60°C for 1 min. Each run should contain a human DNA21 control to check for PCR inhibition, positive controls for each organism and a no template22 control. Laboratories that lack real-time PCR capability can use the conventional multiplex PCR23
  36. 36. assay for detection of T. pallidum, H. ducreyi, and HSV described by Mackay et al. (233). The1 PCR primers and probes and corresponding amplicon sizes are shown in Table 5.2 Oligonucleotides for detection of C. granulomatis, included in the original multiplex assay (233)3 are not included in Table 5 because donovanosis is rarely seen in most settings. The same is true4 for chancroid in most clinical settings. Therefore, if testing for H. ducreyi will not be performed,5 PCR products from the multiplex reaction can be analyzed by agarose gel electrophoresis. On6 the other hand, if H. ducreyi is included in the assay, then an enzyme linked amplicon7 hybridization assay (233) should be used because the amplicons for H. ducreyi and HSV are too8 similar in size to be separated by agarose gels.9 A TaqMan-based simplex real-time PCR targeting the polA gene can be used when the10 primary diagnostic objective is to determine if a body fluid or tissue specimen contains just T.11 pallidum (65). The primers consist of TP-1 (5’CAGGATCCGGCATATGTCC3’) and TP-212 (5’AAGTGTGAGCGTCTCATCATTCC3’) and, a probe TP-313 (5’CTGTCATGCACCAGCTTCGACGTCTT3’), which is labeled at the 5’ end with 6-14 carboxyfluorescein (FAM) and black hole quencher 1 (BHQ1) at the 3’ end. PCR amplification15 is performed in a 25 l reaction containing 300 nM of each primer, 200 nM of probe, 1x PCR16 Buffer, 5 mM MgCl2, 200 M each dATP, dGTP, dCTP, and dUTP, 0.5 U UNG, 1 U of17 AmpliTaq Gold DNA polymerase (All Applied Biosystems) and 10 l of sample. The assay is18 run on a Rotor-Gene 3000 real-time PCR instrument. Thermal cycling consists of a hold at 50°C19 for 2 min and 95°C for 10 min (AmpErase) followed by 45 to 50 cycles consisting of20 denaturation at 95°C for 20 sec and annealing and extension at 60°C for 1 min. Each run should21 contain positive- and no template controls. Laboratories that are unable to perform real-time22 PCR can use a conventional assay targeting the polA gene of T. pallidum with primers F123
  37. 37. (5’TGCGCGTGTGCGAATGGTGTGGTC 3’) and R11 (5’CACAGTGCTCAAAAACGCCTGCACG3’) using PCR conditions described by Liu et al.2 (225). The 377-bp PCR product can be electrophoresed on a 1.5% agarose and the size of DNA3 band estimated with an appropriate molecular weight size standard.4 A survey of the literature reveals conflicting data as to whether whole blood (123),5 peripheral blood mononuclear cells (123), or plasma (51) yields optimal PCR results. We have6 found whole blood to be better than any of its components for detection of T. pallidum although7 additional studies are clearly needed. The variability of PCR results for blood probably reflects8 the low number of circulating treponemes coupled with suboptimal DNA extraction methods.9 To alleviate these problems, we advocate using a method to concentrate treponemes from a10 larger volume of blood. The QIAamp DNA blood midi kit allows the processing of up to 2 ml11 blood as opposed to the 200l used with the QIAamp DNA blood mini kit. The midi kit can also12 be used to concentrate treponemes in CSF and other body fluids.13 14 Brachyspira15 Fresh stool specimens or rectal swabs may be examined by DF for the presence of spirochetes16 (360). Colonic and rectal tissue biopsies can be observed by light microscopy using periodic17 acid Schiff (PAS), hematoxylin-and-eosin (HE) or silver staining and spirochetes appear as a18 “fuzzy coat” on the brush border of the surface epithelium (46,403). A false brush border19 covering the luminal surface of the colon as observed by HE staining is shown in Fig 3A. Under20 TEM, which can be helpful to confirm suspected IS, the organisms appear to be attached end-on21 to the host cell membrane (Fig 3B)(45,210). Immunohistochemistry using either a rabbit22
