Next Generation
Epigenetic Profiling
Wim Van Criekinge
10th octobre 2013, Lille (FR)
Overview
Epigenetics
– Introduction
– Methylation & Oncology
– Biomarkers
MDxHealth
–NEXT-GENeration Epigenetic Biomarkers...
Actionable
Epigenome
Outside
Oncology ?
Historically,
Cancer Was Considered
to be Driven Mostly by Genetic Changes
Example:
Replication errors
GENETIC
Altered
DNA...
Epigenetic Changes are
Important in Causing Cancer
Example:
Replication errors
GENETIC EPIGENETIC
Example:
Chromatin modif...
Source: Schuebel et al 2007
0
20
40
60
80
100
120
Methylated Mutated
76-100 51-75 21-50 1-20
Dx
CDx
Example of Methylation...
MGMT Biology
O6 Methyl-Guanine
Methyl Transferase
Essential DNA Repair Enzyme
Removes alkyl groups from damaged
guanine ba...
MGMT Promoter
Methylation Predicts
Benefit form DNA-Alkylating Chemotherapy
Post-hoc subgroup analysis of Temozolomide Cli...
Overview
Epigenetics
– Introduction
– Methylation & Oncology
– Biomarkers
MDxHealth
–NEXT-GENeration Epigenetic Biomarkers...
MBD_Seq
DNA Sheared
Immobilized
Methyl Binding Domain
Condensed Chromatin
DNA Sheared
Immobilized
Methyl binding domain
MgCl2
Next Gen Sequencing
GA Illumina: 100 million reads
MBD_Seq
Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
Quality evaluation of Methyl Binding Domain
based kit...
Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
Quality evaluation of Methyl Binding Domain based
kit...
MBD_Seq
MGMT = dual core
# samples
# markers
MBD_Seq
Genome-wide methylation
…. by next generation sequencing
Discovery
1-2 million
methylation
cor...
BRCA1,
a bidirectional promoter
18
19
Splice variants
Zooming into
Exon 1
20
Zooming into
Exon 1
21
Zooming into
Exon 1
22
GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
Where is the mC ?
GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
25% 50% 25%
GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
25% 50% 25%
GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
GCATCGTGACTAGCGACTGATCGATGGATGCTAG...
GCATCGTGACTTACGACTGATCGATGGATGCTA
unmethylated alleles
less methylationmethylated alleles
more methylation
Deep Sequencing
Deep Sequencing MGMT Heterogenic complexity
Data integration with
DEEP Sequencing, Infinium, Reactivation, (directional) Expression …
Data integration
Correlation tracks
methylation methylation
expression expression
Corr =-1 Corr = 1
Correlation track
in GBM @ MGMT
+1
-1
BRCA1
32
1 T47D
2 BT549
3 MCF7
4 MDAMB231
5 HS578T
6 NORMAL
7 NORMAL
8 NORMAL
9 BI T21 (BRCA1 MUT)
10 BI T22 (BRCA1 MUT)
11 BLC
12 BLC
13 BLC
14 BLC
15 BLC
16 BLC
17 BLC
13 BLC
14 BLC
15 BLC
16 BLC
17 BLC
18 BLC
19 IVM
20 DKO
# samples
# markers
MBD_Seq
BT_Seq
MSP
Genome-wide methylation
…. by next generation sequencing
Discovery
Verification
Val...
Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
Genetics
107 106 105 104 103 102 101 1108109
Full gen...
Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
Genetics
107 106 105 104 103 102 101 1108109
Full gen...
Sequencing
Deep
Seq
Molecular Unification
107 106 105 104 103 102 101 1108109
Full genome bp
Whole-genome
Bisulphite seq
R...
Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
236 cancer-related genes
(3,769 exons) plus 47 intron...
Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
PubMeth.org
Reviewed methylation database in cancer
Epigenetic Alterations
Associated with Cancer Therapy Response
PCFT – folate
transport (MTX)
WRN
Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
440 cancer-related genes genes are known to
be epigen...
Sequencing
Deep
Seq
Molecular Unification
107 106 105 104 103 102 101 1108109
Full genome bp
Whole-genome
Bisulphite seq
R...
Acknowledgments
44
Geert Trooskens
Simon Denil
Klaas Mensaert
Jean-Pierre Renard
Sarah De Keulenaer
Ellen De Meester
Tim D...
45
biobix
wvcrieki
biobix.be
bioinformatics.be
Van criekinge next_generation_epigenetic_profling_vlille
Upcoming SlideShare
Loading in …5
×

