Your SlideShare is downloading. ×
0
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Prrs rosalba
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Prrs rosalba

845

Published on

Published in: Education
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
845
On Slideshare
0
From Embeds
0
Number of Embeds
3
Actions
Shares
0
Downloads
37
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Síndrome Respiratorio y Reproductivo del Cerdo (PRRS) MVZ. MC. Rosalba Carreón Nápoles Departamento de Producción Animal: Cerdos FMVZ-UNAM Sinaloa, 2011
  • 2. Definición Enfermedad infecto-contagiosa provocada por un Arterivirus. Esta caracterizada por provocar una falla reproductiva, así como neumonía en animales jóvenes y en crecimiento.
  • 3. •Un virus similar fue aislado en Estados Unidos en 1992 y se le conoce como ATTC VR 2332. En Europa se le denomino síndrome respiratorio y aborto epidémico porcino (PEARS) y oreja azul entre otros. El primer aislamiento fue realizado en el Instituto Central de Veterinaria de Netherlands en 1991 y se le designo a la etiología como virus Lelystad.
  • 4. Arterivirus Familia: Arteriviridae Orden: Nidovirales Replicación en macrófagos. Establecimiento de infecciones persistentes asintomáticas.
  • 5. Genoma RNA Envuelto Sensible a solventes de lípidos y cloroformo. Estable varios meses a 70º C y 1 mes a 4º C. 7 proteínas estructurales
  • 6. Posee un alto rango de mutación por lo que hay una significativa variación genómica entre las cepas. Las cepas se han clasificado en europeas y americanas. GP5 asociada a la variabilidad del virus
  • 7. Relación cepas-signología A través de RFLPs 1-0-4 asociado a falla reproductiva y mortalidad en maternidad. 1-0-2 en fase de engorda Los vacunales son similares geneticamente, pero no se asocia a signos de enfermedad Rosendal IPVS 2010
  • 8. Tipo Europeo Se han descrito cepas de alta y baja virulencia. Difieren en viremia, signos, lesiones, eliminación. Las de baja virulencia no pueden detectarse en hisopos porque son de baja eliminación.
  • 9. Circulación Viral Las diferentes cepas pueden circular de diferente manera en las diferentes formas. Una cepa puede circular brevemente en un grupo de una edad mientras en otra granja la misma cepa puede persistir mas ampliamente por un largo periodo. Esto influye en la epidemiología, signos, lesiones, diagnostico y control
  • 10. Epidemiología Se transmite por contacto estrecho de cerdo a cerdo. También por saliva, semen, orina y heces. No existen otros hospederos, los roedores no son susceptibles. Solamente se ha detectado en patos silvestres como susceptibles al virus. El virus el altamente infeccioso, la dosis requerida para una infección activa es extremadamente baja.(10 partículas) De acuerdo a su patogenicidad influirá esto en las vías por la que se elimina y la cantidad eliminada.
  • 11. Epidemiología La transmisión entre granjas ocurre mediante cerdos portadores y el uso de semen contaminado. El incremento de la inseminación artificial ha conllevado a la diseminación de la enfermedad. La eliminación en semen puede ser intermitente hasta por un período de 92 días.
  • 12. Epidemiología Puede haber infecciones subclínicas con resolución en infecciones persistentes. Los lechones nacidos virémicos de hembras infectadas en el ultimo tercio de gestación, pueden crear subpoblaciones de cerdos virémicos en el hato originando cuadros crónicos.
  • 13. Epidemiología PRRS Granjas Libres Granjas Positivas Estables (No signología) Granjas Positivas Inestables (signología)
  • 14. Inmunidad Se desarrolla y confiere protección con cepas homólogas y parcial con las heterólogas Importante para establecer la cinética de la enfermedad. La presencia de anticuerpos, No impide la viremia. Los ac SN aparecen hasta el mes y su pico a los 3 meses bloquean o suprimen la infección sobre todo los producciones por gp5
  • 15. gP5
  • 16. Inmunidad Celular Hay interferón gamma a partir de la 3ª. semana. Altera los patrones de citoquinas liberadas por los macrófagos. Se afectan subpoblaciones CD2, CD4 y CD8+
  • 17. Fig. 2 Macrófago alveolar Fig. 3 Macrófago muerto por el virus de PRRS
  • 18. Signos clínicos I Dependen de: La virulencia de la cepa involucrada. Edad de los animales. Co-infeciones con otros virus y bacterias. Factores estresantes medioambientales.
  • 19. Hembra y lechón Aumento de partos prematuros. Lechones nacidos débiles. Lechones nacidos muertos. Cuadro respiratorio en lechones.