  38. 38. polyclonal antibody derived from an uncharacterized intestinal spirochete (210) or anti-T.1 pallidum and –M. bovis antibody (403) have been used for examining fixed tissue samples.2 Species-specific diagnostic PCR tests for Brachyspira spp. have been based on the3 NADH oxidase (nox) and/or rRNA gene sequences (46,210,267) and have been used on fixed,4 paraffin-embedded tissue specimens (210,267,268) or human feces (269). The QIAamp DNA5 mini kit can be used to extract DNA from 180 to 220 mg of stool specimen. Up to 25 mg fresh or6 frozen biopsy tissue and archival samples can be extracted with the QIAamp DNA mini kit.7 Detection of B. pilosicoli and B. aalborgi DNA can be achieved with the PCR assays described8 by Mikosza et al. (267,269) using the primers and PCR conditions for either 16S rRNA or nox9 targets shown in Table 6. All PCR amplifications are performed individually and consist of a 2510 μl reaction mix of 67 mM Tris–HCl (pH 8.8), 16.6 mM (NH4)2SO4, 0.45% (v/v) Triton X-100,11 0.2 mg ml−1 gelatin, 0.55 U of Tth Plus DNA polymerase, 1.5 mM of MgCl2, 5 nmol each of12 dATP, dGTP, dCTP, and dTTP, 12.5 pmol of each primer and 2 μl DNA. The above assay was13 performed originally on an Applied Biosystems 2400 thermocycler; however, use of newer14 instruments such as the Applied Biosystems 9700 or 9800 thermocycler will require assay15 optimization. PCR amplicons should be electrophoresed on a 1.5% agarose and sizes of DNA16 bands estimated with an appropriate molecular weight size standard.17 18 ISOLATION PROCEDURES19 T. pallidum20 RIT is the only means available for isolating T. pallidum from clinical specimens and, because of21 its extraordinary sensitivity (1 to 2 organisms in a sample), has long been considered the gold22 standard for treponeme detection (231,234,418). CSF is the body fluid examined most23
  39. 39. frequently by RIT but infectivity testing of serum, blood, and amniotic fluid also has been1 reported (161,230,265,290,291,352,364,434). For best results, material must be inoculated as2 soon as possible, preferably within 30 minutes of collection. In the case of CSF or whole blood,3 1 ml is typically inoculated into each testis. Solid tissues must be emulsified with sterile saline4 prior to injection. When relatively large numbers of spirochetes are present in a specimen, the5 rabbit will develop orchitis and treponemes will be visible in the testicular aspirate. However, in6 our experience with CSF, development of orchitis is uncommon. We monitor the infection status7 of the animal by performing serologic tests for syphilis at monthly intervals. If the rabbit fails to8 seroconvert after 90 days, the RIT is considered to be negative. If the rabbit seroconverts, it is9 sacrificed and the testes are extracted with sterile saline. If treponemes are seen in the extract,10 the test is positive. If treponemes are not seen, the extract is inoculated into the testes of a11 second rabbit which is followed serologically and for development of orchitis as described12 above. A complete description of the RIT method can be found in reference (231).13 14 Brachyspira15 Both B. pilosicoli and B. aalborgi are obligate anaerobes but grow in a variety of media16 containing blood with B. aalborgi being more fastidious of the two species. Fecal samples,17 rectal swabs, or biopsies of the colon or rectum can be cultured anaerobically using brain heart18 infusion agar (37,210) or trypticase soy agar medium (210) with 10% bovine blood, 400 µg/ml19 of spectinomycin and 5 µg/ml polymyxin incubated anaerobically at 37oC. Biopsy specimens20 should preferably be streaked onto agar plates within 1 hr of collection (210). Colonies of B.21 aalborgi appear light grey, weakly β-haemolytic with a diameter of 1.2 mm on brain heart22 infusion agar medium after 21 days of incubation (37). B. pilosicoli and B. aalborgi growth23