Van criekinge next_generation_epigenetic_profling_vlille

939
-1

Published on

Next generation epigenetic profiling

Published in: Education, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
939
On Slideshare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
25
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Van criekinge next_generation_epigenetic_profling_vlille

  1. 1. Next Generation Epigenetic Profiling Wim Van Criekinge 10th octobre 2013, Lille (FR)
  2. 2. Overview Epigenetics – Introduction – Methylation & Oncology – Biomarkers MDxHealth –NEXT-GENeration Epigenetic Biomarkers –PharmacoDX: Methylation Based Biomarkers for Predictive and Prognostic Use
  3. 3. Actionable Epigenome
  4. 4. Outside Oncology ?
  5. 5. Historically, Cancer Was Considered to be Driven Mostly by Genetic Changes Example: Replication errors GENETIC Altered DNA/mRNA/proteins Altered DNA sequence X X Oncogenesis Tumor  Mutations in p53  Activating mutations in RAS  Mutations or amplifications of the HER-2 gene  Chromosomal translocations in myeloid cells and the generation of the BCR-ABL fusion protein
  6. 6. Epigenetic Changes are Important in Causing Cancer Example: Replication errors GENETIC EPIGENETIC Example: Chromatin modification errors Altered DNA/mRNA/proteins Altered DNA sequence Altered levels of mRNA/proteins Altered chromatin structure X X Oncogenesis Tumor
  7. 7. Source: Schuebel et al 2007 0 20 40 60 80 100 120 Methylated Mutated 76-100 51-75 21-50 1-20 Dx CDx Example of Methylation vs Mutation: Colon & Breast Cancer
  8. 8. MGMT Biology O6 Methyl-Guanine Methyl Transferase Essential DNA Repair Enzyme Removes alkyl groups from damaged guanine bases Healthy individual: - MGMT is an essential DNA repair enzyme Loss of MGMT activity makes individuals susceptible to DNA damage and prone to tumor development Glioblastoma patient on alkylator chemotherapy: - Patients with MGMT promoter methylation show have longer PFS and OS with the use of alkylating agents as chemotherapy
  9. 9. MGMT Promoter Methylation Predicts Benefit form DNA-Alkylating Chemotherapy Post-hoc subgroup analysis of Temozolomide Clinical trial with primary glioblastoma patients show benefit for patients with MGMT promoter methylation 0 5 10 15 20 25 Median Overall Survival 21.7 months 12.7 months radiotherapy plus temozolomide Methylated MGMT Gene Non-Methylated MGMT Gene radiotherapy Adapted from Hegi et al. NEJM 2005 352(10):1036-8. Study with 207 patients
  10. 10. Overview Epigenetics – Introduction – Methylation & Oncology – Biomarkers MDxHealth –NEXT-GENeration Epigenetic Biomarkers Can we rediscover MGMT ? What does the epigenome look like ? ….
  11. 11. MBD_Seq DNA Sheared Immobilized Methyl Binding Domain Condensed Chromatin DNA Sheared
  12. 12. Immobilized Methyl binding domain MgCl2 Next Gen Sequencing GA Illumina: 100 million reads MBD_Seq
  13. 13. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. Quality evaluation of Methyl Binding Domain based kits for enrichment DNA-methylation sequencing De Meyer et al (2013) Plos One
  14. 14. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. Quality evaluation of Methyl Binding Domain based kits for enrichment DNA-methylation sequencing
  15. 15. MBD_Seq MGMT = dual core
  16. 16. # samples # markers MBD_Seq Genome-wide methylation …. by next generation sequencing Discovery 1-2 million methylation cores
  17. 17. BRCA1, a bidirectional promoter 18
  18. 18. 19 Splice variants
  19. 19. Zooming into Exon 1 20
  20. 20. Zooming into Exon 1 21
  21. 21. Zooming into Exon 1 22
