Van criekinge next_generation_epigenetic_profling_vuppsala
Upcoming SlideShare
Loading in...5
×
 

Van criekinge next_generation_epigenetic_profling_vuppsala

on

  • 1,560 views

Epigenetic - PhD Programme Uppsala

Epigenetic - PhD Programme Uppsala

Statistics

Views

Total Views
1,560
Views on SlideShare
411
Embed Views
1,149

Actions

Likes
0
Downloads
3
Comments
0

2 Embeds 1,149

http://www.bioinformatics.be 1148
http://translate.googleusercontent.com 1

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Van criekinge next_generation_epigenetic_profling_vuppsala Van criekinge next_generation_epigenetic_profling_vuppsala Presentation Transcript

    • PhD programme Slides available www.bioinformatics.be
    • Lab for Bioinformatics and computational genomics 10 “genome hackers” mostly engineers (statistics) 42 scientists technicians, geneticists, clinicians >100 people hardware engineers, mathematicians, molecular biologists
    • Next Generation Epigenetic Profiling Wim Van Criekinge 12th december, Uppsala (SE)
    • Overview Epigenetics – Introduction – Methylation & Oncology – Biomarkers MDxHealth – NEXT-GENeration Epigenetic Biomarkers – PharmacoDX: Methylation Based Biomarkers for Predictive and Prognostic Use
    • The genome is just the start …
    • Defining Epigenetics Genome DNA   Chromatin Epigenome Gene Expression Phenotype   Reversible changes in gene expression/function Without changes in DNA sequence Can be inherited from precursor cells Allows to integrate intrinsic with environmental signals (including diet)
    • DNA Methylation Differentiates Totipotent Embryonic Stem Cells from Unipotent Adult Stem Cells Alex Meissner, Henry Stewart Talks
    • Reprogramming the DNA methylome Paula Vertino, Henry Stewart Talks
    • Transgenerational inheritence
    • Actionable Epigenome
    • 250 different cell types Epigenetic (meta)information = stem cells
    • Cellular programming Epigenetic (meta)information = stem cells
    • Outside Oncology ?
    • Historically, Cancer Was Considered to be Driven Mostly by Genetic Changes GENETIC  Mutations in p53 Example: Replication errors  Activating mutations in RAS  Mutations or amplifications of the X X HER-2 gene Altered DNA sequence  Chromosomal translocations in Altered DNA/mRNA/proteins Oncogenesis myeloid cells and the generation of the BCR-ABL fusion protein Tumor
    • Epigenetic Changes are Important in Causing Cancer GENETIC EPIGENETIC Example: Chromatin modification errors Example: Replication errors X X Altered chromatin structure Altered DNA sequence Altered DNA/mRNA/proteins Oncogenesis Altered levels of mRNA/proteins Tumor
    • Example of Methylation vs Mutation: Colon & Breast Cancer 120 100 80 Dx 60 40 CDx 20 0 Methylated Mutated Source: Schuebel et al 2007 76-100 51-75 21-50 1-20
    • MGMT Biology O6 Methyl-Guanine Methyl Transferase Essential DNA Repair Enzyme Removes alkyl groups from damaged guanine bases Healthy individual: - MGMT is an essential DNA repair enzyme Loss of MGMT activity makes individuals susceptible to DNA damage and prone to tumor development Glioblastoma patient on alkylator chemotherapy: - Patients with MGMT promoter methylation show have longer PFS and OS with the use of alkylating agents as chemotherapy
    • MGMT Promoter Methylation Predicts Benefit form DNA-Alkylating Chemotherapy Post-hoc subgroup analysis of Temozolomide Clinical trial with primary glioblastoma patients show benefit for patients with MGMT promoter methylation 25 Median Overall Survival 21.7 months 20 15 plus temozolomide 12.7 months radiotherapy 10 radiotherapy 5 0 Non-Methylated MGMT Gene Methylated MGMT Gene Adapted from Hegi et al. NEJM 2005 352(10):1036-8. Study with 207 patients
    • Overview Epigenetics – Introduction – Methylation & Oncology – Biomarkers MDxHealth – NEXT-GENeration Epigenetic Biomarkers Can we rediscover MGMT ? What does the epigenome look like ? ….
    • MBD_Seq Condensed Chromatin DNA Sheared DNA Sheared Immobilized Methyl Binding Domain
    • MBD_Seq Immobilized Methyl binding domain MgCl2 Next Gen Sequencing GA Illumina: 100 million reads