  40. 40. appears as a thin film or as discrete, pinpoint colonies on trypticase soy agar medium after 5 to1 14 days (37,210,243). B. aalborgi cultures usually require a longer incubation period. In a study2 describing the isolation of Brachyspira from anaerobic blood cultures, automated detection was3 not obtained uniformly and required a minimum of 5.6 to 14.9 days (depending on the strain);4 however, the organisms could be subcultured and observed by DF (36,413). Alternatively,5 spirochetes isolated from solid or broth based media can be observed by phase contrast6 microscopy (37). B. aalborgi has been successfully subcultured on brain heart infusion agar (37)7 and propagated in trypticase soy broth containing 10% foetal calf serum (46). B. pilosicoli is less8 fastidious than B. aalborgi and can be subcultured on media used for its isolation or grown in9 Kunkle’s anaerobic broth (244).10 11 IDENTIFICATION12 Brachyspira13 B. pilosicoli and B. aalborgi strains can be characterized using API-ZYM (bioMérieux, Inc.,14 Durham, NC), and other biochemical tests such as indole production and hippurate hydrolysis15 (46,210,413). A strong hippurate cleavage reaction and weak -galactoside activity is16 commonly used to identify B. pilosicoli, while B. aalborgi is negative for -galactoside activity17 and gives a weak hippurate reaction (210).18 19 TYPING SYSTEMS20 T. pallidum21
  41. 41. The molecular epidemiology of syphilis is poorly understood, in part, because there has been no1 means to differentiate “street strains” of T. pallidum. Previous studies based on DNA-DNA2 hybridization could not differentiate between the three subspecies of T. pallidum (264) and3 attempts to develop a strain typing method based on the 4D antigen gene (296), the 15 kDa4 lipoprotein gene (59), and the intragenic region between the 16S and 23S rRNA genes (61)5 proved unsuccessful because these sequences are so highly conserved. Identification of variable6 regions of the T. pallidum genome has made it possible to develop a molecular typing system for7 T. pallidum (117,226,396). The typing system is based on PCR amplification and restriction8 fragment length polymorphism (RFLP) analysis of three members of the tpr multicopy gene9 family (tpr E [tp0313], G [tp0317], J [tp0621]) and amplification of a variable number of 60-bp10 tandem repeats within arp (tp0433) gene (328). To date, more than 40 strain types have been11 identified, which comprise 15 tpr-based RFLPs (designated a to p, Fig. 5A) and 17 arp tandem12 repeats varying from 3 to 22 (Fig. 5B) (74,273,328,329).13 In order to type T. pallidum strains, an approximately 1.8 kb region of the tprE, G, and J14 genes is simultaneously amplified using a two-tube nested PCR employing primer pairs B1,15 5’ACTGGCTCTGCCACACTTGA3’/A2, 5’CTACCAGGAGAGGGTGACGC 3’ and IP6,16 5’CAGGTTTTGCCGTTAAGC3’/IP7, 5’AATCAAGGGAGAATACCGTC 3’ followed by17 restriction digestion with MseI and RFLP analysis (328,329). The 60-bp repeat region of the arp18 gene is amplified with PCR primers 1A (5’CAAGTCAGGACGGACTGTCCCTTGC3’) and 2A19 (5’GGTATCACCTGGGGATGCGCACG3’) but an improved touchdown PCR method which20 include new primers has recently been developed (Katz et al.-submitted). In earlier typing studies21 (328,329), 14d was identified as the predominant strain type; therefore, a subtyping component,22 currently being developed at the Laboratory Reference and Research Branch, Division of STD23
  42. 42. Prevention at the CDC, will be introduced to further discriminate among strains (327). The1 subtyping component involves PCR amplification and sequencing of a homonucleotide G2 tandem repeat within the rpsA (tp0279) gene of T. pallidum. Preliminary data shows that3 inclusion of this subtyping component further discriminated 14d strains in an endemic syphilis4 setting while the majority of strains from an initial syphilis outbreak in Vancouver were identical5 suggesting clonal spread. Using the combined typing methods (subtyping system), strains are6 now designated by the number of 60-bp repeat within the arp gene, RFLP profile of the tpr7 genes, and number of G tandem repeats within rpsA. For example, the Nichols’ strain of T.8 pallidum is designated 14a10.9 Strain typing has been performed on specimens from genital ulcers, mucosal lesions, skin10 lesions, CSF, whole blood, serum, plasma, and exudates from ear scrapings in patients with11 latent syphilis (51,273,328,333,402). Of all the strain typing studies, three each reported 14a,12 14d, and 14f strain types as being the major subtype identified, respectively13 (51,74,113,250,273,328,329,333,402). While the typing system appears to be useful for strain14 characterization, only a few specimens from epidemiologically linked cases have been typed and15 this remains an on-going challenge (113,402). The ability to type specimens from16 epidemiologically linked cases might prove useful especially for syphilis outbreak analysis and17 hopefully lead to implementation of more effective control measures for syphilis.18 19 Brachyspira20 B. pilosicoli strains have been characterized by PFGE and MLEE but the PFGE method appears21 to be more discriminatory (219,413,415). Various studies using PFGE typing show that B.22 pilosicoli strains belong to a genetically diverse group (38,243,244,415). The identification of23