  22. 22. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT Where is the mC ?
  23. 23. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
  24. 24. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25% 50% 25% GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
  25. 25. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25% 50% 25% GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT Dense methylated needed for transcriptional silencing Are there alleles with all three positions methylated ?
  26. 26. GCATCGTGACTTACGACTGATCGATGGATGCTA unmethylated alleles less methylationmethylated alleles more methylation Deep Sequencing
  27. 27. Deep Sequencing MGMT Heterogenic complexity
  28. 28. Data integration with DEEP Sequencing, Infinium, Reactivation, (directional) Expression …
  29. 29. Data integration Correlation tracks methylation methylation expression expression Corr =-1 Corr = 1
  30. 30. Correlation track in GBM @ MGMT +1 -1
  31. 31. BRCA1 32 1 T47D 2 BT549 3 MCF7 4 MDAMB231 5 HS578T 6 NORMAL 7 NORMAL 8 NORMAL
  32. 32. 9 BI T21 (BRCA1 MUT) 10 BI T22 (BRCA1 MUT) 11 BLC 12 BLC 13 BLC 14 BLC 15 BLC 16 BLC 17 BLC
  33. 33. 13 BLC 14 BLC 15 BLC 16 BLC 17 BLC 18 BLC 19 IVM 20 DKO
  34. 34. # samples # markers MBD_Seq BT_Seq MSP Genome-wide methylation …. by next generation sequencing Discovery Verification Validation
  35. 35. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. Genetics 107 106 105 104 103 102 101 1108109 Full genome bp Whole-genome Bisulphite seq MSP Probes (450-27K) Enrichment Targeted Panels
  36. 36. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. Genetics 107 106 105 104 103 102 101 1108109 Full genome bp G E N E T I C Whole-genome sequencing Enrichment seq (Exome) PCR Enrichment Targeted Panels Instrument and Assay providers CLIA Lab service providers
  37. 37. Sequencing Deep Seq Molecular Unification 107 106 105 104 103 102 101 1108109 Full genome bp Whole-genome Bisulphite seq RUO Clinical E P I G E N E T I C Whole-genome sequencing Enrichment seq (MBD, RRBS) Enrichment seq (Exome) Probes (450-27K) Enrichment Targeted Panels Enrichment Targeted Panels Ultra Deep
  38. 38. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 236 cancer-related genes (3,769 exons) plus 47 introns from 19 genes often rearranged or altered in cancer. These genes are known to be somatically altered in human solid cancers based on recent scientific and clinical literature.
  39. 39. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. PubMeth.org Reviewed methylation database in cancer
  40. 40. Epigenetic Alterations Associated with Cancer Therapy Response PCFT – folate transport (MTX) WRN
  41. 41. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 440 cancer-related genes genes are known to be epigenetically altered in human solid cancers based on recent scientific and clinical literature.
  42. 42. Sequencing Deep Seq Molecular Unification 107 106 105 104 103 102 101 1108109 Full genome bp Whole-genome Bisulphite seq RUO Clinical E P I G E N E T I C Whole-genome sequencing Enrichment seq (MBD, RRBS) Enrichment seq (Exome) Probes (450-27K) Enrichment Targeted Panels Enrichment Targeted Panels Ultra Deep
  43. 43. Acknowledgments 44 Geert Trooskens Simon Denil Klaas Mensaert Jean-Pierre Renard Sarah De Keulenaer Ellen De Meester Tim De Meyer Olivier Thas Wim van den Berghe Manon Van Engeland Jurgen Veeck Monika Hegi Pierre Bady Sebastian Kurscheid
  44. 44. 45 biobix wvcrieki biobix.be bioinformatics.be
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×