Van criekinge next_generation_epigenetic_profling_vvumc_uploaded

1,575 views

Published on

Next Generation Epigenetic Profiling

Published in: Education, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,575
On SlideShare
0
From Embeds
0
Number of Embeds
1,141
Actions
Shares
0
Downloads
23
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Van criekinge next_generation_epigenetic_profling_vvumc_uploaded

  1. 1. Next Generation Epigenetic Profiling Wim Van Criekinge 14th november 2013, Boston (US) 20th november 2013, Amsterdam
  2. 2. Overview   Epigene,cs   –   Introduc*on   –   Methyla*on  &  Oncology   –   Biomarkers     MDxHealth   – NEXT-­‐GENera*on  Epigene*c  Biomarkers   – Methyla*on  Based  CDx  
  3. 3. Actionable Epigenome
  4. 4. Outside Oncology ?
  5. 5. Historically,     Cancer  Was  Considered     to  be  Driven  Mostly  by  Gene,c  Changes     GENETIC   §  Muta*ons  in  p53     Example:   Replica,on  errors   §  Ac*va*ng  muta*ons  in  RAS   §  Muta*ons  or  amplifica*ons  of  the   X   X   Altered     DNA  sequence       Altered     DNA/mRNA/proteins   HER-­‐2  gene   §  Chromosomal  transloca*ons  in   Oncogenesis   myeloid  cells  and  the  genera*on  of   the  BCR-­‐ABL  fusion  protein   Tumor    
  6. 6. Epigene,c  Changes  are     Important  in  Causing  Cancer   GENETIC   EPIGENETIC   Example:     Chroma,n  modifica,on  errors   Example:   Replica,on  errors   X   X   Altered     DNA  sequence       Altered     DNA/mRNA/proteins   Altered   chroma,n  structure   Oncogenesis   Altered  levels  of   mRNA/proteins   Tumor  
  7. 7. Example  of  Methyla,on     vs  Muta,on:  Colon  &  Breast  Cancer   120   100   80   Dx 60   40   CDx 20   0   Methylated Mutated Source:  Schuebel  et  al    2007   76-100 51-75 21-50 1-20
  8. 8. MGMT Biology O6 Methyl-Guanine Methyl Transferase Essential DNA Repair Enzyme                     Removes alkyl groups from damaged guanine bases Healthy  individual:     -­‐  MGMT  is  an  essen*al  DNA  repair  enzyme   Loss  of  MGMT  ac*vity  makes  individuals  suscep*ble   to  DNA  damage  and  prone  to  tumor  development     Glioblastoma  pa,ent  on  alkylator  chemotherapy:     -­‐  Pa*ents  with  MGMT  promoter  methyla*on  show   have  longer  PFS  and  OS  with  the  use  of  alkyla*ng   agents  as  chemotherapy  
  9. 9. MGMT Promoter Methylation Predicts Benefit form DNA-Alkylating Chemotherapy Post-hoc subgroup analysis of Temozolomide Clinical trial with primary glioblastoma patients show benefit for patients with MGMT promoter methylation 25 Median  Overall  Survival   21.7 months 20 15 plus temozolomide 12.7 months radiotherapy 10 radiotherapy 5 0 Non-Methylated MGMT Gene Methylated MGMT Gene Adapted  from  Hegi  et  al.   NEJM  2005   352(10):1036-­‐8.   Study  with  207  pa*ents  
  10. 10. Clinical  Valida,on     of  MDxHealth  assay  RTOG  0525  Study   §  MGMT  was  measured  prospec*vely  in  the  RTOG  0525  study   §  MGMT  used  to  balance  the  arms  of  the  study  as  there  is  an   advantage  to  overall  survival  and  progression  free  survival  being   MGMT  methyla*on   §  Physicans  goal  in  this  study  was  to  compare  current   temozolomide  schedule  (Arm  1)  vs  a  dose-­‐dense  administra*on   of  temozolomide(Arm2).   §  The  dose  dense  schedule  was  hypothesized  as  being  able  to   overcome  the  unmethylated  MGMT  tumors  by  overwhelming   the  tumor  with  alkyla*on.   §  The  dose  dense  schedule  did  not  work.  