    • Quality evaluation of Methyl Binding Domain based kits for enrichment DNA-methylation sequencing De Meyer et al (2013) Plos One Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
    • Quality evaluation of Methyl Binding Domain based kits for enrichment DNA-methylation sequencing Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
    • MBD_Seq MGMT = dual core
    • Genome-wide methylation …. by next generation sequencing # markers 1-2 million methylation cores MBD_Seq Discovery # samples
    • BRCA1, a bidirectional promoter 27
    • Splice variants 28
    • Zooming into Exon 1 29
    • Zooming into Exon 1 30
    • Zooming into Exon 1 31
    • Where is the mC ? GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
    • GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
    • GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25% 50% 25% GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
    • GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25% 50% 25% GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT Dense methylated needed for transcriptional silencing Are there alleles with all three positions methylated ?
    • Deep Sequencing unmethylated alleles methylated alleles less methylation more methylation GCATCGTGACTTACGACTGATCGATGGATGCTA
    • Deep Sequencing MGMT Heterogenic complexity
    • Data integration with DEEP Sequencing, Infinium, Reactivation, (directional) Expression …
    • Data integration Correlation tracks expression expression Corr =-1 Corr = 1 methylation methylation
    • Correlation track in GBM @ MGMT +1 -1
    • BRCA1 1 2 3 4 5 6 7 8 T47D BT549 MCF7 MDAMB231 HS578T NORMAL NORMAL NORMAL 41
    • 9 10 11 12 13 14 15 16 17 BI T21 (BRCA1 MUT) BI T22 (BRCA1 MUT) BLC BLC BLC BLC BLC BLC BLC
    • 13 BLC 14 BLC 15 BLC 16 BLC 17 BLC 18 BLC 19 IVM 20 DKO
    • Genome-wide methylation …. by next generation sequencing # markers MBD_Seq Discovery BT_Seq Verification MSP Validation # samples
    • Genetics Whole-genome Bisulphite seq Probes (450-27K) Enrichment Targeted Panels MSP bp Full genome 109 108 107 106 Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 105 104 103 102 101 1
    • Genetics Instrument and Assay providers G E N E T I C Whole-genome sequencing Enrichment seq (Exome) Enrichment Targeted Panels PCR bp Full genome 109 108 107 106 105 104 103 CLIA Lab service providers Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 102 101 1
    • Molecular Unification E P I Whole-genome Bisulphite seq G E N E T I C Whole-genome sequencing Enrichment seq (MBD, RRBS) Probes (450-27K) Ultra Deep Enrichment Targeted Panels Enrichment seq (Exome) Enrichment Targeted Panels Deep Seq bp Full genome 109 108 RUO 107 106 105 104 103 Sequencing 102 101 1 Clinical
    • 236 cancer-related genes (3,769 exons) plus 47 introns from 19 genes often rearranged or altered in cancer. These genes are known to be somatically altered in human solid cancers based on recent scientific and clinical literature. Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
    • PubMeth.org Reviewed methylation database in cancer Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
    • Epigenetic Alterations Associated with Cancer Therapy Response PCFT – folate transport (MTX) WRN
    • 440 cancer-related genes genes are known to be epigenetically altered in human solid cancers based on recent scientific and clinical literature. Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
    • Molecular Unification E P I Whole-genome Bisulphite seq G E N E T I C Whole-genome sequencing Enrichment seq (MBD, RRBS) Probes (450-27K) Ultra Deep Enrichment Targeted Panels Enrichment seq (Exome) Enrichment Targeted Panels Deep Seq bp Full genome 109 108 RUO 107 106 105 104 103 Sequencing 102 101 1 Clinical
    • Acknowledgments Geert Trooskens Simon Denil Klaas Mensaert Jean-Pierre Renard Sarah De Keulenaer Ellen De Meester Tim De Meyer Wim van den Berghe Manon Van Engeland Jurgen Veeck Monika Hegi Pierre Bady Sebastian Kurscheid Olivier Thas 53
    • biobix wvcrieki biobix.be bioinformatics.be 54