  43. 43. strains from intestinal spirochetosis with the same PFGE pattern in human and dogs suggests1 zoonotic transmission may occur (219,415). There are no reports on typing of B. aalborgi strains2 which probably reflects the fastidious nature of this organism that until recently was unculturable3 from human feces (37).4 5 SEROLOGIC TESTS6 General Principles7 Syphilitic infection elicits two different types of antibody responses, traditionally designated as8 “nontreponemal” and “treponemal” (217,392). Nontreponemal tests historically were the first to9 be developed and still are used for both screening and for evaluation of disease activity following10 therapy (Table 7). The standard nontreponemal tests use flocculation to detect antibodies against11 lipoidal antigens, primarily cardiolipin (315). These tests were designated nontreponemal12 because it was believed that they detect antibodies elicited by host lipids released from tissues13 damaged during infection. More recent studies, however, showing that T. pallidum contains14 cardiolipin cast doubt on this long-held assumption, raising the possibility that nontreponemal15 antibodies actually are elicited against the treponeme (30). Regardless, nontreponemal tests have16 two inherent problems: they lack sensitivity in primary and late syphilis (Fig. 4), and they lack17 specificity because they can be elicited in diseases and conditions unrelated to syphilis, giving18 rise to so-called biological false-positives (BFPs, see below)(342,344). These deficiencies19 necessitated the development of more specific tests to detect antibodies that are unquestionably20 directed against and specific for the organism. The conventional treponemal tests, beginning21 with the FTA-ABS and culminating with the TP-PA, addressed this need quite admirably and22 continue to do so (228,392). The need to achieve higher throughput and decreased personnel and23
  44. 44. other laboratory costs, however, has prompted the development of a plethora of automatable1 enzyme immunoassays (EIAs) most of which use mixtures of recombinant antigens instead of T.2 pallidum lysates for improved specificity (Tables 8A-D). In addition, the challenge of syphilis3 diagnosis and control in developing countries has necessitated the development of RPOC dual4 tests which simultaneously provide both qualitative nontreponemal and treponemal test results5 from small volumes (as little as 5 µl) of fingerstick blood. Lastly, serological assays to monitor6 production of IgM during infection have traditionally been concerned primarily with diagnosis of7 congenital syphilis. Recently, a renewed interest in the detection of specific IgM as a tool for8 early diagnosis and monitoring therapy has emerged (202,237,256,367).9 10 Nontreponemal Tests11 In 1906, soon after the discovery of the etiological agent for syphilis, Wasserman (432)12 developed the first serologic test for syphilis in which lipoidal antigens extracted from livers of13 aborted fetuses with congenital syphilis were used as the basis for a complement fixation test.14 Not until 35 years later was it discovered that the antigen responsible for eliciting these human15 antibodies was the ubiquitous phospholipid cardiolipin (316). In addition to the difficulties in16 performing the Wasserman test, its specificity left much to be desired. In 1947, Harris et al.17 (147) developed a simplified test for detecting anti-cardiolipin antibodies based on lipids18 extracted from beef heart. The VDRL (Venereal Disease Research Laboratory) test they19 developed is a slide flocculation assay that requires a microscope for reading. About a decade20 later, Portnoy (335) developed an improved nontreponemal test, the RPR (Rapid Plasma21 Reagin), that incorporated charcoal particles, enabling the results to be read without the aid of a22
