Evolution lectures 5 6 2012b

3,342
-1

Published on

Fossilization & what DNA can tell us.

0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
3,342
On Slideshare
0
From Embeds
0
Number of Embeds
8
Actions
Shares
0
Downloads
86
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Evolution lectures 5 6 2012b

  1. 1. Mini-Summary
  2. 2. Mini-Summary• The history of the earth is divided into geological time periods
  3. 3. Mini-Summary• The history of the earth is divided into geological time periods• These are defined by characteristic flora and fauna
  4. 4. Mini-Summary• The history of the earth is divided into geological time periods• These are defined by characteristic flora and fauna• Large-scale changes in biodiversity were triggered by slow and rapid environmental change Pg r T P- T) (K g -P -S J r- K D O T te La d ay To
  5. 5. Lecture 5: Fossils1. How fossilization works. Some examples of fossils.2. Dating fossils.3. What we can learn from fossils? y . wurm {@} qmul . ac .uk
  6. 6. Geological context
  7. 7. Geological contextThree broad classes of rock:
  8. 8. Geological contextThree broad classes of rock:•Sedimentary rocks: formed by particles(mineral or organic) gradually settling out of solution,then compacting to form rock
  9. 9. Geological contextThree broad classes of rock:•Sedimentary rocks: formed by particles(mineral or organic) gradually settling out of solution,then compacting to form rock•Igneous rocks: formed by the cooling of magma
  10. 10. Geological contextThree broad classes of rock:•Sedimentary rocks: formed by particles(mineral or organic) gradually settling out of solution,then compacting to form rock•Igneous rocks: formed by the cooling of magma•Metamorphic rocks: modification of existingrocks under high pressure and heat
  11. 11. Fossils: only in sedimentary rocks (deposited on oceanicshorelines, lake beds, flood plains...)
  12. 12. Fossils: only in sedimentary rocks (deposited on oceanicshorelines, lake beds, flood plains...)Weathering or erosion can expose the older layers
  13. 13. Fossilization
  14. 14. Fossilization• Permineralization
  15. 15. Fossilization• Permineralization• “Natural cast” process
  16. 16. Fossilization• Permineralization• “Natural cast” process• Fossilization is rare & only in sediment...
  17. 17. Fossilization• Permineralization• “Natural cast” process• Fossilization is rare & only in sediment...• Ancient material also occurs: • in amber • by mummification • in ice
  18. 18. Fossil formation at Sterkfontein
  19. 19. Fossil formation at SterkfonteinLimestone deposits were laiddown 2.5 billion years ago whenthe area was a shallow sea.
  20. 20. Fossil formation at SterkfonteinLimestone deposits were laiddown 2.5 billion years ago whenthe area was a shallow sea.Caves eventually form below thesurface.
  21. 21. Fossil formation at SterkfonteinLimestone deposits were laiddown 2.5 billion years ago whenthe area was a shallow sea.Caves eventually form below thesurface.‘Pot holes’ form between thesurface and the caves.
  22. 22. Fossil formation at SterkfonteinLimestone deposits were laiddown 2.5 billion years ago whenthe area was a shallow sea.Caves eventually form below thesurface.‘Pot holes’ form between thesurface and the caves.Debris, including animals, fall in!
  23. 23. Fossil formation at SterkfonteinLimestone deposits were laiddown 2.5 billion years ago whenthe area was a shallow sea.Caves eventually form below thesurface.‘Pot holes’ form between thesurface and the caves.Debris, including animals, fall in!Compaction and cementing withwater and limestone produces“Breccia”.
  24. 24. Fossil preservation• Hard part like shells, bones and teeth are usually all that remain• Soft tissues fossils are rare
  25. 25. Why are fossils rare?
  26. 26. Why are fossils rare?• Fossils don’t form often:
  27. 27. Why are fossils rare?• Fossils don’t form often: • Predators, scavengers, insects consume corpses
  28. 28. Why are fossils rare?• Fossils don’t form often: • Predators, scavengers, insects consume corpses • Bacteria and fungi decompose remains
  29. 29. Why are fossils rare?• Fossils don’t form often: • Predators, scavengers, insects consume corpses • Bacteria and fungi decompose remains • Even faster in tropics (acid soil, warm, humid...)
  30. 30. Why are fossils rare?• Fossils don’t form often: • Predators, scavengers, insects consume corpses • Bacteria and fungi decompose remains • Even faster in tropics (acid soil, warm, humid...)
  31. 31. Why are fossils rare?• Fossils don’t form often: • Predators, scavengers, insects consume corpses • Bacteria and fungi decompose remains • Even faster in tropics (acid soil, warm, humid...)• Best locations for fossil formation::
  32. 32. Why are fossils rare?• Fossils don’t form often: • Predators, scavengers, insects consume corpses • Bacteria and fungi decompose remains • Even faster in tropics (acid soil, warm, humid...)• Best locations for fossil formation:: • arid deserts, deep water (with low O2)
  33. 33. Why are fossils rare?• Fossils don’t form often: • Predators, scavengers, insects consume corpses • Bacteria and fungi decompose remains • Even faster in tropics (acid soil, warm, humid...)• Best locations for fossil formation:: • arid deserts, deep water (with low O2)
  34. 34. Why are fossils rare?• Fossils don’t form often: • Predators, scavengers, insects consume corpses • Bacteria and fungi decompose remains • Even faster in tropics (acid soil, warm, humid...)• Best locations for fossil formation:: • arid deserts, deep water (with low O2)•
  35. 35. Why are fossils rare?