  • 20. Verracos Baja la libido. Decrece motilidad espermática Incremento de anormalidades en la cola del espermatozoide y presencia de gotas citoplasmáticas. Baja el volumen del eyaculado.
  • 21. Linea de Produccion Fiebre, anorexia. Cianosis en orejas, vientre y miembros. Cuadro respiratorio. Asociación con otros virus y bacterias.
  • 22. Interacciones Salmonelosis Enfermedad de Glasser Neumonía enzooótica P R R S Parvovirosis Estreptococosis Circovirosis Pleuropneumonia
  • 23. Lesiones Macroscópicas: Neumonía intersticial Linfoadenopatia generalizada. Microscópicas: Engrosamiento paredes alveolares. Hipertrofia de nódulos linfáticos
  • 24. ¿Como la diagnosticamos?
  • 25. Aislamiento viral
  • 26. Líneas celulares de ciertos monos africanos: MAO-104 MARC-145. Más usada en Estados Unidos. Limitantes: variación en la susceptibilidad de las líneas: usar 2 líneas.
  • 27. Limitantes Disponibilidad de cultivo celular de bajo pasaje. El aislamiento viral está limitado a dos líneas celulares. El virus es difícil de aislar. Implica de una a dos semanas. La muestra debe enviarse al laboratorio a la brevedad posible y en congelación.
  • 28. Reacción en cadena de la polimerasa (PCR) Extracción del ácido nucleico del virus y su posterior amplificación de una porción específica de su material genético para su posterior identificación mediante una electroforesis. Interpretación: Presencia del fragmento amplificado del PCR, comparándolo con un control de pares de bases y el control positivo.
  • 29. PCR MUESTRAS: Suero Tejidos Semen Extraccion RNA Amplificacion Visualizacion del fragmento amplificado Electroforesis
  • 30. PCR Altamente sensible y específico, capaz de detectar 10 viriones por ml de semen. El resultado puede obtenerse de 24-48 horas. Se puede utilizar para diferenciar el virus americano del europeo. Hay PCR en 1 y 2 pasos. En 30-35 ciclos se producen 235 (34´359´738,368) moléculas idénticas del ADN original (sensibilidad) Semen hay eliminación intermitente y con baja carga viral. Al infectarse a los 2 días pueden empezar a eliminarlo en semen. PCR positiva en suero PCR positiva en tejidos 1mes 2 meses
  • 31. Fluidos orales Al correlacionarlo con PCR en suero hay resultados inconsistentes en pie de cría y cerdos jóvenes. Mas consistencia en animales de engorda. Influir: Variación de la cepa y tiempo de infección. Puede tener el mismo valor diagnostico que el suero en fase aguda. Afecta por el tipo y concentración de cepa Utilizar pooles Charreire IPVS 2010
  • 32. Fetos Cordón umbilical húmedo Pulmones no colapsados
  • 33. Tarjetas FTA Papel de una matriz de celulosa que lisa las células en la muestra, mientras preserva los ácidos nucleicos. Al inactiva a virus y bacterias, no son infecciosas. Pueden almacenarse a temperatura ambiente y los ácidos nucleicos quedan protegidos de la degradación. Se han usado con muestras de suero, sangre y fluidos orales.
  • 34. •RT- PCR ANIDADO Se realiza una segunda reacción con un par de primers que se localizan dentro de la región amplificada por primera vez . Se incrementa la sensibilidad. Cuando usarla: •Animales de gran valor (reproductores) •Se presume de que existe la enfermedad, pero no se tiene la certeza •Se requiere certificar que no hay virus circulando en la granja (alta sensibilidad) •El muestreo se realiza muy temprano o muy tardío a la fase de viremia
  • 35. PRC tiempo real PCRtr PCR TIEMPO REAL •Herramienta sensible, específica,rápida y cuantitativa para el diagnóstico de las enfermedades infecciosas. •Algunas de las aplicaciones del PCR en tiempo real: •Cuantificación viral •Genotipificación (virus involucrados son del mismo o diferente origen) Alta reproducibilidad Muchas muestras se pueden analizar a la vez Uso para preparación de inóculos Evaluación de vacunas Alto costo Detecta un bajo numero de copias y esto es bueno sobre todos cuando hay serologias negativas.
  • 36. PCR en Tiempo Real Cada copia de ADN producida emite una unidad de fluorescencia,la cual es captada por un lector laser que es decodificada por un software.
  • 37. Limitantes Inversión inicial costosa. Entrenamiento de personal Áreas de trabajo, personal y equipo, exclusivo para el PCR. Por su costo, no debe utilizarse como una prueba tamiz.