  45. 45. microscope. Compared to the VDRL test, the RPR test has the additional advantage of1 employing a more stable antigen that does not need to be freshly prepared. Four years after the2 development of the RPR test, they developed another flocculation assay, the USR (Unheated3 Serum Reagin), which eliminated the need to heat-inactivate the patient’s serum before testing.4 Shortly thereafter, they used this modification to improve the RPR and added a special card5 which could be utilized in field studies (334). The last traditional nontreponemal test to be6 developed was the TRUST (Toluidine Red Unheated Serum Test), which substitutes particles of7 toluidine red for the charcoal particles used in the RPR (323) in order to simplify reading. Table8 7 presents the salient features of the commercially available nontreponemal tests along with the9 corresponding information for the nontreponemal components of three dual tests, Vira Med10 ViraBlot, Span SpiroLipin, and ChemBio DPP Screen and Confirm, that are not FDA-approved.11 Detailed protocols for performing the RPR, VDRL, USR, and TRUST assays can be found in A12 Manual of Tests for Syphilis published by the American Public Health Association13 (http://www.apha.org); an on-line version can be accessed at www.cdc.gov/xxxxxx.14 15 The VDRL Slide Test16 The antigen for the VDRL test is composed of a mixture of cardiolipin, cholesterol, and lecithin17 in ethanol at concentrations of 0.03%, 0.9%, and 0.21%, respectively (218). The alcohol18 solution is used to prepare micelles of antigen suspension in VDRL-buffered saline; once19 prepared, the antigen is useable for only 8 hours. The VDRL test is performed on special glass20 slides with paraffin or ceramic rings and should not be performed on slides with wells or21 concavities. The test must be performed at ambient temperatures between 23 and 29˚C. The22
  46. 46. results are read microscopically at 100X, the highest titer causing flocculation being the1 endpoint. The VDRL test also is performed on CSF to identify and manage cases of2 neurosyphilis. The VDRL-CSF is performed identically to the serum VDRL except that the3 VDRL antigen is diluted 1:1 with 10% saline.4 5 The Unheated Serum Reagin (USR) test6 The USR micro-flocculation test uses a modified VDRL antigen containing choline chloride7 which eliminates the need for heating of the serum sample (218). The USR must be read8 microscopically just like the VDRL. The USR test is rarely used since the RPR test has9 essentially the same advantages and does not require a microscope for determination of results.10 11 The RPR card test12 The RPR card test can be performed on serum or plasma. The RPR antigen is similar to that of13 the VDRL but also contains 10% choline chloride to eliminate the need for heat-inactivated14 serum, 0.01875 M EDTA to enhance the stability of the suspension, and finely divided charcoal15 particles as a visualizing agent (218). In the RPR card test, serial dilutions of serum or plasma16 (heated or unheated) are prepared on a plastic-coated card following which the RPR antigen is17 added. The presence of antibodies causes flocculation, while suspensions without antibodies18 remain uniformly gray. Traditionally, the RPR has not been recommended for CSF testing based19 on evidence that it was less sensitive and specific than the VDRL-CSF (215,218). Recently,20 however, the RPR was compared to the VDRL for CSF testing and was determined to perform21
  47. 47. with equal sensitivity and specificity (53). Given the potential for RPR testing to simplify1 management of neurosyphilis patients, further comparative studies seem warranted.2 3 Toluidine Red Unheated Serum Test (TRUST)4 The TRUST is a macroflocculation assay very similar to the RPR. The antigen for the TRUST is5 almost identical to that used in the RPR and USR tests except that toluidine red is incorporated6 into the mix (218). The serum samples are prepared and diluted as with the RPR; the antigen is7 added, and the cards are placed on a rotator at 100 RPM for eight minutes. The sensitivity of the8 TRUST is very similar to that of the RPR (Table 1) while the specificity is slightly higher9 (216,217,323,401).10 11 Treponemal Tests12 The need to confirm the Wasserman