  36. 36. Why are fossils rare?• Fossils don’t form often: • Predators, scavengers, insects consume corpses • Bacteria and fungi decompose remains • Even faster in tropics (acid soil, warm, humid...)• Best locations for fossil formation: • arid deserts, deep water (with low O2), cold
  37. 37. Why are fossils rare?• Fossils don’t form often: • Predators, scavengers, insects consume corpses • Bacteria and fungi decompose remains • Even faster in tropics (acid soil, warm, humid...)• Best locations for fossil formation: • arid deserts, deep water (with low O2), cold• Fossils can be lost:
  38. 38. Why are fossils rare?• Fossils don’t form often: • Predators, scavengers, insects consume corpses • Bacteria and fungi decompose remains • Even faster in tropics (acid soil, warm, humid...)• Best locations for fossil formation: • arid deserts, deep water (with low O2), cold• Fossils can be lost: • mountains: lots of erosion
  39. 39. Why are fossils rare?• Fossils don’t form often: • Predators, scavengers, insects consume corpses • Bacteria and fungi decompose remains • Even faster in tropics (acid soil, warm, humid...)• Best locations for fossil formation: • arid deserts, deep water (with low O2), cold• Fossils can be lost: • mountains: lots of erosion • Metamorphosis and subduction of rocks destroys fossils
  40. 40. Why are fossils rare?• Fossils don’t form often: • Predators, scavengers, insects consume corpses • Bacteria and fungi decompose remains • Even faster in tropics (acid soil, warm, humid...)• Best locations for fossil formation: • arid deserts, deep water (with low O2), cold• Fossils can be lost: • mountains: lots of erosion • Metamorphosis and subduction of rocks destroys fossils
  41. 41. Why are fossils rare?• Fossils don’t form often: • Predators, scavengers, insects consume corpses • Bacteria and fungi decompose remains • Even faster in tropics (acid soil, warm, humid...)• Best locations for fossil formation: • arid deserts, deep water (with low O2), cold• Fossils can be lost: • mountains: lots of erosion • Metamorphosis and subduction of rocks destroys fossils• Most are still buried rather than exposed at the surface
  42. 42. A few examples...
  43. 43. Plesiosaur fossilAquatic reptile; not a dinosaur. But same time (Mesozoic Era). A typical fossil skeleton.
  44. 44. More typical…Parts of head, and anvil/brush of Akmonistion zangerli, shark from Carboniferous of Scotland
  45. 45. Ammonites NautilusAmmonite
  46. 46. Archaeopteryx - late Jurassic (150Mya)Feathers, like soft tissue, are rarely preserved.But here imprinted in the rock.
  47. 47. “Fuzzy Raptor” (a dromaeosaur) A rare example of a feathered dinosaur
  48. 48. The earliest Eutherian Mammal? Lower Cretaceous of China, 125 Mya Eomaia scansoria Ji et al., (2002) Nature 416, 816-822 A climbing mammal from a lake shore environment
  49. 49. Leptictidium tobieniEocene (Messel Shales, Germany)Soft tissues AND gut contents are preserved
  50. 50. Dinosaur footprint• Atthe time, this footprint of a dinosaur pressed into soft mud and became preserved in the now hardened rock. Can inform us on locomotion.
  51. 51. Fossilized tracks atLaetoli (Tanzania) Footprints preserved in volcanic ash from: 3 hominids (Australopithecus afarensis) Numerous other mammals
  52. 52. Fossilized tracks atLaetoli (Tanzania) Footprints preserved in volcanic ash from: 3 hominids (Australopithecus afarensis) Numerous other mammals
  53. 53. Fossil Ichthyosaur giving birth• Suchspecial preservations can inform us about the reproductive pattern in this species (live birth) .
  54. 54. Fossil EggsInformation on development and social/reproductive behavior
  55. 55. INSECT IN AMBER• This mosquito was imbedded in tree sap that subsequently hardened into amber, preserving the insect within.
  56. 56. Neanderthal skull from Iraq (≈50,000 years old)Very rarely, DNA can be extracted andsequenced from such sub-fossils
  57. 57. Some animals get trapped in ice
  58. 58. Lecture 5: Fossils1. How fossilization happens & some examples.2. Dating fossils3. What we can learn from fossils?
  59. 59. Dating methods • Absolute - the item itself is dated • Relative - strata above (younger) and below (older) are dated and the item expressed relative to theseBest method depends on context & age.
  60. 60. Principles ofradiometric dating
  61. 61. Dating methods
  62. 62. Stratigraphy
  63. 63. StratigraphyAs sediment collects, deeper layers are compacted by the onesabove until they harden and become rock.Deeper Fossils are older than those above.Thus positions within the rock layers gives fossils a chronological age.
  64. 64. Index (Zone) Fossils•Index fossils: diagnostic fossil species that help dating new finds•Here, Locality 3 has no layer B (wasn’t formed or eroded).
  65. 65. Lecture 5: Fossils1. How fossilization happens & some examples.2. Dating fossils3. What we can learn from fossils?
  66. 66. • Fossils can sometimes directly or indirectly tell us a great deal about the behavior of an organism, or its lifestyle
  67. 67. Intepreting fossils• Careful interpretation: helps make sense of fossilized remains• Analysis of hard parts can tell something about soft anatomy (e.g where muscles are (.e.g muscle scars).• Geology: --> environmant (freshwater/marine/swamp))• Infer from living organisms & relatives.
  68. 68. Hallucigenia sparsa (Cambrian Period) From the Burgess Shale (Canada). Example of a soft bodied animal fossil, also very old!
  69. 69. Now re-interpreted as an Onychophoran ("velvet worm")
  70. 70. Colors don’t fossilize...
  71. 71. Colors don’t fossilize...…or do they? (discovered fossilised melanosomes)
  72. 72. Fossils - Summary
  73. 73. Fossils - Summary• Fossils form in sedimentary rock• Fossilization is a rare process• Usually, only the hard parts like bone, teeth, exoskeletons and shells are preserved• Fossils of different ages occur in different strata, and “index fossils” can be used to cross-reference between different geographic locations• Careful interpretation is required.
  74. 74. Lecture 6: What can DNA tell us?