  • 38. Factores a considerar: •Calidad de la muestra •Calidad en el envío de la muestra •Presencia de DNAasa y RNAasa •Metodología utilizada (preparación casera vs Kits Comerciales) •Necesito almacenar la muestra? •Cuando fue tomada la muestra? NO HAY PRUEBAS 100% SENSIBLES Y ESPECIFICAS
  • 39. RFLps Secuenciacion Diversidad genética entre cepas europeas, americanas y diferencias de vacunas. Comparar 2 virus de la misma granja en diferentes momentos para saber si es el mismo. Comparar 2 virus de diferente origen: el de la granja y el de los animales introducidos.
  • 40. Secuenciación del PRRSV y estudios filogenéticos Determinar la secuencia completa o parcial del genoma 1… CGGGACTGTCGATTGATCAGCTAGCTA AATCGATCGTCT AAAAGCTAGCTCTTGTGCGCGTGATCG ATCGATCG…15421 15421 nucleótidos SOLO ORF 5 13788… CGGGATTGATCAAAGCTAGCCCGTATA AATCGATC GTCTAAAAGCTAGCTCTTCGTGATCGA TCGTTTTCG…14390
  • 41. Secuenciación del PRRSV y estudios filogenéticos Para que sirve conocer las secuencias del PRRS? Para compararlas entre diversos virus y determinar el grado de similitud Para evidenciar mutaciones genéticas/antigénicas Para investigación en genética molecular La secuenciación no es una técnica de diagnóstico
  • 42. Arbol filogenético basado en secuencias del ORF5 de cepas europeas -Diversidad genética en una región geográfica. -Evolución en los cambios genómicos de las cepas. Goubars IVPS 2010
  • 43. Dendograma antigénico de aislados de virus de PRRS No hubo relación entre los “clusters” antigénicos y genómicos de los aislados por lo tanto hay diversidad antigénica y no pueden definirse grupos Martinez-Lobo IPVS 2010 Dendograma genómico de aislados de virus de PRRS
  • 44. Inmunohistoquímica Detección del antígeno mediante un anticuerpo monoclonal, marcado con una enzima que se evidencia con un cromógeno.
  • 45. SEROLOGIA  Detecta exposición a enfermedades  Análisis de hato • No para individuos  Puede ayudar a establecer la edad de la infección  Programa de vacunación  NO se puede diferenciar el tipo de anticuerpos!!! • Anticuerpos vacunales (inmunidad activa) • Anticuerpos por infección (inmunidad activa)
  • 46. Diagnóstico de anticuerpos E.L.I.S.A. Inmunofluorescencia indirecta Seroneutralización Serología detectable 1 semana hasta un año
  • 47. E.L.I.S.A. Detección de anticuerpos indirectamente mediante la utilización de una enzima y con un sustrato forma un coloreado. Interpretación: Dependerá de acuerdo a la marca comercial utilizada
  • 48. E.L.I.S.A. Media IDEXX 2.8 Media HIPRA 220 200 2.4 160 Media S/P IDEXX 2 140 1.6 120 100 1.2 80 0.8 60 40 0.4 20 0 0 4 5 6 7 8 9 Edad (Semanas) 10 11 12 Media IRPC HIPRA 180
  • 49. Inmunofluorescencia indirecta Se emplean monoestratos infectados de cultivos celulares y un antisuero marcado con fluoresceína. Interpretación: Observación de una célula y/o colonia de células fluorescentes en su citoplasma
  • 50. El utilizar la combinación de E.L.I.S.A. con IFA es MAS sensible para determinar el status individual. Aplicación: Pie de cría MACHOS Usado rutinariamente antes de la introducción de machos a unidades libres si un animal sale positivo puede ser removido a tiempo.
  • 51. Seroneutralización Capacidad del suero problema para neutralizar la infectividad de una cantidad constante de virus en un cultivo celular. Interpretación: Presencia o ausencia de efecto citopático.
  • 52. Comparación entre pruebas serológicas Prueba Detección de anticuerpos Rango de positividad Tipo de Ig detectada E.L.I.S.A. 9-13 días Depende de la marca comercial Ig G IPMA 5-9 días Mayor a 20 Ig G IFA 7-11 días 5-7 días Mayor a 20 Ig G Ig M SN 28 días Mayor a 1:2 Ig G
  • 53. Economicamente, la más importante a nivel mundial
  • 54. Conclusiones Es una enfermedad que esta en “continuo movimiento”. Evolución en las cepas En el diagnóstico En el control La interacción con otras enfermedades
  • 55. ¡GRACIAS! rcarreonn@prodigy.net.mx

×