  11. 11. Outcomes  by   MGMT  Status-­‐   MDxHealth  Assay   100 Dead Total 162 244 Methylated Unmethylated 433 516 p (2-sided) =< 0.0001 HR (95% CI) =1.74 (1.45, 2.08) 75 Progression-free Survival (%) Overall Survival (%) 100 50 25 0 0 Patients at Risk Methy 244 Unmethy 516 12 24 36 Months after Randomization 168 104 37 295 106 28 48 6 6 Dead Total 202 244 Methylated Unmethylated 486 516 p (2-sided) =< 0.0001 HR (95% CI) =1.63 (1.38, 1.92) 75 50 25 0 0 Patients at Risk Methy 244 Unmethy 516 12 24 36 Months after Randomization 99 55 19 108 40 14 48 3 4 However  the  study  did  show  that  the  MDxHealth  assay  was  able  to  show  the  benefit   to  OS  and  PFS  with  the  MGMT  methylated  cohort.   Confiden*al   ASCO  2011,  Mark  R.  Gilbert,  MD   12  
  12. 12. Overview   Epigene,cs   –   Introduc*on   –   Methyla*on  &  Oncology   –   Biomarkers     MDxHealth   – NEXT-­‐GENera*on  Epigene*c  Biomarkers   Can  we  rediscover  MGMT  ?     What  does  the  epigenome  look  like  ?  
  13. 13. MBD_Seq   Condensed  Chroma*n   DNA  Sheared   DNA  Sheared   Immobilized     Methyl  Binding  Domain    
  14. 14. MBD_Seq   Immobilized     Methyl  binding  domain     MgCl2   Next  Gen  Sequencing   GA  Illumina:  100  million  reads  
  15. 15. Quality  evalua*on  of  Methyl  Binding  Domain  based   kits  for  enrichment  DNA-­‐methyla*on  sequencing   De  Meyer  et  al  (2013)     Plos  One     Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
  16. 16. MBD_Seq   MGMT  =  dual  core  
  17. 17. BRCA1,   a  bidirec,onal  promoter   18
  18. 18. Splice variants 19
  19. 19. Zooming  into     Exon  1   20
  20. 20. Zooming  into     Exon  1   21
  21. 21. Zooming  into     Exon  1   22
  22. 22. Genome-­‐wide  methyla,on     ….  by  next  genera,on  sequencing   #  markers   1-­‐2  million   methyla*on   cores     MBD_Seq   Discovery   #  samples  
  23. 23. Where  is  the  mC  ?   GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
  24. 24. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
  25. 25. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25%   50%   25%   GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
  26. 26. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25%   50%   25%   GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT Dense  methylated  needed  for  transcrip*onal  silencing   Are  there  alleles  with  all  three  posi4ons  methylated  ?  
  27. 27. Deep  Sequencing   unmethylated  alleles   methylated  alleles   less  methyla*on   more  methyla*on   GCATCGTGACTTACGACTGATCGATGGATGCTAGCAT!
  28. 28. Deep  Sequencing  MGMT  Heterogenic  complexity  
  29. 29. Data  integra,on  with       DEEP  Sequencing,  Infinium,  Reac,va,on,  (direc,onal)  Expression  …  
  30. 30. BRCA1   1 2 3 4 5 6 7 8 T47D BT549 MCF7 MDAMB231 HS578T NORMAL NORMAL NORMAL 31
  31. 31. 9 10 11 12 13 14 15 16 17 BI T21 (BRCA1 MUT) BI T22 (BRCA1 MUT) BLC BLC BLC BLC BLC BLC BLC
  32. 32. 13 BLC 14 BLC 15 BLC 16 BLC 17  BLC 18  BLC 19 IVM 20 DKO
  33. 33. Genome-­‐wide  methyla,on     ….  by  next  genera,on  sequencing   #  markers   MBD_Seq   Discovery   BT_Seq   Verifica*on   Valida*on   #  samples  
  34. 34. Gene,c  tes,ng   Whole-genome Bisulphite seq Probes (450-27K) Enrichment Targeted Panels MSP bp Full genome 109 108 107 106 Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 105 104 103 102 101 1
  35. 35. Gene,c  tes,ng   Instrument  and  Assay  providers           G   E   N   E   T   I   C   Whole-genome sequencing Enrichment seq (Exome) Enrichment Targeted Panels PCR bp Full genome 109 108 107 106 105 104 103 CLIA  Lab  service  providers   Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 102 101 1