test with another more specific test was widely recognized13 soon after its development. The first assay to test for antibodies unquestionably directed against14 treponemal antigens was developed in 1949 by Nelson and Mayer (294). This assay, the T.15 pallidum immobilization (TPI) test was based on the ability of patient sera to immobilize viable16 treponemes in the presence of complement. However, the TPI test proved to be very difficult to17 perform, required treponemes freshly harvested from infected rabbits, and yielded results that18 often were difficult to interpret. Efforts to invent a less cumbersome test culminated in the19 development of an immunofluorescence assay, the Fluorescent Treponemal Antibody (FTA) test,20 which used patient sera to immunolabel whole treponemes fixed to glass slides. To enhance the21
  48. 48. test’s specificity, cross-reactive antibodies were removed by absorption with extracts from the1 non-pathogenic Treponema phagedenis Reiter; this modified FTA assay was termed the FTA-2 ABS test (175). About the same time, Rathlev (343) developed a reliable hemagglutination3 assay which served as a basis for the MHA-TP test. Replacement of the red blood cells with4 gelatin particles in the TP-PA test, now the most widely utilized treponemal test in the United5 States, increased specificity while eliminating the need for the absorption step (332). Since the6 1980s, progressive technological advances in immunoassay format, in concert with the7 availability of purified, recombinant T. pallidum antigens, have spawned diverse EIAs, dual8 tests, RPOCs, and, most recently, luminescent bead assays with multiplexing potential. Tables9 8A-D contain a comprehensive summary of the salient features of the commercially available10 treponemal tests, as well as some that are still developmental. Detailed protocols for performing11 the FTA-ABS, MHA-TP, and TP-PA can be found in A Manual of Tests for Syphilis (218).12 13 FTA-ABS Test (Table 8A)14 Reagents for the FTA-ABS are available from Trinity Biotech Plc (Co. Wicklow, Ireland). As15 noted earlier, the sample first must be adsorbed with an extract of T. phagedenis Reiter (Sorbent)16 to remove cross-reactive antibodies present in normal sera. The absorbed serum then is used to17 immunolabel treponemes fixed to glass slides, and FITC-conjugated anti-human18 immunoglobulin antibody is used to visualize labeled organisms. While the assay cannot19 distinguish between IgG and IgM anti-treponemal antibodies, its sensitivity for both early and20 late syphilis derives from the fact that it detects both antibody classes simultaneously. The21 serum is subjectively scored on a scale of 1+ to 4+ scale based upon the intensity of the22
  49. 49. fluorescence. Standardized controls which produce negative, 1+ and 4+ fluorescence readings,1 must be included in each assay for comparison. The test can be modified using unheated CSF2 for diagnosis of neurosyphilis (see below). Some inherent limitations of the FTA-ABS test must3 be noted. First, the control sera and Sorbent must be carefully and frequently standardized.4 Second, the microscope must be calibrated according to strict guidelines to ensure test5 reproducibility. Lastly, interpretation of the results is dependent upon the subjectivity of the6 technician reading the slides. For all of these reasons, the number of laboratories that perform the7 FTA-ABS test, once considered the gold standard treponemal assay, has diminished greatly in8 the United States.9 10 MHA-TP Test (Table 8A)11 The MHA-TP is a passive hemagglutination assay of formalinized, tanned erythrocytes sensitized12 with T. pallidum antigen that can be used to test preabsorbed patient sera. The serum is placed in13 microtiter plates and the sensitized sheep erythrocytes are added. If the serum contains reactive14 IgG and/or IgM antibodies, they will agglutinate the red blood cells which will coat the bottom of15 the wells. If the serum is nonreactive, the unagglutinated red blood cells will form a button on the16 bottom of the well (217,218). The MHA-TP has been supplanted by the TP-PA and is no longer17 available.18 19 TP-PA Test (Table 8A)20 The TP-PA test (Fujirebio Inc., Tokyo, Japan) is a modification of the MHA-TP test that replaces21 the sheep RBCs with gelatin particles sensitized with T. pallidum antigens to reduce the number22 of non-specific (e.g., heterophile reactions with red blood cells) interactions between patient sera23