  75. 75. Lecture 6: What can DNA tell us?• Species relationships previously based on:
  76. 76. Lecture 6: What can DNA tell us?• Species relationships previously based on: • bone structures
  77. 77. Lecture 6: What can DNA tell us?• Species relationships previously based on: • bone structures • morphologies
  78. 78. Lecture 6: What can DNA tell us?• Species relationships previously based on: • bone structures • morphologies • development
  79. 79. Lecture 6: What can DNA tell us?• Species relationships previously based on: • bone structures • morphologies • development • behavior
  80. 80. Lecture 6: What can DNA tell us?• Species relationships previously based on: • bone structures • morphologies • development • behavior • ecological niche
  81. 81. Lecture 6: What can DNA tell us?• Species relationships previously based on: • bone structures • morphologies • development • behavior • ecological niche • ....
  82. 82. Lecture 6: What can DNA tell us?• Species relationships previously based on: • bone structures • morphologies • development • behavior • ecological niche • ....
  83. 83. Lecture 6: What can DNA tell us?• Species relationships previously based on: • bone structures • morphologies • development • behavior • ecological niche • ....• DNA holds lots of additional information:
  84. 84. Lecture 6: What can DNA tell us?• Species relationships previously based on: • bone structures • morphologies • development • behavior • ecological niche • ....• DNA holds lots of additional information: • 2. Evolutionary relationships
  85. 85. Lecture 6: What can DNA tell us?• Species relationships previously based on: • bone structures • morphologies • development • behavior • ecological niche • ....• DNA holds lots of additional information: • 2. Evolutionary relationships • 3. Current evolutionary contexts
  86. 86. Lecture 6: What can DNA tell us?• Species relationships previously based on: • bone structures • morphologies • development • behavior • ecological niche • ....1. DNA sequences change• DNA holds lots of additional information: • 2. Evolutionary relationships • 3. Current evolutionary contexts
  87. 87. 1. DNA sequences change
  88. 88. 1. DNA sequences changeDNA mutations occur all the time.
  89. 89. 1. DNA sequences changeDNA mutations occur all the time.Reasons:
  90. 90. 1. DNA sequences changeDNA mutations occur all the time.Reasons: • mistakes in DNA replication or recombination,
  91. 91. 1. DNA sequences changeDNA mutations occur all the time.Reasons: • mistakes in DNA replication or recombination, • mutagens (radiation, chemicals),
  92. 92. 1. DNA sequences changeDNA mutations occur all the time.Reasons: • mistakes in DNA replication or recombination, • mutagens (radiation, chemicals), • viruses
  93. 93. 1. DNA sequences changeDNA mutations occur all the time.Reasons: • mistakes in DNA replication or recombination, • mutagens (radiation, chemicals), • viruses • transposons
  94. 94. 1. DNA sequences changeDNA mutations occur all the time.Reasons: • mistakes in DNA replication or recombination, • mutagens (radiation, chemicals), • viruses • transposons
  95. 95. 1. DNA sequences changeDNA mutations occur all the time.Reasons: • mistakes in DNA replication or recombination, • mutagens (radiation, chemicals), • viruses • transposonsInherited: only if in germ line. Not from soma.
  96. 96. Types of mutations
  97. 97. Types of mutations• Small: replacement, insertion, deletion. E.g.:
  98. 98. Types of mutations• Small: replacement, insertion, deletion. E.g.: original: GATTACAGATTACA Point mutation new : GATTACATATTACA
  99. 99. Types of mutations• Small: replacement, insertion, deletion. E.g.: original: GATTACAGATTACA Point mutation new : GATTACATATTACA Polymerase slippage original: TGCAGATAGAGAGAGAGAGAGAGCAGAT in satellite new : TGCAGATAGAGAGAGAGAGCAGAT
  100. 100. Types of mutations• Small: replacement, insertion, deletion. E.g.: original: GATTACAGATTACA Point mutation new : GATTACATATTACA Polymerase slippage original: TGCAGATAGAGAGAGAGAGAGAGCAGAT in satellite new : TGCAGATAGAGAGAGAGAGCAGAT• Big: inversions, duplications, deletions
  101. 101. Types of mutations• Small: replacement, insertion, deletion. E.g.: original: GATTACAGATTACA Point mutation new : GATTACATATTACA Polymerase slippage original: TGCAGATAGAGAGAGAGAGAGAGCAGAT in satellite new : TGCAGATAGAGAGAGAGAGCAGAT• Big: inversions, duplications, deletions
  102. 102. Types of mutations• Small: replacement, insertion, deletion. E.g.: original: GATTACAGATTACA Point mutation new : GATTACATATTACA Polymerase slippage original: TGCAGATAGAGAGAGAGAGAGAGCAGAT in satellite new : TGCAGATAGAGAGAGAGAGCAGAT• Big: inversions, duplications, deletions
  103. 103. Types of mutations• Small: replacement, insertion, deletion. E.g.: original: GATTACAGATTACA Point mutation new : GATTACATATTACA Polymerase slippage original: TGCAGATAGAGAGAGAGAGAGAGCAGAT in satellite new : TGCAGATAGAGAGAGAGAGCAGAT• Big: inversions, duplications, deletions
  104. 104. Types of mutations • Small: replacement, insertion, deletion. E.g.: original: GATTACAGATTACA Point mutation new : GATTACATATTACA Polymerase slippage original: TGCAGATAGAGAGAGAGAGAGAGCAGAT in satellite new : TGCAGATAGAGAGAGAGAGCAGAT • Big: inversions, duplications, deletionsMutations are the source of genetic, inheritable variation
  105. 105. What happens to a mutation?
  106. 106. What happens to a mutation?• Most point mutations are neutral: no effect.
