Thesis biobix

1,002 views

Published on

Published in: Education, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,002
On SlideShare
0
From Embeds
0
Number of Embeds
562
Actions
Shares
0
Downloads
10
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Thesis biobix

  1. 1. Master thesis @ BioBix
  2. 2. What the f*#@$k are we working on (aka, TOPICS): • Small stuff does matter… • Does translation start at ATG? • Nuclear translation, ay caramba? • (R)Evolutionary • Hunt epigenetics for imprinted loci • Cardiovascular epigenomics
  3. 3. Small stuff does matter… Canonical bio-active peptides: -cleaved from precursor -signal peptide @ N-terminus -secretory pathway ! Micropeptides: -translated directly from sORF -lacking signal sequence -released in cytoplasm Polaris: 3 peptides: 8, 9, 36 AA Rotundifolia4: 1 peptide: 53 AA Enod40: 2 peptides: 12 and 24 AA Tarsal-less/pri: 4 peptides: 11 and 32 AA
  4. 4. Small stuff does matter… Mus musculus (common house mouse) Build discovery strategy Extrapolate strategy 160 Mbp ➡ Examples for validation are available ➡ model systems ➡ L2 and L3 type larvae ➡ Embryonic stages between 10-16h ➡ 3 Gbp between 8 and 12 days past coitus (dpc) ➡ samples
  5. 5. Small stuff does matter… (Crappé J. et al., BMC Genomics, 2013)
  6. 6. Does translation start at ATG? Mass spectrometry NGS: RNA-seq
  7. 7. Does translation start at ATG?
  8. 8. (1) (3) (4) Does translation start at ATG? (1) Generation of cell extracts in which ribosomes have been faithfully halted along the mRNA they are translating in vivo
 (2) Nuclease digestion of RNAs that are not protected by the ribosome followed by recovery of the ribosome-protected mRNA fragments
 (2) (3)Quantitative conversion of the protected RNA fragments into a DNA library
 (4)That can be analyzed by deep sequencing (Ingolia N. et al., Nature Protocols, 2012) (Ingolia N. et al., Cell, 2011) - Harringtonine - Lactimidomycin (LTM) (Lee S. et al., PNAS, 2012) (Fritch C. et al., Gen. Research, 2012) - Puromycin ! causes ribosome accumulation at translation initiation site (TIS)
  9. 9. Does translation start at ATG? (1) 65% of transcripts contain more than 1 detectable TIS (mESC) (16% ≥ 4) 
 --> Complexity of Proteome
 (2) N-terminal truncations and/or extensions Alternate reading frames (internal out-of-frame), alternative splice isoforms uORFs (regulation downstream initiation) ! (3) Often @ near-cognate initiation sites n =13.454 (Ingolia N. et al., Cell, 2011)
  10. 10. Nuclear translation, ay caramba?
  11. 11. (R)Evolutionary epigenetics
  12. 12. (R)Evolutionary epigenetics
  13. 13. Hunt for imprinted loci DNA-(hydroxy)methylatie ChIP-seq
  14. 14. Cardiovascular epigenomics (TTAGGG)n'
  15. 15. Cardiovascular epigenomics
  16. 16. Where can you help out? • Bioinformatics: 1. tool/pipeline development 2. data analysis/integration (computational genomics) 3. algorithm development • Technological 4. aspects: NGS and MS xxx-seq, (replace xxx with MBD/RNA/RIBO/RRBS/ CHIP) or Mass Spectrometry
  17. 17. Where can you help out? Example: Bioinformatics, tool/pipeline development - Use RIBO-seq translation synthesis products as search space for MS/MS based proteomics/peptidomics - Construct a user-friendly, robust and fast pipeline to do the conversion - Both scripting based and implementation in Galaxy-P
  18. 18. Where can you help out? Example: Bioinformatics, tool/pipeline development
  19. 19. Example: Bioinformatics, tool/pipeline development Results: (1) 45 LC runs resulting in 68.523 MS/MS spectra (2) Different translation product types Ribo-seq N-terminomics 259$ 16$ 4$ 1$ 3$ 1556$ n =13.454 n =1.835 (Menschaert G. et al., Mol & Cell Prot, 2013)
  20. 20. Example: Bioinformatics, tool/pipeline development (3) Start codon: both cognate and near-cognate 1.0 ACG 0.0 G TG G C A A C G C T TA C G T 1.0 probability bits 2.0 T 0.5 G TG GA ACCG A GTAC C 0.0 TGT TC T C A 5 Kozak  mo(f:[A/G]CCatgG[not  T] Based on new N-term-ext and uORF identifications T C A 5 WebLogo 3.3 WebLogo 3.3 (4) Example: HDGF_MOUSE (n-term-ext, near-cognate start site) GTG GTG TTG HDGF  (hsa)   stomach& skin& spleen& heart& kidney& intes*ne& lung& 46# 40#kDa# 38#kDa# 36.5#kDa# HDGF  (mmu)     (V)AAPELASGAGIEAGAAR (|)||||| || ||||||| (V)AAPELGPGATIEAGAAR liver& tes*s& GCCGTGTGTTGCCCACCGCGCCCGGCCCTGTCCGA GCGGCGCGCGGGCGCAGACGCCGTGGCTGCCCCGG AGCTCGCGTCGGGGGCCGGCATCGAGGCGGGGGCC GCGCGAGGGCCGGAGCGCAGCGGCGCCGCAACCGC CGCACGCGCAAACTTGGGCTCGCGCTTCCCGGCTC GGCGCGGAGCCCGGGGCGCCCGCGGCCCCGCCATG TCGCGATCCAACCGGCAGA… brain& uc008ptc.1   muscle& ATG 32# HDGF% (Menschaert G. et al., Mol & Cell Prot, 2013)
  21. 21. (International) collaborations: • VIB (Medical Proteomics Group: ribosome profiling and MS) • VITO (Mass Spectrometry: small stuff) • NXTGNT • Asklepios (UGent sequencing facility) study investigators group • Weissman lab, Fenyö lab (US: ribosome profiling, cancer proteogenomics, MS)
  22. 22. More info @: • where are we:
 www.biobix.be
 general info on the lab
 topics online, your input ?
 www.nucleotides2networks.be • where are we physically:
 Building A, 2nd floor, Room 004 symposium, 29th of November: 
 “Bridging the gap between two omics worlds, transcriptomics and proteomics”
 invitation will follow/be posted on the biobix.be • Mini

×