Your SlideShare is downloading. ×
0
Геномика адаптивного иммунитета
как подход к индивидуальной диагностике

Dmitriy M. Chudakov
Genomics of Adaptive Immunity...
В каждом из нас – порядка 1012 Т клеток

Т клетки и Т-клеточные рецепторы
Клональная экспансия Т клеток
Специфичность
Т-клеточного рецептора
Анализ индивидуального репертуара
Т-клеточных рецепторов
MiTCR software
http://mitcr.milaboratory.com/

Bolotin DA et al. MiTCR: software for T-cell receptor sequencing data analy...
Анализ индивидуального репертуара
Т-клеточных рецепторов
TCR software
TCR software
Глубокий анализ репертуаров
Т клеточных рецепторов: “простые” вопросы
• Общее разнообразие в каждом человеке?
• Общее разн...
Разнообразие Т-клеточных рецепторов
в крови и старение

Britanova et al., under consideration
Судьба клонов Т-лимфоцитов после
иммуносупрессивной терапии

Britanova et al., Bone Marrow Transplantation, 2012
Репертуары разных людей
существенно пересекаются

Shugay et al., Frontiers in Immunology, 2013.
Конвергенция вариантов Т клеточных
рецепторов происходит от того что:
• Не вполне случайная сборка в тимусе
• Позитивная и...
Общие клонотипы и диагностика
TRBV CDR3 специфичный
к пептиду NLVPMVATV из вируса CMV

CASSLAPGATNEKLFF-1
TGTGCCAGCAGCTTAG...
Специфичность
Т-клеточного рецептора
TCR software
Наша команда
Лаборатория геномики
адаптивного иммунитета:

Лаборатория сравнительной и
функциональной геномики

Britanova ...
Спасибо!
Pairing TCR chains in emulsion

Turchaninova MA, et al. Pairing of T-cell receptor chains via emulsion PCR.
Eur J Immunol....
TCR diversity and % of naïve T cells

Britanova et al., under consideration
TCR diversity and % of naïve T cells

Britanova et al., under consideration
Estimating total TCR beta diversity

Britanova et al., under consideration
Chudakov yandex2013
Upcoming SlideShare
Loading in...5
×

Chudakov yandex2013

555

Published on

Научно-технический семинар по биоинформатике. Дмитрий Чудаков.

0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
555
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
2
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Transcript of "Chudakov yandex2013 "

  1. 1. Геномика адаптивного иммунитета как подход к индивидуальной диагностике Dmitriy M. Chudakov Genomics of Adaptive Immunity lab Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Moscow, Russia , 2013
  2. 2. В каждом из нас – порядка 1012 Т клеток Т клетки и Т-клеточные рецепторы
  3. 3. Клональная экспансия Т клеток
  4. 4. Специфичность Т-клеточного рецептора
  5. 5. Анализ индивидуального репертуара Т-клеточных рецепторов
  6. 6. MiTCR software http://mitcr.milaboratory.com/ Bolotin DA et al. MiTCR: software for T-cell receptor sequencing data analysis. Nature Methods, 2013.
  7. 7. Анализ индивидуального репертуара Т-клеточных рецепторов
  8. 8. TCR software
  9. 9. TCR software
  10. 10. Глубокий анализ репертуаров Т клеточных рецепторов: “простые” вопросы • Общее разнообразие в каждом человеке? • Общее разнообразие в людях => насколько мы похожи? • Как разнообразие меняется с возрастом? • Как меняется после иммуносупрессивной терапии? • Как различается в популяциях Т лимфоцитов? • Общие для людей активированные варианты = диагностика?
  11. 11. Разнообразие Т-клеточных рецепторов в крови и старение Britanova et al., under consideration
  12. 12. Судьба клонов Т-лимфоцитов после иммуносупрессивной терапии Britanova et al., Bone Marrow Transplantation, 2012
  13. 13. Репертуары разных людей существенно пересекаются Shugay et al., Frontiers in Immunology, 2013.
  14. 14. Конвергенция вариантов Т клеточных рецепторов происходит от того что: • Не вполне случайная сборка в тимусе • Позитивная и негативная селекция в тимусе • Ограниченный набор вариантов узнавания антигенных пептидов (не так много бывает ключей к одному замку).
  15. 15. Общие клонотипы и диагностика TRBV CDR3 специфичный к пептиду NLVPMVATV из вируса CMV CASSLAPGATNEKLFF-1 TGTGCCAGCAGCTTAGCGCCGGGAGCAACTAATGAAAAACTGTTTTTT CASSLAPGATNEKLFF-2 TGTGCCAGCAGCTTAGCCCCCGGGGCAACTAATGAAAAACTGTTTTTT CASSLAPGATNEKLFF-3
  16. 16. Специфичность Т-клеточного рецептора
  17. 17. TCR software
  18. 18. Наша команда Лаборатория геномики адаптивного иммунитета: Лаборатория сравнительной и функциональной геномики Britanova O.V., PhD. Turchaninova M.A., PhD. Shcherbo D.S., PhD. Merzlyak E.M., PhD. Staroverov D.B., researcher Bolotin D.A., researcher Shugai, M., researcher Kotlobay A.A., researcher Putintseva E.A., PhD st Schemyakina I.I., PhD st Chudakov D.M., D.Sc. Zvyagin I., PhD. Mamedov I.Z., PhD. Lebedev Y.B. D.Sc. Pogoreliy M. PhD st.
  19. 19. Спасибо!
  20. 20. Pairing TCR chains in emulsion Turchaninova MA, et al. Pairing of T-cell receptor chains via emulsion PCR. Eur J Immunol. 2013
  21. 21. TCR diversity and % of naïve T cells Britanova et al., under consideration
  22. 22. TCR diversity and % of naïve T cells Britanova et al., under consideration
  23. 23. Estimating total TCR beta diversity Britanova et al., under consideration
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×