  107. 107. What happens to a mutation?• Most point mutations are neutral: no effect. • --> Genetic drift, hitchhiking... (--> elimination or fixation)
  108. 108. What happens to a mutation?• Most point mutations are neutral: no effect. • --> Genetic drift, hitchhiking... (--> elimination or fixation)• Some are very deleterious;
  109. 109. What happens to a mutation?• Most point mutations are neutral: no effect. • --> Genetic drift, hitchhiking... (--> elimination or fixation)• Some are very deleterious; Eg. antennapedia (hox gene) mutation:
  110. 110. What happens to a mutation?• Most point mutations are neutral: no effect. • --> Genetic drift, hitchhiking... (--> elimination or fixation)• Some are very deleterious; Some increase fitness. Eg. antennapedia (hox gene) mutation:
  111. 111. What happens to a mutation?• Most point mutations are neutral: no effect. • --> Genetic drift, hitchhiking... (--> elimination or fixation)• Some are very deleterious; Some increase fitness. • --> selection eliminates or fixes them Eg. antennapedia (hox gene) mutation:
  112. 112. What happens to a mutation?• Most point mutations are neutral: no effect. • --> Genetic drift, hitchhiking... (--> elimination or fixation)• Some are very deleterious; Some increase fitness. • --> selection eliminates or fixes them Eg. antennapedia (hox gene) mutation:See population genetics lectures & practical
  113. 113. 2. DNA clarifies evolutionary relationships
  114. 114. 2. DNA clarifies evolutionary relationships Human: GATTACA
  115. 115. 2. DNA clarifies evolutionary relationships Human: GATTACA Peacock: GATTGCA
  116. 116. 2. DNA clarifies evolutionary relationships Human: GATTACA Peacock: GATTGCA Amoeba: GGCTCCA
  117. 117. 2. DNA clarifies evolutionary relationships Human: GATTACA Peacock: GATTGCA Amoeba: GGCTCCA Amoeba Human Peacock
  118. 118. 2. DNA clarifies evolutionary relationships Human: GATTACA Peacock: GATTGCA Amoeba: GGCTCCA Amoeba Human Peacock See practical!
  119. 119. Linnaeus 1735 classification of animals
  120. 120. Carl Woese in 1977
  121. 121. Cows are more closey related to whales than to horses Cetacea ArtiodactylaCetartiodactyla
  122. 122. Bat echolocation Teeling 2002
  123. 123. Bat echolocationEvolved twice! Teeling 2002
  124. 124. Molecular clocks: another dating system Stochastic clock
  125. 125. Molecular clocks: another dating system Genetic change Stochastic clock Metronomic clock Time
  126. 126. Molecular clocks: another dating system Genetic change Stochastic clock Metronomic clock Mutations may accumulate with time at different rates Time
  127. 127. Ancient DNA
  128. 128. Ancient DNA: below 2km of ice
  129. 129. Ancient DNA: below 2km of iceREPORTS criterion many pu abundanc as is typ efficiently low-leve due to D Appr the John signed to tion and the order genus Sa sistent w more tha Arctic en plant div ilar to t which co ceae), pu sales), an by confir Glacier s trol, show ably reco In co Fig. 1. Sample location and core schematics. (A) Map showing the locations of the Dye 3 (65°11N, sample, t 45°50W) and GRIP (72°34N, 37°37W) drilling sites and the Kap København Formation (82°22N, that coul
  130. 130. also shown. Asteraceae, Fabaceae, and Poaceae, are mainly Table 1. Plant and insect taxa obtained from the JEG and Dye 3 silty ice are shown. Sequences have been deposited in GenBank under accession samples. For each taxon (assigned to order, family, or genus level), the numbers EF588917 to EF588969, except for seven sequences less than 50 genetic markers (rbcL, trnL, or COI), the number of clone sequences bp in size that are shown below. Their taxon identifications are indicated supporting the identification, and the probability support (in percentage) by symbols. Order Marker Clones Support (%) Family Marker Clones Support (%) Genus Marker Clones Support (%) JEG sample Rosales rbcL 3 90–99 Malpighiales rbcL 2 99–100 Salicaceae rbcL 2 99–100 trnL 5 99–100 trnL 4 100 Saxifragales rbcL 3 92–94 Saxifragaceae rbcL 2 92 Saxifraga rbcL 2 91 Dye 3 sample Coniferales rbcL 44 97–100 Pinaceae* rbcL 20 100 Picea rbcL 20 99–100 trnL 27 100 trnL 25 100 Pinus† trnL 17 90–99 Taxaceae‡ rbcL 23 91–98 trnL 2 100 Poales§ rbcL 67 99–100 Poaceae§ rbcL 67 99–100 trnL 17 97–100 trnL 13 100 Asterales rbcL 18 90–100 Asteraceae rbcL 2 91 trnL 27 100 trnL 27 100 Fabales rbcL 10 99–100 Fabaceae rbcL 10 99–100 trnL 3 99 trnL 3 99 Fagales rbcL 10 95–99 Betulaceae rbcL 8 93–97 Alnus rbcL 7 91–95 trnL 12 100 trnL 11 98–100 trnL 9 98–100 Lepidoptera COI 12 97–99 *Env_2, trnL ATCCGGTTCATGAAGACAATGTTTCTTCTCCTAAGATAGGAAGGG. Env_3, trnL ATCCGGTTCATGAAGACAATGTTTCTTCTCCTAATATAGGAAGGG. Env_4, trnL ATCCGGTTCATGAGGACAATGTTTCTTCTCCTAATA- TAGGAAGGG. †Env_5, trnL CCCTTCCTATCTTAGGAGAAGAAACATTGTCTTCATGAACCGGAT. Env_6, trnL TTTCCTATCTTAGGAGAAGAAACATTGTCTTCATGAACCGGAT. ‡Env_1, trnL ATCCGTATTATAG- GAACAATAATTTTATTTTCTAGAAAAGG. §Env_7, trnL CTTTTCCTTTGTATTCTAGTTCGAGAATCCCTTCTCAAAACACGGAT.12 6 JULY 2007 VOL 317 SCIENCE www.sciencemag.org Willerslev 2007