  36. 36. Today     E   P   I         G   E   N   E   T   I   C   Whole-genome Bisulphite seq Enrichment seq (MBD, RRBS) Whole-genome sequencing Probes (450-27K) MSP Enrichment Targeted Panels Enrichment seq (Exome) Enrichment Targeted Panels PCR bp Full genome 109 108 107 106 RUO sequencing Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 105 104 103 102 101 1 Clinical PCR
  37. 37. New  Methods…     E   P   I         G   E   N   E   T   I   C   Whole-genome Bisulphite seq Enrichment seq (MBD, RRBS) Whole-genome sequencing Probes (450-27K) MSP Enrichment Targeted Panels Enrichment seq (Exome) Enrichment Targeted Panels PCR bp Full genome 109 108 107 106 RUO sequencing Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 105 104 103 102 101 1 Clinical PCR
  38. 38. Molecular  Unifica,on     E   P   I         G   E   N   E   T   I   C   Whole-genome Bisulphite seq Enrichment seq (MBD, RRBS) Whole-genome sequencing Probes (450-27K) Ultra Deep Enrichment Targeted Panels Enrichment seq (Exome) Enrichment Targeted Panels Deep   Seq   bp Full genome 109 RUO 108 107 106 105 104 103 Sequencing   Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 102 101 1 Clinical
  39. 39. 80.00% 60.00% 20.00% 0% IV Co p ies 50 55 60 65 Percentage Methylation Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 70 /A 45 ies 40 op 35 6.7 2 4.89 7 3.3 3.34 7 1. 0.9735 0.83 0.61 0.56 0.07 DKO CT B 7 30 75 80 TC 25 85 90 GM 20 95 M 15 100 SP 5 10 M 0 M 2 171 97.32 162 .71 22.1.54 18. 3 15.7 33 14 5 8. .87 Amount 40.00%
  40. 40. Molecular  Unifica,on     E   P   I         G   E   N   E   T   I   C   Whole-genome Bisulphite seq Enrichment seq (MBD, RRBS) Whole-genome sequencing Probes (450-27K) Ultra Deep Enrichment Targeted Panels Enrichment seq (Exome) Enrichment Targeted Panels Deep   Seq   bp Full genome 109 RUO 108 107 106 105 104 103 Sequencing   Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 102 101 1 Clinical
  41. 41. Epi-­‐health:  comprehensive  epigene,c  profiling     § Key  genes   – For  all  know  epigene*c  genes   – For  all  important  gene  classes  (CT  genes,  immune-­‐response)  
  42. 42. 440  cancer-­‐related  genes  genes  are  known  to   be  epigene*cally  altered  in  human  solid   cancers  based  on  recent  scien*fic  and  clinical   literature.     Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
  43. 43. Heyn, H. H. & Esteller, M. M. DNA methylation profiling in the clinic: applications and challenges. Nat. Rev. Genet. 13, 679–692 (2012). 44
  44. 44. Epigenetic Alterations Associated with Cancer Therapy Response PCFT – folate transport (MTX) WRN
  45. 45. Kinases,  CT  genes  ….   46
  46. 46. Epi-­‐health:  comprehensive  epigene,c  profiling     § Key  genes   – For  all  know  epigene*c  genes   – For  all  important  gene  classes  (CT  genes,  immune-­‐response)   § Key  regions     – Iden*fied  by  mining  epigenomes  
  47. 47. Data  integra,on   Correla,on  tracks     expression expression Corr =-1 Corr = 1 methylation methylation
  48. 48. Correla,on  track   in  GBM  @  MGMT   +1 -1
  49. 49. Epi-­‐health:  comprehensive  epigene,c  profiling     § Key  genes   – For  all  know  epigene*c  genes   – For  all  important  gene  classes  (CT  genes,  immune-­‐response)   § Key  regions   – Iden*fied  by  mining  epigenomes   § Approach   – Acceptable  amounts  of  clinical  material   – TAT/cost   § Analysis   – Ac*onable  interpreta*on   – Get  gene*c  data  as  a  bonus    
  50. 50. Molecular  Unifica,on   E P I Whole-genome Bisulphite seq G E N E T I C Whole-genome sequencing Enrichment seq (MBD, RRBS) Probes (450-27K) Ultra Deep Enrichment Targeted Panels Enrichment seq (Exome) Enrichment Targeted Panels Deep   Seq   bp Full genome 109 108 RUO 107 106 105 104 103 Sequencing   102 101 1 Clinical

×