  50. 50. and the antigen matrix (332). Because there is no separate absorption step, the TP-PA is simpler1 to set up than the MHA-TP and requires less preparation time. The tests themselves are2 performed in a very similar manner except that the TP-PA requires a larger sample volume (1003 µl vs. 20 µl) which may account for its greater sensitivity (75). The serum sample is diluted 1:404 in the microtiter plate and sensitized gelatin particles then are added, resulting in a final serum5 dilution of 1:80. As with the MHA-TP, agglutination indicates the presence of IgG and/or IgM6 anti-treponemal antibodies. The sources for error with the TP-PA are usually associated with the7 use of dusty or improper plates, pipetting errors, or vibrations in the laboratory.8 9 Enzyme Immunoassays (EIAs) (Table 8B)10 With the exception of the Capita IgG (Trinity Biotech Plc), the Capita IgM, and the TrepCheck11 IgM (Phoenix Bio-Tech Corporation Mississauga, Ontario, Canada), all of the EIAs currently12 being used for syphilis diagnosis employ recombinants antigens and detect both IgG and IgM13 antibodies. The 15-, the 17-, the 44.5-, and the 47 kDa antigens are the most frequently utilized14 because they induce strong, persistent antibody responses from the outset of infection (24,143)15 and are expressed only by pathogenic treponemes (301). Although EIAs using recombinant16 antigens might be expected to have better performance than assays using T. pallidum lysates17 (181), surprisingly, this has not been borne out in head-to-head comparisons of many EIAs18 (75,367). EIAs utilize one of three basic formats (or combinations thereof) to detect IgG or IgM19 antibodies or, in most cases, both. One is an indirect format in which either antigen or antibody20 immobilized on the plastic matrix serves as a capture molecule. Examples are the Captia IgG21 EIA, which uses an anti-antibody conjugate to detect serum antibodies captured by immobilized22 antigen, and the Captia IgM and TrepCheck IgM EIAs, which use antigen conjugates to detect23
  51. 51. IgM antibodies captured by immobilized anti-human IgM. The second format, referred to as the1 sandwich method, employs recombinant antigens bound to the plastic to capture specific IgG and2 IgM antibodies; the captured antibodies are detected using conjugates of the capturing antigen(s)3 which bind to unoccupied binding sites on the captured antibodies. The majority of the EIAs4 (Murex ICE [Murex Biotech Ltd, Dartford, UK], TrepSure [Phoenix Bio-Tech Corporation,5 Mississauga, Ontario, Canada], Bioelisa 3.0 [Biokit, Barcelona, Spain], Enzywell [Diesse,6 Sienna, Italy], and Syphilis EIA II [Newmarket Laboratories Ltd., Newmarket, UK]) use the7 sandwich format. In both the capture and sandwich methods, an increasing signal indicates a8 more reactive serum specimen. The third format, competitive inhibition, uses immobilized9 antigen to capture specific IgG and IgM antibodies from patient sera, which then block10 subsequent binding of an antibody-conjugate of identical specificity. With this format, OD is11 inversely related to the amount of antibody bound. The Pathozyme Syphilis (Omega12 Diagnostics, Alloe, UK), Biomerieux Trepanostika (Organon, Veedik, Belgium) and Behring13 Enzygost (Behring, Marburg, Germany) are examples of competitive inhibition EIAs. In the14 United States, the Captia Syphilis-IgG test (Trinity Biotech, Dublin, Ireland; BioRad, Richmond,15 Calif.; and Wampole Laboratories, Princeton, N.J.) has been cleared by the FDA for use as either16 a confirmatory test or as a screening test, while the TrepSure (Phoenix Bio-Tech Corp.,17 Mississauga, Ontario, Canada; and Sigma Chemical Company, St. Louis, Mo.) has been cleared18 by FDA for use as a confirmatory test. None of the other EIAs, which are primarily available in19 Europe or other world markets, are FDA-approved as general screening or confirmatory tests.20 21 Immunoblot and pseudo-immunoblot tests (Table 8C)22 Immunoblotting techniques add an element of specificity because of their capacity to identify the23

×