  131. 131. also shown. Asteraceae, Fabaceae, and Poaceae, are mainly Table 1. Plant and insect taxa obtained from the JEG and Dye 3 silty ice are shown. Sequences have been deposited in GenBank under accession samples. For each taxon (assigned to order, family, or genus level), the numbers EF588917 to EF588969, except for seven sequences less than 50 genetic markers (rbcL, trnL, or COI), the number of clone sequences bp in size that are shown below. Their taxon identifications are indicated supporting the identification, and the probability support (in percentage) by symbols. Order Marker Clones Support (%) Family Marker Clones Support (%) Genus Marker Clones Support (%) JEG sample Rosales rbcL 3 90–99 Malpighiales rbcL 2 99–100 Salicaceae rbcL 2 99–100 trnL 5 99–100 trnL 4 100 Saxifragales rbcL 3 92–94 Saxifragaceae rbcL 2 92 Saxifraga rbcL 2 91 Dye 3 sample Coniferales rbcL 44 97–100 Pinaceae* rbcL 20 100 Picea rbcL 20 99–100 trnL 27 100 trnL 25 100 Pinus† trnL 17 90–99 Taxaceae‡ rbcL 23 91–98 trnL 2 100 Poales§ rbcL 67 99–100 Poaceae§ rbcL 67 99–100 trnL 17 97–100 trnL 13 100 Asterales rbcL 18 90–100 Asteraceae rbcL 2 91 trnL 27 100 trnL 27 100 Fabales rbcL 10 23. L. 99–100R. Hacker, G. Hirth, P. B. Kelemen, Mehl, B. Fabaceae rbcL 10 99–100 R. L. Rudnick, Ed. (Elsevier-Pergamon, Oxford, 2003), Supporting Online Ma trnL 3 J. Geophys. Res. 108, 10.1029/2002JB002233 99 trnL 3 vol. 3, pp. 593–659. 99 www.sciencemag.org/cgi/co (2003). 27. T. V. Gerya, D. A. Yuen, Earth Planet. Sci. Lett. 212, 47 SOM Text Fagales rbcL R. Jicha, Betulaceae rbcL 10 24. B.95–99 D. W. Scholl, B. S. Singer, G. M. Yogodzinski, 8 (2003).93–97 Alnus rbcL 7 Figs. S1 and S2 91–95 trnL 12 S. M. 100 Geology 34, 661 (2006). Kay, trnL 1128. 98–100 trnL We thank M. Long, E. Kneller, and C. Conrad for 9 References98–100 Lepidoptera COI 12 25. C.-T. Lee, X. Cheng, U. Horodyskyj, Contrib. Min. Petrol. 97–99 conversations that motivated this work. Funding was 151, 222 (2006). provided by NSF grants EAR-9910899, EAR-0125919, and 13 February 2007; accepte *Env_2, trnL ATCCGGTTCATGAAGACAATGTTTCTTCTCCTAAGATAGGAAGGG. Env_3,A.trnL Greene, in The Crust, 26. P. B. Kelemen, K. Hanghøj, R. ATCCGGTTCATGAAGACAATGTTTCTTCTCCTAATATAGGAAGGG. Env_4, trnL ATCCGGTTCATGAGGACAATGTTTCTTCTCCTAATA- EAR-0509882. 10.1126/science.1141269 TAGGAAGGG. †Env_5, trnL CCCTTCCTATCTTAGGAGAAGAAACATTGTCTTCATGAACCGGAT. Env_6, trnL TTTCCTATCTTAGGAGAAGAAACATTGTCTTCATGAACCGGAT. ‡Env_1, trnL ATCCGTATTATAG- GAACAATAATTTTATTTTCTAGAAAAGG. §Env_7, trnL CTTTTCCTTTGTATTCTAGTTCGAGAATCCCTTCTCAAAACACGGAT.12 Ancient Biomolecules from 6 JULY 2007 VOL 317 SCIENCE www.sciencemag.org face of the frozen c control for potentia have entered the inte Deep Ice Cores Reveal a Forested cracks or during th Polymerase chain r Southern Greenland Willerslev 2007 the plasmid DNA w tracts of the outer ice 1 2 3 4 interior, confirming
  132. 132. Ancient DNA
  133. 133. Ancient DNA Hair sequencing
  134. 134. Consensus with fossil record?
  135. 135. Genomic Evidence for Large, Long-Lived Ancestors toPlacental MammalsJ. Romiguier,1 V. Ranwez,1,2 E.J.P. Douzery,1 and N. Galtier*,11 ´ CNRS, Universite Montpellier 2, UMR 5554, ISEM, Montpellier, France2 Montpellier SupAgro, UMR 1334, AGAP, Montpellier, France*Corresponding author: E-mail: nicolas.galtier@univ-montp2.fr.Associate editor: Naruya SaitouAbstractIt is widely assumed that our mammalian ancestors, which lived in the Cretaceous era, were tiny animals that survived masteroid impacts in shelters and evolved into modern forms after dinosaurs went extinct, 65 Ma. The small size of most Memammalian fossils essentially supports this view. Paleontology, however, is not conclusive regarding the ancestry ofmammals, because Cretaceous and Paleocene fossils are not easily linked to modern lineages. Here, we use full-genome destimate the longevity and body mass of early placental mammals. Analyzing 36 fully sequenced mammalian genomreconstruct two aspects of the ancestral genome dynamics, namely GC-content evolution and nonsynonymous over synous rate ratio. Linking these molecular evolutionary processes to life-history traits in modern species, we estimate thaplacental mammals had a life span above 25 years and a body mass above 1 kg. This is similar to current primates, cetartiodor carnivores, but markedly different from mice or shrews, challenging the dominant view about mammalian origevolution. Our results imply that long-lived mammals existed in the Cretaceous era and were the most successful in evoopening new perspectives about the conditions for survival to the Cretaceous–Tertiary crisis.
  136. 136. An issue with sequence phylogenies• Can be ambiguous if not enough information.
  137. 137. Ambiguities in mutationsancestral species 1. species 2. What happenedsequence
  138. 138. Ambiguities in mutationsancestral species 1. species 2. What happenedsequence
  139. 139. Ambiguities in mutationsancestral species 1. species 2. What happenedsequence
  140. 140. Ambiguities in mutationsancestral species 1. species 2. What happenedsequence
  141. 141. Ambiguities in mutationsancestral species 1. species 2. What happenedsequence
  142. 142. Ambiguities in mutationsancestral species 1. species 2. What happenedsequence
  143. 143. Ambiguities in mutationsancestral species 1. species 2. What happenedsequence
  144. 144. An issue with sequence phylogenies• Can be ambiguous if not enough information.
  145. 145. An issue with sequence phylogenies• Can be ambiguous if not enough information. • Used to be expensive.
  146. 146. An issue with sequence phylogenies• Can be ambiguous if not enough information. • Used to be expensive. • Mitochondrial gene vs. nuclear gene. Several genes?
  147. 147. An issue with sequence phylogenies• Can be ambiguous if not enough information. • Used to be expensive. • Mitochondrial gene vs. nuclear gene. Several genes?• Whole genome sequencing is now dirt cheap! No longer a problem! (for establishing relationships in past 200-400 million years...)
  148. 148. 3. DNA sequence clarifies current evolutionary contexts
  149. 149. Three-spined stickleback Example 1. Gasterosteus aculeatus Different amounts of armor platingBill Cresko et al; David Kingsley et al
  150. 150. Three-spined stickleback Example 1. Gasterosteus aculeatus in Saltwater: Different amounts of armor plating in Freshwater:Bill Cresko et al; David Kingsley et al
  151. 151. F Independent The freshwater populations, despite their younger age, ar divergent both from the oceanic ancestral populations and colonization events each other, consistent with our supposition that they rep F independent colonizations from the ancestral oceanic popu These results are remarkably similar to results obtained pre from some of these same populations using a small num F less than 10,000 microsatellite and mtDNA markers [55]. This combinat large amounts of genetic variation and overall low-to-mo S differentiation between populations, coupled with recent and years ago phenotypic evolution in the freshwater populations, prese ideal situation for identifying genomic regions that have resp S to various kinds of natural selection. Patterns of genetic diversity distributed across the genome To assess genome-wide patterns we examined mean nuc diversity (p) and heterozygosity (H) using a Gaussian in Saltwater: smoothing function across each linkage group (Figure 4 and S1). Although the overall mean diversity and heterozygosity are 0.00336 and 0.00187, respectively, values vary widely the genome. Nucleotide diversity within genomic regions from 0.0003 to over 0.01, whereas heterozygosity values from 0.0001 to 0.0083. This variation in diversity acro genome provides important clues to the evolutionary pr that are maintaining genetic diversity. For example, in Freshwater: expected (p) and observed (H) heterozygosity largely corre F = Freshwater they differ at a few genomic regions (e.g., on Linkage Grou Genomic regions that exhibit significantly (p,1025) low le S = Saltwater diversity and heterozygosity (e.g. on LG II and V, Fig and Figure S1) may be the result of low mutation low recombination rate, purifying or positive selection consistent across populations, or some combination ofBill Cresko et al; [9,36,105–107].
  152. 152. RAD = Restriction-site Associated DNA sequencing Population Genomics in Stickleback The freshwater populations, despite their younger age, are more F divergent both from the oceanic ancestral populations and from each other, consistent with our supposition that they represent F independent colonizations from the ancestral oceanic population. These results are remarkably similar to results obtained previously F from some of these same populations using a small number of microsatellite and mtDNA markers [55]. This combination of large amounts of genetic variation and overall low-to-moderate S differentiation between populations, coupled with recent and rapid 20 fish per population phenotypic evolution in the freshwater populations, presents an ideal situation for identifying genomic regions that have responded S to various kinds of natural selection. Patterns of genetic diversity distributed across the 45,789 SNPs identified genome To assess genome-wide patterns we examined mean nucleotide diversity (p) and heterozygosity (H) using a Gaussian kernel smoothing function across each linkage group (Figure 4 and Figure S1). Although the overall mean diversity and heterozygosity values each locus sequenced are 0.00336 and 0.00187, respectively, values vary widely across the genome. Nucleotide diversity within genomic regions ranges from 0.0003 to over 0.01, whereas heterozygosity values range F = Freshwater 5–10 times per fish. from 0.0001 to 0.0083. This variation in diversity across the genome provides important clues to the evolutionary processes that are maintaining genetic diversity. For example, while expected (p) and observed (H) heterozygosity largely correspond, S = Saltwater they differ at a few genomic regions (e.g., on Linkage Group XI). Genomic regions that exhibit significantly (p,1025) low levels of diversity and heterozygosity (e.g. on LG II and V, Figure 4 and Figure S1) may be the result of low mutation rate, low recombination rate, purifying or positive selection that is consistent across populations, or some combination of factors [9,36,105–107]. Figure 1. Location of oceanic and freshwater populations In contrast, other genomic regions, such as those on LG III andBill Cresko et Threespine stickleback were sampled from three freshwa- examined. al; XIII (Figure 4), show very high levels of both diversity and
  153. 153. Differentiation between populations (FST) Population Genomics i Saltwater vs. Saltwater FST bewteen 2 populations: 0 = populations have same alleles in similar frequencies 1 = populations have completely different allelesBill Cresko et al; David Kingsley et al
  154. 154. Differentiation between populations (FST) Population Genomics i Saltwater vs. SaltwaterFreshwater vs.Freshwater Figure 6. Genome-wide differentiation among populations. FST across the genome, with colored bars indicating significa (p#1025, blue; p#1027, red) and reduced (p#1025, green) values. Vertical gray shading indicates boundaries of the linkage groups and scaffolds, and gold shading indicates the nine peaks of substantial population differentiation discussed in the text. (A) FST between the populations (RS and RB; note that no regions of FST are significantly elevated or reduced). (B,C,D) Differentiation of each single freshwate from the two oceanic populations, shown as the mean of the two pairwise comparisons (with RS and RB): (B) BP, (C) BL, (D) ML. Colored plot represent regions where both pairwise comparisons exceeded the corresponding significance threshold. (E) Overall population d between the oceanic and freshwater populations. (F) Differentiation among the three freshwater populations (BP, BL, ML). doi:10.1371/journal.pgen.1000862.g006 FST bewteen 2 populations: 0 = populations have same alleles in similar 2010 | Volume 6 | Issue 2 PLoS Genetics | www.plosgenetics.org 8 February frequencies 1 = populations have completely different allelesBill Cresko et al; David Kingsley et al
  155. 155. Differentiation between populations (FST) Population Genomics i Saltwater vs. SaltwaterFreshwater vs.FreshwaterFreshwater 6.blue; p#10 , red)differentiation among populations. F gray shadinggenome, with coloredofbars linkage groups and Figure (p#10 , Genome-wide 25 27 25 and reduced (p#10 , green) values. Vertical across the ST indicates boundaries the indicating significa vs. populations (RS andshading indicates regions ofpeaksare significantlypopulation differentiation discussed in the text.eachFsingle freshwate scaffolds, and gold RB; note that no the nine F of substantial ST elevated or reduced). (B,C,D) Differentiation of (A) between the ST Saltwater representoceanic populations, shown as comparisons the two pairwise comparisonssignificance threshold. (E)(C) BL, (D)population d from the two plot regions where both pairwise the mean of exceeded the corresponding (with RS and RB): (B) BP, Overall ML. Colored between the oceanic and freshwater populations. (F) Differentiation among the three freshwater populations (BP, BL, ML). doi:10.1371/journal.pgen.1000862.g006 FST bewteen 2 populations: 0 = populations have same alleles in similar 2010 | Volume 6 | Issue 2 PLoS Genetics | www.plosgenetics.org 8 February frequencies 1 = populations have completely different allelesBill Cresko et al; David Kingsley et al
  156. 156. Nine identified regions• Include 590 genes: • 31 of these known to or likely to affect morphology or osmoregulation • some previously identified via crosses; most new • finer-scale follow-up required?
  157. 157. Nine identified regions• Include 590 genes: • 31 of these known to or likely to affect morphology or osmoregulation • some previously identified via crosses; most new • finer-scale follow-up required?• Different regions, different mode of evolution:
  158. 158. Nine identified regions• Include 590 genes: • 31 of these known to or likely to affect morphology or osmoregulation • some previously identified via crosses; most new • finer-scale follow-up required?• Differentregions, different mode of evolution: • hard sweep: the same allele is selected to fixation in all freshwater populations
  159. 159. Nine identified regions• Include 590 genes: • 31 of these known to or likely to affect morphology or osmoregulation • some previously identified via crosses; most new • finer-scale follow-up required?• Different regions, different mode of evolution: • hard sweep: the same allele is selected to fixation in all freshwater populations • soft sweep: a different allele is selected to fixation in each freshwater population
  160. 160. Nine identified regions• Include 590 genes: • 31 of these known to or likely to affect morphology or osmoregulation • some previously identified via crosses; most new • finer-scale follow-up required?• Different regions, different mode of evolution: • hard sweep: the same allele is selected to fixation in all freshwater populations • soft sweep: a different allele is selected to fixation in each freshwater population • balancing selection: selection for heterozygosity
  161. 161. Little fire ant Wasmannia
  162. 162. Little fire ant Wasmannia
  163. 163. NATURE|Vol 435|30 June 2005 LETTERSTable 1 | Genotypes of queens (Q), their mates (M) and workers (w) in one nest (E-3) at each of the 11 microsatellite lociIndividual Waur-225 Waur-275 Waur-418 Waur-566 Waur-680 Waur-716 Waur-730 Waur-1166 Waur-2164 Waur-3176 Waur-1gamQueensQ-1 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298Q-2 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298Q-3 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298Q-4 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298Q-5 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298Q-6 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298Q-7 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298Q-8 223 225 105 115 100 112 263 263 171 171 184 198 158 160 95 97 298 306 230 230 288 298MalesM-1 269 107 118 265 187 192 214 95 320 244 282M-2 269 107 118 265 187 192 214 95 320 244 282M-3 269 107 118 265 187 192 214 95 320 244 282M-4 269 107 118 265 187 192 214 95 320 244 282M-5 269 107 118 265 187 192 214 95 320 244 282M-6 269 107 118 265 187 192 214 95 320 244 282M-7 269 107 118 265 187 192 214 95 320 244 282M-8 269 107 118 265 187 192 214 95 320 244 282Workersw-1 223 269 115 107 112 118 263 265 171 187 198 192 160 214 95 95 306 320 230 244 298 282w-2 225 269 115 107 100 118 263 265 171 187 184 192 158 214 95 95 298 320 230 244 288 282w-3 223 269 105 107 112 118 263 265 171 187 198 192 160 214 97 95 298 320 230 244 298 282w-4 225 269 115 107 100 118 263 265 171 187 184 192 158 214 97 95 306 320 230 244 288 282w-5 223 269 105 107 100 118 263 265 171 187 198 192 158 214 97 95 306 320 230 244 298 282w-6 225 269 115 107 112 118 263 265 171 187 184 192 160 214 97 95 306 320 230 244 288 282w-7 223 269 105 107 100 118 263 265 171 187 184 192 158 214 97 95 306 320 230 244 298 282w-8 225 269 115 107 112 118 263 265 171 187 184 192 158 214 97 95 298 320 230 244 288 282The identities of mates were determined by the sperm collected in the queen’s spermathecae. Queens and males’ genotypes illustrate their clonal production, whereas workers’ genotypes areconsistent with normal sexual reproduction. Paternal alleles are in italics. reproduction (that is, by ameiotic parthenogenesis). In 33 of the 34 nests, all queens (n ¼ 135) and gynes (n ¼ 9) cohabiting in the same nest shared an identical genotype at each of the 11 loci (Table 1 and Fig. 1). The single exception was nest B-12, in which queens differed at 1 of the 11 loci: four queens were heterozygous at Waur-2164
  164. 164. reproduction (that is, by ameiotic parthenogenesis). In 33 of th nests, all queens (n ¼ 135) and gynes (n ¼ 9) cohabiting in the s nest shared an identical genotype at each of the 11 loci (Table 1 Fig. 1). The single exception was nest B-12, in which queens diff at 1 of the 11 loci: four queens were heterozygous at Waur-2 and the remaining three queens were homozygous for one of two alleles. This variation probably reflects a mutation or recom nation event in one queen followed by clonal reproduction wi the nest. The history of this genetic change could be reconstru from the genotypes of queens collected in neighbouring nests (Fi and 2). Nine queens from two neighbouring nests (B-11 and B had the same genotype as the four heterozygous queens for lo Waur-2164, indicating that the mutation or recombination e probably was from a heterozygote to a homozygote queen. The t homozygote queens from nest B-12 had a unique genotype in population, which further supports this interpretation. A comparison between nests supports the view of restricted fem gene flow, with budding being the main mode of colony format Within three of the five sites of collection (A, C and D) all queens the same genotype at the 11 loci (Fig. 2). In one of the two other (B), all queens from 8 of the 17 nests also had an identical genot whereas in the other site (E) the queen genotypes were different in three nests sampled. Taken together, these data indicate that que belonging to the same lineage of clonally produced individ frequently head closely located nests. Moreover, genetic diffe tiation between sites was very strong, with a single occurrenc genotypes shared between sites (the eight queens of nest E-3 genotypes identical to the most common genotype found at site showing that gene flow by females is extremely restricted. In stark contrast to reproductive females, the genotypic anal revealed that workers are produced by normal sexual reproduc (Table 1). Over all 31 queenright nests, each of the 248 genoty workers had, at seven or more loci, one allele that was absenFigure 2 | Neighbour-joining dendrogram of the genetic (allele-shared) queens of their nest. Moreover, the 232 workers from the 29 nesdistances between queens (Q), gynes (G) and male sperms (M) collected which the sperm in the queen’s spermathecae was successf
  165. 165. reproduction (that is, by ameiotic parthenogenesis). In 33 of th nests, all queens (n ¼ 135) and gynes (n ¼ 9) cohabiting in the s nest shared an identical genotype at each of the 11 loci (Table 1 Fig. 1). The single exception was nest B-12, in which queens diff at 1 of the 11 loci: four queens were heterozygous at Waur-2 and the remaining three queens were homozygous for one of two alleles. This variation probably reflects a mutation or recom nation event in one queen followed by clonal reproduction wi the nest. The history of this genetic change could be reconstru from the genotypes of queens collected in neighbouring nests (Fi Downloaded from rspb.royalsocietypublishing.org on J and 2). Nine queens from two neighbouring nests (B-11 and B had2680 same genotypeSib matingfour heterozygous queens for lo the M. Pearcy et al. as the without inbreeding Waur-2164, indicating that the mutation or recombination e probably was from a heterozygote to a homozygote queen. The t two other ant sp hovia emeryi [2 homozygote queens from nest B-12 had a unique genotypelike study, it is in population, which further supports this interpretation. translates also queen mate A comparison between nests supports the view of restrictedon t sib mating fem gene flow, with budding being the main mode of colony format estingly, W aur . studies have s Within three of the five sites of collection (A, C and D) all queens derive from a the same genotype at the 11 loci (Fig. 2). In one of the two other b characterized (B), all queens from 8 of the 17 nests also had an identicalmale ge single genot whereas in the other site (E) the queen genotypes were differentma and a single is also compati in three nests sampled. Taken together, these data indicate that que a single mated belonging to gynes the same lineage of clonally produced individ workers males Interestingly frequently head closely located nests. Moreover, genetic diffe Figure 2. Clonal reproduction in queens and males. The lay male eggs th least two poten tiationthesummarizes the reproduction system ofandlongicornis being clonally p figure in between sites was very strong, P. paternal study population. Maternal (light) with a single occurrenc genotypes shared between sites Contribution to the of nest could (dark) chromosomes are displayed. (the eight queens genome E-3 genotypes of the offspringthe indicated by arrows genotype found at site genome identical to is most common (dashed [21]. Indeed, o arrow represents the mother laying haploid eggs with no one parental ge showing contribution to the genome). actual that gene flow by females is extremely restricted. parasitoas the In stark contrast to reproductive females, the genotypic anal the waterfrog h revealedwith their brothersare producedand yet maintain lenta [33,34], a mate that workers inside the nest, by normal sexual reproduc (Table 1). Over in the generations. worker castes over of theFormica [35,36 heterozygosity unlimited number allof queen and 31 queenright nests, each an paternal genom 248 genoty workers had, at the heterozygosity level of new queens is that was absen Surprisingly, seven or more loci, one allele one. The alternFigure 2 | Neighbour-joining dendrogram of the genetic (allele-shared) queens of their nest. Moreover, the 232link between lay anucleated completely independent of the genealogical workers from the 29 nesdistances between queens (Q), gynes (G) and male sperms (M) collected which mother queen and her mate in this species, as there was successf the the sperm in the queen’s spermathecae fertilized [37]. is no mixing of the paternal and maternal lineages. By which eggs will
  166. 166. Conservation
  167. 167. Summary
  168. 168. Summary• 1. DNA sequences change
  169. 169. Summary• 1. DNA sequences change• 2. Evolutionary relationships
  170. 170. Summary• 1. DNA sequences change• 2. Evolutionary relationships• 3. Current evolutionary contexts
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×